CN105695502A - Application of RDR gene in control of plant flowering time - Google Patents
Application of RDR gene in control of plant flowering time Download PDFInfo
- Publication number
- CN105695502A CN105695502A CN201610171667.7A CN201610171667A CN105695502A CN 105695502 A CN105695502 A CN 105695502A CN 201610171667 A CN201610171667 A CN 201610171667A CN 105695502 A CN105695502 A CN 105695502A
- Authority
- CN
- China
- Prior art keywords
- gene
- arabidopsis
- rdr
- plant
- atrdr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses the application of RDR gene in control of plant flowering time. The RDR gene is RDR gene (At5g24290) of rape (BnaC07g30170D) or arabidopsis thaliana. In the arabidopsis thaliana, the expression disturbing homologous gene AtRDR shows late-flowering phenotype, and overexpression AtRDR or BnRDR shows early-flowering phenotype. In the rape, the overexpression of AtRDR or BnRDR gene enables the rape to flower early; therefore, both of the rape BnRDR and the arabidopsis thaliana AtRDR have a function of regulating and controlling the plant flowering time. Early-flowering plants can be obtained by overexpressing the RDR gene by a genetic engineering technology, and late-flowering plants can be obtained by disturbing the expression of the RDR gene. The RDR gene can be used for culturing the early-maturing or late-maturing varieties of the rape, and also can be taken as a marker for breeding the early-maturing or late-maturing varieties of the rape.
Description
Technical field
The present invention relates to plant genetic engineering and biological technical field。It is specifically related to the application in controlling the plant blossom time of the RDR gene。
Background technology
Brassica campestris L is one of big oil crop in the world four。World's rape cultivation area has reached 20,000,000 hectares, China's rape cultivation area is throughout the year stable at 7,000,000 hectares, area and Zong Chanjunju Rape-seed production state first place, account for the world 1/3 (The Ministry of Agriculture of the People's Republic of China, MOA. Chinese agriculture statistics. Beijing: Chinese agriculture publishing house, 2007)。Due to Brassica campestris L important strategic status in cropping system and national economy, Rape-seed production is subject to the attention of more and more national。Brassica campestris L is the oil crop in winter that south China is main, the main and shift of crops multiple cropping such as Oryza sativa L., Cotton Gossypii。But because period of duration is longer, having contradiction in season with double rice cropping system three crops per annual, lack late sowing (mid or late October sowing) and early receive the rape variety of (mid or late April results) after receiving because of double cropping of rice, a lot of double-ridged horn are Winter paddy field。Therefore the Brassica campestris L early-maturing variety that the selection-breeding ripe phase is suitable is needed。Additionally, precocious Brassica campestris L maturation is early, it is possible to avoid the high temperature of late growth stage to force the harm of the disasters such as ripe or hot dry wind, or alleviate extent of injury, and can be succession crop early suddenly, it is ensured that the stable high yield of succession crop, thus improving grain and oil week annual production (Wang Biqing, kingdom Chinese scholartree, precocious Brassica campestris L physio-biochemical characteristics progress, crop investigations, 2011,, 25 (3): 269-273)。The research of official's spring cloud et al. shows that Brassica campestris L early-maturing variety has the advantage that 1) Brassica campestris L early-maturing variety maturation early, be the fundamental way solving double cropping of rice with Brassica campestris L contradiction in season；2) the resistance to late sowing of Brassica campestris L early-maturing variety, before the winter, growing way is much stronger than late-maturing variety；3) Brassica campestris L early-maturing variety maturation is early, May early and middle ten days high temperature can be avoided and force ripe, all higher (the official's spring cloud of thousand grain weigth and oil content, Chen member, Wu Mingliang, south double rice cropping system winter rape early-maturing variety selection-breeding and Mechanical culture progress, China's engineering science, 2010,12 (2): 5-10)。
Domestic and international prematureness breeding, it is important that carry out florescence selection。The research such as Liu Houli shows that the general kind of autumn sowing cabbage type rape is ripe about spending the later moon eventually, and areal, general early-maturing variety productive phase is longer, and at more than 30-40d, late variety productive phase is shorter, at about 25-30d。What judge the period of maturation with the whole florescence is reliable sooner or later。Initial bloom stage is sooner or later, it is possible to as the reference judging the period of maturation。High forever equal once the florescence of early-set Line and ripe phase being carried out relativity determination and show, initial bloom stage and period of maturation, the correlation coefficient in whole florescence and period of maturation all reaches pole significant level。1975 respectively 0.711 and 0.454,1978 respectively 0.591 and 0.530 (Liu Houli. the heredity of Brassica campestris L and breeding, Shanghai science tech publishing house, 1985.338-339.)。The Brassica campestris L early flowering season, early then also early thus maturation was also early the whole florescence, the correlation coefficient in early flowering season and whole florescence and early flowering season and period of maturation respectively 0.695 and 0.562, all reached pole significant level。Therefore early flowering season and whole florescence all can as period of duration select according to (Bai Shuping. cabbage type rape Early mature apricot test tube selects pre-test, Gansu Agriculture University's journal, 1994,29 (2): 193-194.)。Brassica campestris L flowering time is the important indicator determining its period of maturation sooner or later as can be seen here。More early, the period of maturation is more early for flowering time。The promotion precocious functional gene of Brassica campestris L or molecular marker can be tested and appraised and cultivate to realize Brassica campestris L early-maturing variety。
