CN103014018B - Rape bnrabgdi3 gene and application thereof - Google Patents

Abstract

The invention discloses a rape BnRabGDI3 gene and application thereof, also discloses a gene which is a separated gene having sequences shown in SEQ ID No.1 and SEQ ID No.2. RabGDI3 is a GDP (guanosine diphosphate) dissociation inhibitor, is one of regulatory factors needed in the conversion process of RabGDP/RabGTP (Rab guanosine triphosphate), and plays an important role in the process of regulating vesicle transfer by the Rab protein. BnRabGDI3 presents a prominent preferential expression in the rape anther and microspore. The microspore can be abortive by interfering the expression of Arabidopsis AtRabGDI3 gene. Transgenic Arabidopsis with overexpression of BnRabGDI3 is used as a male parent and pollinated with transgenic Arabidopsis with interference of RabGDI3 gene, so that the fertility of anther and pollen of the filial generation is recovered. The complementary experiment confirms that rape BnRabGDI3 and Arabidopsis AtRabGDI3 have the same function of controlling the anther development and the pollen fertility of the rape and the Arabidopsis. The pollen fertility can be controlled by using genetic engineering technology to regulate the expression level of RabGDI3, so that male sterile line material and restorer material can be created; and the rape BnRabGDI3 can be used for the development study of male gamete and the quality improvement of the crop.

Description

Rape BnRabGDI3 gene and application thereof

Technical field

The present invention relates to plant genetic engineering and biological technical field.Be specifically related to a kind of RabGDI3 gene of controlling rape and Arabidopis thaliana pollen fertility, also relate to a kind of preparation method who controls the RabGDI3 gene of plant pollen fertility simultaneously, also relate to a kind of purposes of controlling the RabGDI3 gene of plant pollen fertility.The invention still further relates to the carrier that contains this gene or its homologous nucleotide sequence and utilize the application of this gene in rape genetically engineered with relating to.

Background technology

Rab albumen is that small molecules GTP (guanosine triphosphate) is in conjunction with subfamily maximum in protein family, molecular switch as vesica transportation plays important regulating and controlling effect (Wu Wenlin, the structure of the clean .Rab albumen of Wu Sui, function and research prospect. the Taiwan Straits, 2006,25(4): 599-605).Rab albumen effect circulation is Rab-GDP and the conversion process of two kinds of different bonding states of Rab-GTP.The Rab-GDP being wherein present in tenuigenin is non-activity state, and with membrane-bound Rab-GTP be activated state transportation (the Vanessa Vernoud that participates in regulation and control vesica, Amy C.Horton, Zhenbiao Yang, et al.Analysis of the Small GTPase Gene Superfamily ofArabidopsis.Plant Physiology, 2003,131:1191-1208).For most of Rab albumen, with be being connected of certain films to modify and realize by its PROTEIN C end conservative halfcystine isoprenylation, this process need GGTase (Rab geranylgeranyl transferase, Mang ox geranyl transferring enzyme) and REP (Rab escort protein, Rab escorts albumen) common participation complete (Fan Jundie, Wang Wei, the structure of beam