In the growth and development process of plant, including nourishing and growing and two stages of reproductive growth, and blooming is that plant is by the most important process changed to generative growth phase of nourishing and growing。Plant is in order to successfully multiply, and except needs accumulate enough nutrition, also to select to bloom under suitable external environmental condition。The flower induction process of higher plant is limited mainly by internal factor and outside environmental elements two aspect determines, internal factor mainly includes endotrophic hormonal readiness and genetic factor, and external factor mainly has the duration of day and temperature。Plant blooms in good time, is under internal and external factor combined effect, and by floral genes sequential expression over time and space, and then regulate what plant tip meristem development completed。Along with molecular biological development, researcher is furtherd investigate for model organism arabidopsis, has resolved the molecular network of flowering of plant time-controllable in detail。Existing result of study shows, arabidopsis (Arabidopsisthaliana) there is more than 80 gene loci can affect flowering time, wherein nearly 20 with spend relevant (KoornneefM.Alonso-BlancoC evening, Blankestijn-deVriesH, HanhartCJ, PeetersAJ, Geneticinteractionsamonglate-floweringmutantsofArabidops is.Genetics, 1998,148 (2): 885-892)。Known arabidopsis flowering time regulatory molecule network is mainly constituted (MouradovA. by Photoperiod pathway (Photoperiodpathway), vernalization approach (Vernalizationpathway), autonomous pathway (Autonomouspathway) and four approach of gibberellin pathway (Gibberellinpathway), CremerF, CouplandG., Controloffloweringtime:interactingpathwaysasabasisfordiv ersity.PlantCell, 2002,14:S111-S130；SimpsonG.G.andCarolineDean, Arabidopsis, theRosettastoneoffloweringtime？Science, 2002,296 (5566): 285-289)。2009, researcher also been proposed the Article 5 signal path of miRNA involved in plant flowering time regulation and control, is called old and feeble path (Agingpathway；WangJ.W.CzechB, WeigelD, miR156-regulatedSPLtranscriptionfactorsdefineanendogenou sfloweringpathwayinArabidopsisthaliana.Cell, 2009,138:738-749)。
Photoperiod pathway is to study to obtain a clearest complete flowering regulation pathways。Photoperiod pathway starts from the photoreceptors impression to optical signal。Known plants has three kinds of light receptors, and they are phytochrome, blue light receptor and ultraviolet light receptor。Phytochrome (phytochrome, phy) absorbs HONGGUANG and far-red light, and wave-length coverage is 600-750nm；Blue light receptor comprises cryptochrome (cryptochrome, cry) and the light element (phototropin, phot) that becomes, and they are responsible for absorbing blue light and ultraviolet light A (UV-A), and wave-length coverage is 320-500nm；Also having a class is ultraviolet B (UV-B) receptor, absorbs UV-B, and wave-length coverage is 282～320nm。Research finds, in arabidopsis, phytochrome gene has PHYA, PHYB, PHYC, PHYD, PHYE totally 5, cryptochrome gene has CRY1 and CRY2, the light plain gene that becomes has PHOT1 and PHOT2, UV-B light receptor gene is UVR8 (BriggsWR.OlneyMA., Photoreceptorsinplantphotomorphogenesistodate.Fivephytoc hromes, twocryptochromes, onephototropin, andonesuperchrome.PlantPhysiol., 2001,125:85-88)。In Photoperiod pathway, light receptor can experience the light source of different wave length and the change of day-night length, and optical signal passes to biological clock, produces Circadian Rhythm。After downstream gene GIGANTEA (GI) experiences Diurnal blood pressure rhythm, signal is passed to transcription factor CONSTANS (CO), and then induce the expression of its Target genes FLOWERINGLOCUST (FT), thus realizing the photoperiod regulation and control (SimpsonG.G.SimpsonG.G.andCarolineDean to flowering time, Arabidopsis, theRosettastoneoffloweringtime？Science, 2002,296 (5566): 285-289)。Plant experiences change in optical signal by above three big light receptor systems, and then multiple physiological process (SmithH. such as the foundation of participation adjustment seed germination, establishing of seedling morphology, photosynthetical system and flowering time, Phytochromesandlightsignalperceptionbyplants-anemergings ynthesis.Nature, 2000,407:585-591)。
K cryogenic treatment a period of time, it is possible to promoting flowering of plant, this phenomenon is referred to as vernalization。In nature, most overwintering plants bloom and are required for vernalization, such as winter wheat, winter rape etc.。And many crops also evolve out need not the kind of vernalization, such as spring wheat, spring rape etc.。Sung etc. are based on the epistasis inhibition (SungS.AmasinoRM. having researched and proposed vernalization of arabidopsis; VernalizationinArabidopsisthalianaismediatedbythePHDfing erproteinVIN3.Nature; 2004; 427 (6970): 159-164): in vernalization process; first VERNALIZATIONINDEPENDENT3 (VIN3) initial set protein methyltransferase complex (HDAC) deacetylation function, reduces FLOWERINGLOCUSC (FLC) chromatinic specific regions Acetylation Level；Subsequently, it is combined with the HDAC of VERNALIZATION1 (VRN1) and VERNALIZATION2 (VRN2) component to methylate modification two acid residues sites of FLC histone H 3 K9 and H3K27, thus suppressing the high level expression of FLC, promote flowering of plant；Simultaneously, it is understood that there may be recruit heterochromatin protein HP1, cause that FLC is in the inhibition heterochromatin state of energy stable existence。It addition, plant also is able to be produced K cryogenic treatment " memory effect " by this mechanism。
After the approach such as the photoperiod when plant are obstructed, autonomous pathway plays a role, and experiences the developmental condition change within plant, combining environmental signal, Accelerate bloom。Arabidopsis is cloned into FCA, FY, FLD, FPA, seven gene (AukermanM.J.LeeI such as FVE, LD and FLK in succession, WeigelD, AmasinoRM, TheArabidopsisflowering-timegeneLUMINIDEPENDENSisexpress edprimarilyinregionsofcellproliferationandencodesanuclea rproteinthatregulatesLEAFYexpression.PlantJ., 1999,18 (2): 195-203；ChenR.ZhangSuzhi, SunShulan, ChangJianhong, ZuoJianru, CharacterizationofanewmutantalleleoftheArabidopsisflower inglocusD (FLD) genethatcontrolsthefloweringtimebyrepressingFLC.ChineseS cienceBulletin, 2005,50 (23): 2701-2706；LimM.H.KimJ, KimYS, ChungKS, SeoYH, LeeI, KimJ, HongCB, KimHJ, ParkCM., ANewArabidopsisgene, FLK, encodesanRNAbindingproteinwithKhomologymotifsandregulate sfloweringtimeviaFLOWERINGLOCUSC.PlantCell, 2004,16 (3): 731-740；MacknightR.BancroftI, PageT, ListerC, SchmidtR, LoveK, WestphalL, MurphyG, ShersonS, CobbettC, DeanC., FCA, agenecontrollingfloweringtimeinArabidopsis, encodesaproteincontainingRNA-bindingdomains.Cell, 1997,89 (5): 737-745；QuesadaV.MacknightR, DeanC, SimpsonGG., AutoregulationofFCApre-mRNAprocessingcontrolsArabidopsis floweringtime.EMBOJ., 2003,22 (12): 3142-3152), and these seven genes all modify to chromatin or RNA modifies relevant (AmasinoR.M., Floweringtime:apathwaythatbeginsatthe3 ' end.Curr.Biol., 2003,13 (17): R670-672)。Autonomous pathway is the same with vernalization approach, also it is the expression Accelerate bloom by suppressing FLC, but the two is not simple linear relationship, these genes of autonomous pathway are the function (MichaelsS.D.AmasinoRM. jointly being regulated and controled FLC by separate approach, LossofFLOWERINGLOCUSCactivityeliminatesthelate-flowering phenotypeofFRIGIDAandautonomouspathwaymutationsbutnotres ponsivenesstovernalization.PlantCell, 2001,13 (4): 935-941)。
Gibberellins (Gibberellin, GA), except controlling growth and development of plants, also has the critical function of regulation and control flowering time。Such as, GA biosynthesis mutant ga1, ga4 and ga5 show postponement and bloom, wherein ga1 more shows dwarfing and apical dominance such as weakens at the phenomenon (SunT.P.KamiyaY., TheArabidopsisga1locusencodesthecyciaseen-tkaurenesynthe taseofgibberellinbiosynthesis.PlantCell, 1994,6 (10): 1509-1518)。And deletion mutant gai, rga and the rgl1 of 3 key gene GIBBERELLICACIDINSENSITIVE (GAI) in GA signal transduction path, REPRESSOROFGA1-3 (RGA) and RGA-LIKE1 (RGL1) all show as early blossoming。GA biosynthesis pathway mutant is likely to block GA route of synthesis, thus reducing the inhibitory action to GAI, RGA and RGL1, ultimately results in late flower。So, GA synthesis mutant and GA signal pathway mutant can both affect flowering time。
Further investigation along with the regulation and control of miRNA involved in plant flowering time, there has been proposed the old and feeble path (WangZ.MaoH of flowering time regulation and control, DongC, JiR, CaiL, FuH, LiuS., OverexpressionofBrassicanapusMPK4EnhancesResistancetoScl erotiniasclerotioruminOilseedRape.MPMI, 2009,22 (3): 235-244；WuG.PoethigRS., TemporalregulationofshootdevelopmentinArabidopsisthalian abymiR156anditstargetSPL3.Development, 2006,133:3539-3547；YamaguchiA.WuMF, YangL, WuG, PoethigRS, WagnerD., ThemicroRNA-regulatedSBP-BoxtranscriptionfactorSPL3isadi rectupstreamactivatorofLEAFY, FRUITFULL, andAPETALA1.Dev.Cell, 2009,17:268-278)。Be not suitable for blooming breed the period of offspring owing to plant also exists one, now internal and external factor be not suitable for blooming。Researcher finds that " age " is particularly significant for blooming of plant, particularly xylophyta。For this annual herb plant of arabidopsis, there is also seedling and Photoperiod pathway signal cannot be produced a period of response, and old and feeble path take part in the regulation and control (MozleyD. of this process just, Developmentalandphotobiologicalfactorsaffectingphotoperi odicinductioninArabidopsisthalianaHeynh.Landsbergerecta. J.Exp.Bot., 46:173-179., 1995)。
In arabidopsis flower induction process, above-mentioned five regulatory pathways are not isolated existence, but the suppression each produced or Accelerate bloom signal are passed to SUPPRESSIONOFOVEREXPRESSIONOFCONSTANS1 (SOC1), these crucial integration factors of FT, LEAFY (LFY), and by regulating their expression height, activate or suppress the expression of downstream inflorescence meristem and floral organ gene, so that the needs of plant Adaptable growth to the full extent and growth。
Regulated and control network of blooming also has certain conservative in different plant species。Such as, Oryza sativa L. (Oryzasativa) Headingdate3a (Hd3a) gene and arabidopsis FT gene, it is all distance flowering signal (being also referred to as florigen), it can move to inflorescence meristem from vanes phloem, inducing flowering of plant (CorbesierL., Thequestforflorigen:areviewofrecentprogress.J.Exp.Bot., 2006,57:3395-3403；TamakiS.MatsuoS, WongHL, YokoiS, ShimamotoK., Hd3aproteinisamobilefloweringsignalinrice.Science, 2007,316:1033-1036)；And SOC1 and LFY is as the crucial integration factor in arabidopsis, Oryza sativa L. there is also OsMADS50 and the RFT1 of homology with it。Researcher passes through hereditism's means, Oryza sativa L. identifies a series of flowering time controlling gene with arabidopsis very high homology, and construct complete regulated and control network (KojimaS.TakahashiY, KobayashiY, MonnaL, SasakiT, ArakiT, YanoM., Hd3a, ariceorthologoftheArabidopsisFTgene, promotestransitiontofloweringdownstreamofHd1undershort-d ayconditions.PlantCellPhysiol., 2002,43:1096-1105；KomiyaR.IkegamiA, TamakiS, YokoiS, ShimamotoK., Hd3aandRFT1areessentialforfloweringinrice.Development, 2008,135:767-774)。Brassica genus other plant such as Brassica campestris Ls etc. and arabidopsis have the similarity of height on genome, and all belong to short-day plant, from arabidopsis, therefore identify that the flowering time control functional gene obtained can be effectively applied in the regulation and control of Brassica campestris L flowering time。
Therefore, the present invention develops a gene RDR controlling arabidopsis and Brassica campestris L flowering time。Arabidopsis disturbs the expression of homologous genes AtRDR (At5g24290) gene show late colored phenotype, and early blossoming phenotype occurs in process LAN AtRDR or BnRDR in arabidopsis。And interference AtRDR transgenic progeny arabidopsis in process LAN BnRDR gene, its flowering time can be made to return to consistent with wild type。The result of applicant imply that RDR is controlling Brassica campestris L and arabidopsis flowering time, creates in Brassica campestris L early-maturing variety and has suitable application prospect。
Summary of the invention
It is an object of the invention to the application that there are provided RDR gene in controlling the plant blossom time, the expression suppressing this gene can cause arabidopsis or Brassica campestris L late blooming, this gene of process LAN can make arabidopsis or Brassica campestris L bloom ahead of time, and described gene is cabbage type rape RDR gene (BnaC07g30170D) or arabidopsis RDR gene (At5g24290)。
It is also an object of the present invention to provide the preparation method that the artificial microRNA containing AtRDR gene target (AATUTUTATATUUTGTUGAG) sequence disturbs recombinant vector (RNAi-AtRDR), realized the suppression of RDR gene expression amount in arabidopsis。
Another object of the present invention is the preparation method that there are provided the recombinant vector (OX-AtRDR) containing AtRDR full length gene CDS sequence, realizes the lifting of RDR gene expression amount in arabidopsis and Brassica campestris L。
Another object of the present invention is the preparation method that there are provided the recombinant vector (OX-BnRDR) containing BnRDR full length gene CDS sequence, realizes the lifting of RDR gene expression amount in arabidopsis and Brassica campestris L。
In order to complete above-mentioned purpose, the present invention adopts the following technical scheme that
RDR gene is in the application controlled in the plant blossom time, including utilizing molecular biological method process LAN or suppress arabidopsis RDR gene or Brassica campestris L RDR gene to control the flowering time of arabidopsis in arabidopsis；Or utilize molecular biological method in Brassica campestris L process LAN Brassica campestris L RDR gene or arabidopsis RDR gene to control the flowering time of Brassica campestris L。
Preferably, during by reticent arabidopsis RDR gene to postpone the flowering time of arabidopsis, the RDR gene target of arabidopsis is: AATUTUTATATUUTGTUGAG；
Preferably, the expression vector of process LAN arabidopsis RDR gene, by obtaining the gus gene sequence that the full-length cDNA fragment of arabidopsis RDR gene is replaced in pBI121 plant expression vector。
Preferably, the expression vector of process LAN Brassica campestris L RDR gene, by obtaining the gus gene sequence that the full-length cDNA fragment of Brassica campestris L RDR gene is replaced in pBI121 plant expression vector。
The present invention compared with prior art, has the following advantages and effect:
1, by cloning this gene, study the effect in Brassica campestris L flowering time of this gene, specify that this gene has the function controlling flowering time。By this gene of process LAN, applicant can artificial creation's precocity material, provide new gene for Brassica campestris L earliness gene Engineering Breeding。
2, by building the artificial microRNA vector rna i-AtRDR of RDR gene, arabidopsis thaliana transformation, it is thus achieved that the transfer-gen plant of high interference efficiency, provide an effective method for research gene function。
3, the Phenotypic Observation by transgenic arabidopsis is carried out is identified, inventor obtains 11 strains and has late colored phenotype and 8 transgenic arabidopsis with early blossoming phenotype, illustrates that RDR gene has the function efficiently controlling the flowering of plant time。
4, proceeding to the process LAN plasmid OX-BnRDR of BnRDR in interference of transgene flower in the evening MI-1 strain of AtRDR, Progeny plants flowering time recovers。Prove that BRDR and AtRDR gene has the identical function controlling flowering time。
5, proceeding to process LAN plasmid OX-BnRDR or OX-AtRDR in double; two No. nine in Brassica campestris L, inventor obtains 10 transgenic individual plants, is respectively provided with Blooming phenotype。
5, applicant can above-mentioned artificial microRNA perturbation technique and process LAN technology, the precocious or late-maturing material of manual creation Brassica campestris L or kind。
Accompanying drawing explanation
The CDS that Fig. 1 is BnRDR clones electrophoretogram。
Wherein: swimming lane M is the nucleic acid Marker of DL2000；Swimming lane 1 be with in double; two No. 9 cDNA be template the BnRDR gene C DS fragment of pcr amplification。
Fig. 2 is vector construction schematic diagram。
Wherein: A is microRNAi structural principle schematic diagram。
B is process LAN RDR genophore structural representation。
Fig. 3 is a kind of transfer-gen plant PCR qualification figure converting RNAi carrier RNAi-AtRDR。
Wherein: swimming lane 1 is the nucleic acid Marker of DL2000；Swimming lane 2 is RNAi-AtRDR positive plasmid；Swimming lane 3 is wildtype Arabidopsis thaliana；Swimming lane 4-14 is transgenic positive plant。
Fig. 4 is that a kind of OX-RDR transfer-gen plant PCR identifies figure。
Wherein: A:OX-AtRDR transgenic progeny PCR identifies figure。
Swimming lane M is the nucleic acid Marker of DL2000；Swimming lane 1,2 is OX-AtRDR positive plasmid；Swimming lane 3-10 is transgenic positive plant；Swimming lane 11 is wildtype Arabidopsis thaliana。
B:OX-BnRDR/WT and OX-BnRDR/MI transgenic progeny PCR identifies figure
Swimming lane M is the nucleic acid Marker of DL2000；Swimming lane 1,2 is OX-BnRDR positive plasmid；Swimming lane 3-10 is OX-BnRDR/WT transgenic positive plant；Swimming lane 11-18 is OX-BnRDR/MI transgenic positive plant；Swimming lane 19 is wildtype Arabidopsis thaliana。
Fig. 5 is RDR gene expression dose figure in a kind of transgenic progeny alabastrum
A schemes: RNAi-AtRDR converts RDR gene expression dose in interference of transgene MI offspring。
B schemes: RDR gene expression dose in process LAN OX offspring。
Detailed description of the invention
According to following example, it is possible to be better understood from the present invention, but described embodiment is to better explain the present invention rather than limitation of the present invention。Agents useful for same of the present invention if not otherwise specified, derives from commercial channel, described technical scheme, if not otherwise specified, is the conventional scheme of this area。
Embodiment 1:
The acquisition of cabbage type rape BnRDR gene:
In cabbage type rape (BrassicanapusL.), the cDNA of double; two No. nine is for template, and primer: BnRDRS:ATGGACCGACCAGCTGACGGA and BnRDRA:TTAGAAGGAAGTAAACCGG is designed in the ORF region for BnRDR sequence, expands。Amplified production is sized to 1605bp (Fig. 1), PCR response procedures be 94 DEG C 5 minutes, 94 DEG C 1 minute, 60 DEG C 1 minute, 72 DEG C 2 minutes, 33 circulations, 72 DEG C 10 minutes, 16 DEG C 3 hours。PCR primer detects through 1.0% agarose gel electrophoresis, after Gel Extraction kit reclaims, it is connected to pMD18-T carrier, heat shock method converts the competent cell of gold bacterial strain, coat on the LB solid medium flat board containing ampicillin 50 μ g/mL, 37 DEG C of overnight incubation, select white macula 6。M13 primer (5 '-TGTAAAACGACGGCCAGT-3 ' and 5 '-CAGGAAACAGCTATGACC-3 ') is adopted to do bacterium colony PCR detection。Amplification is sized to 2284bp, 1.0% agarose gel electrophoresis test strip size。Bacterial plaque correct for PCR detected magnitude is inoculated into the LB liquid medium containing ampicillin 50 μ g/mL, at 37 DEG C, 200r/min shaken cultivation is overnight, alkalinity extraction plasmid in a small amount, after 1.0% agarose gel electrophoresis detection plasmid DNA size is correct, adopt Kpn I/XbaI enzyme that plasmid is carried out double digestion, 1.0% agarose gel electrophoresis detection。By Positive recombinant clones called after pMD18-BnRDR correct for detection, pMD18-BnRDR serves Hai Yingjun company check order, analysis result shows, obtain the Brassica campestris L RDR gene C DS total length of a kind of separation, its sequence is nucleotide sequence shown in SEQIDNO:1, aminoacid sequence shown in coding SEQIDNO:2。BLAST finds that Brassica campestris L RDR and AtRDRCDS nucleotide homology are more than 80%, and amino acid identity reaches 87%, and Brassica campestris L RDR gene is the homologous genes of AtRDR (arabidopsis RDR)。
Embodiment 2:
The application in controlling the plant blossom time of the RDR gene:
1, the structure of the artificial microRNA interference plant expression vector RNAi-AtRDR of AtRDR gene
In order to study the function of RDR gene in the present invention, have employed amiRNAi (artificialmicroRNAinterference, artificial microRNA disturbs, identical below) technology。Due to Brassica campestris L RDR and the RDR of arabidopsis have similar gene structure, conservative VIT domain, transmembrane structure and more than 85% albumen homology, speculating that both have identical function, therefore the function of Brassica campestris L BnRDR is the gain-of-function by studying arabidopsis AtRDR。(SchwabR. shown in A in structure principle such as Fig. 2 of artificial microRNA interference carrier, OssowskiS., RiesterM., etal.HighlyspecificgenesilencingbyartificialmicroRNAsinA rabidopsis.PlantCell, 2006,18 (5): 1121-1133)。The target sequence chosen is one section of sequence special in AtRDR gene: RNA sequence shown in AATUTUTATATUUTGTUGAG, SEQIDNO:3。On the method basis, the invention such as Yan proposes the construction method (YanH. of a kind of plant manpower fine RNA expression vector rapidly and efficiently, DengX., etal.AnovelapproachfortheconstructionofplantamiRNAexpres sionvectors.JournalofBiotechnology, 2011,151:9-14), the structure of artificial microRNA interference carrier RNAi-AtRDR in this experiment is completed with reference to above-mentioned literature procedure。
By freeze-thaw method (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning texts guide (third edition) Science Press, identical below) by the Plastid transformation Agrobacterium EHA105 of the RNAi-AtRDR carrier containing above-mentioned acquisition:
Step is as follows:
1: take 0.2ml competence Agrobacterium, slowly melt in ice。
2: add about 2 μ g recombinant plasmid dnas, mix gently, after ice bath 30min, put into liquid nitrogen flash freezer 1min, then 37 DEG C of water-bath 5min, melt cell。
3: adding 800 μ l without antibiotic LB fluid medium, 28 DEG C of jogs cultivate 4-5h。
4:12000rpm, 30s, go supernatant, cell to be resuspended in 0.2mlLB fluid medium culture medium。
5: culture is uniformly coated on containing Rif (rifampicin, 50mg/L) with Str (streptomycin, on LB solid medium agar plate 50mg/L), cultivate 2 days for 28 DEG C, after transformant occurs in flat board, choose bacterium, carry out bacterium colony PCR detection with BarF:5 '-TTTCGGTGACGGGCAGGAC-3 ' and BarR:5 '-CTGCACCATCGTCAACCAC-3 ' for primer。Detection method is as follows: be do template by a small amount of bacterial plaque of toothpick picking of sterilizing, reaction system is that 10 μ l include: template DNA template 1 μ L (about 100ng), 10 × Taqbuffer (containing MgCl2) 1 μ l, 1.5mmol/LdNTP (10mmol/L) 1 μ l, 5 ' primers (10 μm of ol/L) 0.5 μ l, 3 ' primers (10 μm of ol/L) 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH2O5.5 μ l。Reaction condition be 94 DEG C 5 minutes, 94 DEG C 30 seconds, 55 DEG C 80 seconds, 72 DEG C 1 minute, 32 circulations, 72 DEG C 10 minutes, amplification be sized to 1028bp。RNAi-AtRDR proceeding to Agrobacterium tumefaciems EHA105, screens by rifampicin (50 μ g/mL) resistant panel, picking bacterial plaque, bacterium colony PCR detects checking。
2, RNAi-AtRDR genetic transformation in arabidopsis and transfer-gen plant screening:
Inflorescence infestation method is adopted to carry out transformation of Arabidopsis thaliana。The preparation Agrobacterium tumefaciems EHA105 bacterium solution containing recombinant vector RNAi-AtRDR, proceeds in the LB fluid medium containing rifampicin 50 μ g/ml converting, 28 DEG C of incubated overnight the previous day。Second day, under 276nm nano wave length, detect the light absorption value of bacterium solution with ultraviolet spectrophotometer, take out when the light absorption value of bacterium solution reaches between 1.6-2.0。With the centrifugal 10min of 4000g under room temperature, abandoning supernatant, precipitation is suspended in isopyknic 5% sucrose solution。Muddy sucrose solution is poured in a big culture dish, before converting, adds the Silwetl-77 of final concentration of 0.02% (volume ratio)。After mixing the whole inflorescence of arabidopsis to be transformed gently be immersed in sucrose, silent several 15 seconds, take out plant。Plant after conversion is good with a black plastic bag pack, is placed on growth case and cultivates。Plastic bag was opened in second day, be placed on the local cultivation of light intensity。Tried again conversion every one week。Cultivating about one month results seed, seed dries 3-5 days under incubator or daylight。
The T0 converting results is broadcast in the Vermiculitum being mixed with PNS nutritional solution for seed。Transfer to temperature 20-25 DEG C, intensity of illumination 5000-10000 lumen, the photoperiod is 16 h light/8 h dark, air humidity more than between the cultivation of more than 80%, normal management。According to cremart (Bar) resistance screening positive plant distinctive on expression vector。After arabidopsis grows a piece of true leaf, spray the herbicide basta of 30ppm。After one week, spray the Basta of 50ppm, it is thus achieved that arabidopsis transgenic positive Seedling。The transformed plant that screening obtains, claims T1 for transformed plant。Blade grows to sufficiently large hour (3-4 leaf phase), takes a little green seedling leaf, extracts DNA, carries out the PCR positive detection of converting material。The primer is BarF and BarR, and reaction system is 10 μ l。Reaction condition be 94 DEG C 5 minutes, 94 DEG C 30 seconds, 55 DEG C 80 seconds, 72 DEG C 1 minute, 32 circulations, 72 DEG C 10 minutes, amplification be sized to 1028bp。Agarose gel electrophoresis with 1% detects, and result shows (Fig. 3), and the artificial microRNA interference plant expression vector RNAi-AtRDR of RDR gene has successfully proceeded to arabidopsis, obtains 11 strain transgenic positive plant altogether, is respectively designated as MI-1, MI-2 etc.。
3, the structure of AtRDR gene overexpression plant expression vector OX-AtRDR and conversion, screening
Collection arabidopsis alabastrum between growth, extracts test kit according to Trirol after putting into liquid nitrogen flash freezer and requires to extract RNA, with the RNA of acquisition for template, carry out reverse transcription according to the explanation of Promega company reverse transcriptase, save backup in-80 DEG C after the cDNA subpackage obtained。The pcr amplification of AtRDR gene (At5g24290) cDNA fragment is carried out with arabidopsis alabastrum cDNA for template。The primer is AtRDRF:CGCggatcc-ATGGAAAAGTCAAACCAACCAGTT and AtRDRR:ACAtctaga-AAAGGAAGTAAACCGGCACTCCTC。5 ' ends of primer sequence introduce BamHI and XbalI restriction endonuclease sites respectively。PCR reaction system is 25 μ L。PCR response procedures is as follows: 94 DEG C of 5min；94 DEG C of 30sec, 55 DEG C of 45sec, 72 DEG C of 1min, 35 circulations；72 DEG C extend 8min。Amplified fragments is sized to 1668bp。PCR primer detects through 1.0% agarose gel electrophoresis。Reclaim test kit with gel after completing and reclaim purification purpose fragment, it is thus achieved that AtRDR gene cDNA full length fragment。
The gus gene sequence (in Fig. 2 B) in pBI121 plant expression vector is replaced, it is thus achieved that the plant over-express vector OX-AtRDR of AtRDR gene with the AtRDR gene cDNA full length fragment obtained。
For completing this purpose, first with BamHI/SacI double digestion AtRDR gene cDNA fragment, simultaneously by the GUS fragment of BamHI/SacI enzyme action pBI121 plasmid。Enzyme action system is 10 μ l, and endonuclease reaction carries out in 37 degree of incubators, after about 4-6 hour, detects with 1% (mass volume ratio) agarose gel electrophoresis。
The large fragment DNA gel cut on the digestion products of AtRDR gene cDNA fragment and cloning vehicle pBI121 is reclaimed test kit reclaim。In the digestion products of AtRDR gene CDNA fragment ratio (molar concentration rate) biased sample than pBI121 carrier segments (150ngAtRDR gene CDNA fragment: 50ng carrier segments)=3:1, add T4DNA ligase 5 unit, 10 × reaction buffer, sterilized water supplements volume to 20 μ L, and 16 DEG C connect overnight。After conversion, screening containing on kanamycin solid LB flat board, after choosing speckle, carrying out bacterium colony PCR detection with NPT II F and NPT II R primer (NPT II F:5 '-GATGGATTGCACGCAGGT-3 ' and NPT II R:5 '-TCAGAAGAACTCGTCAAG-3 ')。Reaction condition be 94 DEG C 5 minutes, 94 DEG C 1 minute, 55 DEG C 30 seconds, 72 DEG C 2 minutes 30 seconds, 33 circulations, 72 DEG C 10 minutes, amplification be sized to 800bp, after 1.0% agarose gel electrophoresis detected magnitude is correct, select positive strain upgrading grain, the recombiant plasmid called after OX-AtRDR that digestion verification is correct。Then utilize freeze-thaw method that OX-AtRDR proceeds to Agrobacterium tumefaciems EHA105, kanamycin (50 μ g/mL) and rifampicin (50 μ g/mL) Double plate screening, choose speckle, carry out bacterium colony PCR detection checking。
Inflorescence infestation method is adopted to carry out the OX-AtRDR Plastid transformation wildtype Arabidopsis thaliana that will obtain。By convert the T0 of results for after the mercuric chloride surface sterilization 10 minutes of seed 70% (volume ratio) ethanol and 0.01% (volume ratio) with distilled water wash for several times (5～7 times), then MS solid screening and culturing primary surface is arrived in piping and druming equably。4 DEG C of vernalization 4-6 days, puts into constant incubator and cultivates。According to the positive Seedling of kalamycin resistance screening specific on expression vector。Blade grows to sufficiently large hour (3-4 leaf phase), takes a little green seedling leaf and carries out PCR positive detection, and primer is NPT II F and NPT II R, and reaction system is 10 μ l。Reaction condition be 94 DEG C 5 minutes, 94 DEG C 30 seconds, 55 DEG C 30 seconds, 72 DEG C 1 minute, 32 circulations, 72 DEG C 10 minutes, amplification be sized to 800bp。Result shows that (in Fig. 4 A) obtains transgenic positive plant。More than positive plant selfing 3 generation, it is thus achieved that 8 T3 that isozygoty are for strain。It is respectively designated as OX-AtRDR-1, OX-AtRDR-2 etc.。
4, the structure of BnRDR gene overexpression plant expression vector OX-BnRDR and conversion
Utilize primer BnRDRS2:CGCggatcc-ATGGACCGACCAGCTGACGGA and the BnRDRA2:ACAtctaga-TTAGAAGGAAGTAAACCGG built for over-express vector, from pMD18-BnRDR plasmid, amplify required fragment。PCR reaction system is 25 Μ l, includes: 1 × PCRbuffer, MgCI1.5mmol/L, dNTP0.2mmol/L (mM every liter), primer concentration are 0.5mol/L, Pfu enzyme 1.5 unit, and template is about 100ng。PCR response procedures is as follows: 94 DEG C of 5min；94 DEG C of 30sec, 55 DEG C of 45sec, 72 DEG C of 1min, 35 circulations；72 DEG C extend 8min。Amplified fragments is sized to 1629bp。PCR primer detects through 1.0% agarose gel electrophoresis。Reclaim test kit with gel after completing and reclaim purification purpose fragment。
The gus gene sequence (in Fig. 2 B) in pBI121 plant expression vector is replaced, it is thus achieved that the plant over-express vector OX-BnRDR of BnRDR gene by the purpose fragment obtained。
For completing this purpose, first by BamHI/SacI double digestion BnRDR gene CDNA fragment, simultaneously by the GUS fragment of BamHI/SacI enzyme action pBI121 plasmid。Enzyme action system is 10 μ l, and endonuclease reaction carries out in 37 degree of incubators, after about 4-6 hour, detects with 1% (mass volume ratio) agarose gel electrophoresis。
The large fragment DNA gel cut on the digestion products of BnRDR gene CDNA fragment and cloning vehicle pBI121 is reclaimed test kit reclaim。In the digestion products of the BnRDR gene CDNA fragment ratio biased sample than pBI121 carrier segments=3:1, adding T4DNA ligase 5 unit, 10 × reaction buffer, sterilized water supplements volume to 20 μ L, and 16 DEG C connect overnight。After conversion, screening containing on kanamycin (50 μ g/mL) solid LB flat board, after choosing speckle, carry out bacterium colony PCR detection with NPT II F and NPT II R primer。After 1.0% agarose gel electrophoresis detected magnitude is correct, select positive strain upgrading grain, the recombiant plasmid called after OX-BnRDR that digestion verification is correct。Then utilize freeze-thaw method that OX-BnRDR proceeds to Agrobacterium tumefaciems EHA105, kanamycin (50 μ g/mL) and rifampicin (50 μ g/mL) Double plate screening, choose speckle, carry out bacterium colony PCR detection checking with NPT II F and NPT II R primer。
The RNAi-AtRDR transgenic arabidopsis that inflorescence infestation method carries out converting the OX-BnRDR plasmid of acquisition respectively wildtype Arabidopsis thaliana and acquisition is adopted to close strain MI-1。Carry out surface sterilization for seed by converting the T0 of results and be seeded in MS solid screening culture medium according to kalamycin resistance specific on expression vector to carry out cultivating to screen positive plant。Blade grows to sufficiently large hour (3-4 leaf phase), takes a little green seedling leaf NPT II gene primer NPT II F and NPT II R and carries out PCR positive detection, all obtains 8 transgenic positive plant (Fig. 4) respectively。More than positive plant selfing 3 generation, OX-BnRDR Plastid transformation wildtype Arabidopsis thaliana obtains 8 homozygous lines altogether, is respectively designated as OX-BnRDR/WT-1, OX-BnRDR/WT-2 etc.。OX-BnRDR Plastid transformation MI-1 obtains 8 homozygous lines altogether, is respectively designated as OX-BnRDR/MI-1, OX-BnRDR/MI-2 etc.。
5, in transgenic arabidopsis offspring, the expression analysis of RDR gene and flowering time phenotype are observed:
The all transgenic lines isozygotied that will obtain after continuous selfing, including 11 RNAi-AtRDR transgenic lines, 8 OX-AtRDR strains, 8 OX-BnRDR/WT strains, 8 OX-BnRDR/MI-1 strains, and wildtype Arabidopsis thaliana is seeded between growth simultaneously。Collecting alabastrum after bolting, every kind of material at least takes three repetition, each repeats at least one strain, with masking foil parcel after sampling, is positioned over rapidly in liquid nitrogen ,-80 DEG C of preservations。Extraction RNA goes forward side by side to go and carries out reverse transcription, saves backup in-80 DEG C after the cDNA subpackage obtained。
Carry out fluorescence quantitative PCR detection。Internal reference Actin gene primer is ActinF and ActinR。The RDR gene primer of the conservative section design according to arabidopsis and Brassica campestris L RDR gene C DS sequence is RDRF and RDRR (RDRF:CCGAGATAGAGTTGGAAGAGGATAATG and RDRR:CATCCTCATTTCCAAGCTCATAGTTTT)。Quantitative fluorescent PCR reaction often group experiment all completes to repeat three biologys, repeats at least to do three technology each biology and repeats。With the relative expression quantity comparing Ct method (Δ Δ Ct) and calculating gene, detect the expression (Fig. 5) of (RNAi-AtRDR transgenic line, OX-AtRDR strain, OX-BnRDR/WT strain, OX-BnRDR/MI-1) in various transgenic progeny of RDR gene。
Result shows that in the RNAi-AtRDR transgenic line of all detections, the expression of target gene RDR is all significantly lower than wildtype Arabidopsis thaliana, and average suppression efficiency is more than 70%, and wherein the jamming effectiveness of MI-1 and MI-8 strain reaches 80%。In OX-AtRDR process LAN transgenic line, the expression of target gene RDR is all remarkably higher than wildtype Arabidopsis thaliana, has on average raised 30 times, and the highest rises more than 50 times。In OX-BnRDR/WT process LAN transgenic line, the expression of target gene RDR is also significantly greater than wildtype Arabidopsis thaliana, has on average raised 20 times。In OX-BnRDR/MI transgenic line, the expression of target gene RDR also returns to more than wildtype Arabidopsis thaliana, 5 times (Fig. 5) of average out to wild type expression。Target site selected when building RNAi-AtRDR carrier is sequence one section special in AtRDR gene, it is ensured that will not identify BnRDR sequence and then be degraded。Therefore in RNAi-AtRDR transgenic line MI-1, process LAN BnRDR gene can realize a large amount expression of this gene。
The all transgenic lines isozygotied that will obtain after continuous selfing, being seeded between growth including 11 RNAi-AtRDR transgenic lines, 8 OX-AtRDR strains, 8 OX-BnRDR/WT strains, 8 OX-BnRDR/MI-1 strains and wildtype Arabidopsis thaliana, every strain is no less than 20 strains simultaneously。Statistics first of all material spends open hour DF (daystoflowering) and first the flowers are in blossom Herb lotus throne leaf and stem leaf sum TLN (totalleafnumber) when putting。Adopt DPS statistical analysis software analytical data。
The flowering time statistical result of table 1 transgenic arabidopsis
Result shows that all RNAi-AtRDR transgenic line flowering times are all more notable delay than wildtype Arabidopsis thaliana, and maximum is delayed 7 days in (table 1), and TLN number is also significantly more than wildtype Arabidopsis thaliana, maximum how long 9 blades (tables 1)。The transgenic arabidopsis OX-AtRDR strain of process LAN AtRDR and BnRDR gene and the flowering time of OX-BnRDR/WT strain are all notable than wildtype Arabidopsis thaliana to be done sth. in advance, on average ahead of time 5-4 days (table 1), TLN number is also considerably less than wildtype Arabidopsis thaliana, 3 (table 1) of average minimizing。Illustrate to suppress the expression of RDR gene can postpone the flowering time of arabidopsis in arabidopsis, and the expression improving RDR gene can make arabidopsis bloom ahead of time。AtRDR has the function controlling arabidopsis flowering time。
In addition statistical result also shows that 8 OX-BnRDR/MI-1 close the flowering time (table 1) of strains and TLN number (table 1) and wildtype Arabidopsis thaliana is not significantly different from。MI-1 strain is the transgenic arabidopsis (Fig. 5) that the AtRDR gene utilizing microRNA perturbation technique to obtain almost is not expressed completely, and in this material, proceed to the process LAN plasmid OX-BnRDR of BnRDR, the a large amount making BnRDR in arabidopsis is expressed, and instead of the AtRDR gene being totally constrained。This result fully confirms that the process LAN of BnRDR gene can the complementary flower phenotype in evening caused due to arabidopsis AtRDR gene silencing。BnRDR gene is the same with arabidopsis AtRDR gene has the function controlling arabidopsis flowering time。
6, the Brassica campestris L of over-express vector converts and the observation of flowering time phenotype
Adopt Regenerated from Hypocotyl Explants method, over-express vector OX-AtRDR and OX-BnRDR is converted respectively in Brassica campestris L double; two No. nine, during conversion, utilize specific kalamycin resistance on expression vector screen positive Seedling in culture medium。Through co-culturing, regenerate, screen, take root and after seedling exercising, by unconverted to conversion seedling and same leaf age double; two No. nine in being transplanted to transgenic garden on the same day。The 6-7 leaf phase to be grown into takes a little green seedling leaf and extracts DNA, carries out PCR positive detection with NPT II F and NPT II R primer, all obtains 10 strain T1 generation positive Seedlings。It is respectively designated as OX-AtRDR-Bn1, OX-AtRDR-Bn2 and OX-BnRDR-Bn1, OX-BnRDR-Bn2 etc.。
When the Brassica campestris L florescence, record in all transgene rapes and non-transgenic double; two No. nine and start to first natural law DF (daystoflowering) that the flowers are in blossom puts that day from being transplanted to transgenic garden。Result is as shown in table 2。Non-transgenic is bloomed being transplanted to transgenic garden 123 talent for double; two No. nine, and the 10 strain OX-AtRDR transgene rapes obtained and and the 10 strain OX-BnRDR transgene rapes that obtain are all just bloom for 110-115 days after transplanting, flowering time is advanced by 8-13 days。The expression utilizing process LAN technology to improve RDR gene in Brassica campestris L is described, it is possible to the flowering time of significant Brassica campestris L ahead of time, it is thus achieved that precocious Brassica campestris L material。BnRDR gene is the same with arabidopsis AtRDR gene has the function controlling Brassica campestris L flowering time。
The flowering time statistical result of table 2 transgene rape
SEQUENCELISTING
<110>Inst. of Oil Crops, Chinese Academy of Agriculture
<120>flowering time control gene RDR and application thereof
<130>flowering time control gene RDR and application thereof
<160>3
<170>PatentInversion3.1
<210>1
<211>1605
<212>DNA
<213>cabbage type rape
<400>1
atggaccgaccagctgacggaagcaagtttggggagagaggtgaaatcgtagatgcagat60
ttcttggtgggtcttctcgacaccttcagttttggcaaatataatcttctggccataaaa120
aatgtgttaaatgcgccggcaaagattacaccggcgacggagcagcaggacaagaccacc180
gagaagcaggatgatggatctcaaggtctcgtaggggacgcgtctgttcgtgaaagcata240
ggatcggtatcttccagttcggatccaataatactggatgatatgagcgaaaccggttca300
aataatgaacctgtttcaaacgaagaaaccagttcacctaatgaacccgtttcaaacgaa360
gaatccggttcaaacaatgaacccgtttcaaacgaagaatccggttataattggttggag420
tcgaactccacaaacttacccagtgtagagaatgaaaggcaccataacgaagacgaaggt480
gagatagtagaagaagaaaaagacaaagacaaagacaaagacaaagaagaagaagaagaa540
gaaaaagacgaaaataaaaacagcgggagaacatcatctgactcggaagaaaaatcaaac600
ctagagacattgcttgcgacacaagaaaagtacgagctttactgtccaagctgtagctct660
tgtatcaccaggaaagtgattcttacgaaaaaagaacatgggaagctcgttgatgaatca720
agcgacatcgaggagattgaaccacatgttaaggtgcatacccctaagaagcttataact780
gagaatgaagatcaagaatataaagaggagggttatctcttcgcttgcttggcctgccta840
aagtactacatcagattaggaaccaggttcttacaacgagatgatgagccagttgaagta900
cttttagagtctagggagagtagtaacaccacagaatcagaatcaccgcctcaaaataaa960
ctggaccgtgaaagattcctcgttgagctattgaagagcactgtctacggcggtttaacc1020
gagaccatcaccagcctcgtcgttgtatcttccgcctctgcctccggatcctccaccgag1080
aatatcttggctcttgcggtcgcaaatttagccggtggtctcatcgtccttgctcaaaac1140
ctacaagatctaagaaacagttcagatcaagagaaagatcggtacaatgagttgttaggg1200
agacgtgacaatatccggttgcatgtactagtagcggtcctgtcttacattttcttcggc1260
ctaattgctccgctggtttacgcattttccttctaccaaaccgggatcaagaactacaag1320
cttgtctcggttttctcggtttctctggtttgtgcaatcatgctcggtatgatcaaggtc1380
tacgtccgtaaaccgatcaacgtacgtgcatcccctaaaccttatctcaagtctgctgct1440
tattacacgtctattgttgttgtctcttctggaatctcatacattgttggagaaatcgtg1500
ggagagtatatccgaaagctcggtttgtttagtttataccagagcggtttgacttcaaca1560
cttgacggaattaaaccagaggaataccggtttacttccctttaa1605
<210>2
<211>535
<212>PRT
<213>cabbage type rape
<400>2
MetAspArgProAlaAspGlySerLysPheGlyGluArgGlyGluIle
151015
ValAspAlaAspPheLeuValGlyLeuLeuAspThrPheSerPheGly
202530
LysTyrAsnLeuLeuAlaIleLysAsnValLeuAsnAlaProAlaLys
354045
IleThrProAlaThrGluGlnGlnAspLysThrThrGluLysGlnAsp
505560
AspGlySerGlnGlyLeuValGlyAspAlaSerValArgGluSerIle
65707580
GlySerValSerSerSerSerAspProIleIleLeuAspAspMetSer
859095
GluThrGlySerAsnAsnGluProValSerAsnGluGluThrSerSer
100105110
ProAsnGluProValSerAsnGluGluSerGlySerAsnAsnGluPro
115120125
ValSerAsnGluGluSerGlyTyrAsnTrpLeuGluSerAsnSerThr
130135140
AsnLeuProSerValGluAsnGluArgHisHisAsnGluAspGluGly
145150155160
GluIleValGluGluGluLysAspLysAspLysAspLysAspLysGlu
165170175
GluGluGluGluGluLysAspGluAsnLysAsnSerGlyArgThrSer
180185190
SerAspSerGluGluLysSerAsnLeuGluThrLeuLeuAlaThrGln
195200205
GluLysTyrGluLeuTyrCysProSerCysSerSerCysIleThrArg
210215220
LysValIleLeuThrLysLysGluHisGlyLysLeuValAspGluSer
225230235240
SerAspIleGluGluIleGluProHisValLysValHisThrProLys
245250255
LysLeuIleThrGluAsnGluAspGlnGluTyrLysGluGluGlyTyr
260265270
LeuPheAlaCysLeuAlaCysLeuLysTyrTyrIleArgLeuGlyThr
275280285
ArgPheLeuGlnArgAspAspGluProValGluValLeuLeuGluSer
290295300
ArgGluSerSerAsnThrThrGluSerGluSerProProGlnAsnLys
305310315320
LeuAspArgGluArgPheLeuValGluLeuLeuLysSerThrValTyr
325330335
GlyGlyLeuThrGluThrIleThrSerLeuValValValSerSerAla
340345350
SerAlaSerGlySerSerThrGluAsnIleLeuAlaLeuAlaValAla
355360365
AsnLeuAlaGlyGlyLeuIleValLeuAlaGlnAsnLeuGlnAspLeu
370375380
ArgAsnSerSerAspGlnGluLysAspArgTyrAsnGluLeuLeuGly
385390395400
ArgArgAspAsnIleArgLeuHisValLeuValAlaValLeuSerTyr
405410415
IlePhePheGlyLeuIleAlaProLeuValTyrAlaPheSerPheTyr
420425430
GlnThrGlyIleLysAsnTyrLysLeuValSerValPheSerValSer
435440445
LeuValCysAlaIleMetLeuGlyMetIleLysValTyrValArgLys
450455460
ProIleAsnValArgAlaSerProLysProTyrLeuLysSerAlaAla
465470475480
TyrTyrThrSerIleValValValSerSerGlyIleSerTyrIleVal
485490495
GlyGluIleValGlyGluTyrIleArgLysLeuGlyLeuPheSerLeu
500505510
TyrGlnSerGlyLeuThrSerThrLeuAspGlyIleLysProGluGlu
515520525
TyrArgPheThrSerLeuSer
530535
<210>3
<211>20
<212>RNA
<213>arabidopsis
<400>3
aatututatatuutgtugag20
Claims (5)
- The application in controlling the plant blossom time of the 1.RDR gene, the described RDR gene that RDR gene is Brassica campestris L or arabidopsis, described plant is Brassica campestris L or arabidopsis。
- 2. gene according to claim 1, described Brassica campestris L RDR gene is BnaC07g30170D；Arabidopsis RDR gene is At5g24290。
- 3. application according to claim 1, it is characterised in that: Brassica campestris L RDR over-express vector is passed through in the wild cabbage type rape of Agrobacterium-mediated Transformation or arabidopsis with the plant blossom time ahead of time；Described Brassica campestris L RDR over-express vector is by obtaining the gus gene sequence that the full-length cDNA fragment of Brassica campestris L RDR gene is replaced in pBI121 plant expression vector。
- 4. application according to claim 1, it is characterised in that: arabidopsis RDR over-express vector is passed through in the wild cabbage type rape of Agrobacterium-mediated Transformation or arabidopsis with the plant blossom time ahead of time；Described arabidopsis RDR over-express vector is by obtaining the gus gene sequence that the full-length cDNA fragment of arabidopsis RDR gene is replaced in pBI121 plant expression vector。
- 5. application according to claim 1, it is characterised in that: disturb recombinant vector to pass through in the wild cabbage type rape of Agrobacterium-mediated Transformation or arabidopsis to postpone the plant blossom time arabidopsis RDRRNA；In described arabidopsis RDRRNA interference recombinant vector, the RDR gene target of arabidopsis is: AATUTUTATATUUTGTUGAG。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610171667.7A CN105695502A (en) | 2016-03-23 | 2016-03-23 | Application of RDR gene in control of plant flowering time |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610171667.7A CN105695502A (en) | 2016-03-23 | 2016-03-23 | Application of RDR gene in control of plant flowering time |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105695502A true CN105695502A (en) | 2016-06-22 |
Family
ID=56232737
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610171667.7A Pending CN105695502A (en) | 2016-03-23 | 2016-03-23 | Application of RDR gene in control of plant flowering time |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105695502A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107723379A (en) * | 2017-11-30 | 2018-02-23 | 华中农业大学 | A kind of molecular labeling for controlling cabbage type rape florescence and application |
| CN112877337A (en) * | 2020-12-30 | 2021-06-01 | 浙江大学 | Application of rape BnaA09WRKY6 gene in promotion of bolting and flowering of cruciferous plants |
| CN113584051A (en) * | 2021-07-27 | 2021-11-02 | 中国农业科学院棉花研究所 | Application of GhGAI gene in regulation and control of plant flowering |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101663398A (en) * | 2007-02-06 | 2010-03-03 | 首尔大学校产学协力团 | SVP gene controlling flowering time of plants |
| CN105112427A (en) * | 2015-09-24 | 2015-12-02 | 中国热带农业科学院南亚热带作物研究所 | Gene LcFLC for retarding flowering time of plants and application thereof |
-
2016
- 2016-03-23 CN CN201610171667.7A patent/CN105695502A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101663398A (en) * | 2007-02-06 | 2010-03-03 | 首尔大学校产学协力团 | SVP gene controlling flowering time of plants |
| CN105112427A (en) * | 2015-09-24 | 2015-12-02 | 中国热带农业科学院南亚热带作物研究所 | Gene LcFLC for retarding flowering time of plants and application thereof |
Non-Patent Citations (7)
| Title |
|---|
| GENBANK: "PREDICTED: Brassica napus membrane protein of ER body 2-like (LOC106416062), mRNA，Accession number：XM_013856898.1", 《GENBANK》 * |
| SADIA TEHRIM ET AL.: "Functional Genomics Approaches to Study At5g24290 Gene in Arabidopsis thaliana and Its Homologous in Brassica Species", 《第十二届全国植物基因组学大会》 * |
| 史卫东: "油菜开花时间变异分析和拟南芥晚开花突变体鉴定与基因克隆", 《中国优秀博硕士学位论文全文数据库 (博士) 农业科技辑》 * |
| 周荣芳等: "芸薹属 AC 基因组中VIT基因家族的鉴定与进化", 《中国油料作物学报》 * |
| 张艺能等: "拟南芥开花时间调控的分子基础", 《植物学报》 * |
| 徐涛等: "植物中依赖于RNA的RNA聚合酶研究进展", 《中国农业科技导报》 * |
| 谭勇俊等: "油菜开花时间遗传调控的研究进展", 《作物研究》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107723379A (en) * | 2017-11-30 | 2018-02-23 | 华中农业大学 | A kind of molecular labeling for controlling cabbage type rape florescence and application |
| CN112877337A (en) * | 2020-12-30 | 2021-06-01 | 浙江大学 | Application of rape BnaA09WRKY6 gene in promotion of bolting and flowering of cruciferous plants |
| CN112877337B (en) * | 2020-12-30 | 2022-06-10 | 浙江大学 | Application of rape BnaA09WRKY6 gene in promotion of bolting and flowering of cruciferous plants |
| CN113584051A (en) * | 2021-07-27 | 2021-11-02 | 中国农业科学院棉花研究所 | Application of GhGAI gene in regulation and control of plant flowering |
| CN113584051B (en) * | 2021-07-27 | 2023-01-31 | 中国农业科学院棉花研究所 | Application of GhGAI gene in regulation and control of plant flowering |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2321349T3 (en) | PROCEDURE AND MEANS FOR CONTROLLING FLOATING PLANTS. | |
| Bloomfield et al. | Sustainable harvest: managing plasticity for resilient crops | |
| EA024958B1 (en) | Engineering of bolting resistance in sugar beet by means of the transgenic expression of the beet homologue of flowering time control gene ft | |
| CN109797157B (en) | Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application | |
| CN106047893B (en) | The application interim in control Rice Heading of OsCOL16 gene | |
| CN105695502A (en) | Application of RDR gene in control of plant flowering time | |
| CN104520312B (en) | The regulation of seed vitality | |
| CN104017061B (en) | Transcription factor ZmbZIP17 and encoding gene and its application in response adverse circumstance | |
| CN102268081A (en) | Rice lateral root control gene OsIAAII and use thereof | |
| Li et al. | Analysis of physiological characteristics of abscisic acid sensitivity and salt resistance in Arabidopsis ANAC mutants (ANAC019, ANAC072 and ANAC055) | |
| CN113755510B (en) | Encoding soybean FtsH metalloprotease gene GmFtsH25 and application thereof | |
| CN111116721A (en) | Plant stress resistance-related transcription factor PwNAC30, and coding gene and application thereof | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN108456683B (en) | Function and application of gene SID1 for regulating heading stage of rice | |
| CN105624172B (en) | The genetic engineering application of paddy rice zinc finger protein gene ZFP214 | |
| CN105132428B (en) | A kind of and the relevant ZmLRT genes of root system of plant character and its relevant biological material and application | |
| Nishihara et al. | Molecular breeding of Japanese gentians—Applications of genetic transformation, metabolome analyses, and genetic markers | |
| CN104673803A (en) | Application of gene methylation in gene expression regulation | |
| CN104945493B (en) | A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application | |
| CN117904142B (en) | Application of SlMYB gene in improving salt stress resistance of tomatoes | |
| CN103014018B (en) | Rape bnrabgdi3 gene and application thereof | |
| CN104797712B (en) | The method for improving cotton fiber length | |
| CN108004250B (en) | Application of wheat stripe rust PSTG_13661 gene in stripe rust prevention and control and stripe rust resistant wheat cultivation method | |
| CN117925640A (en) | Solitary gene for regulating flowering time of bolting of Chinese cabbage and application thereof | |
| CN102888411B (en) | Eucalyptus PGEF13 gene and plant expression vector, host cell and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160622 |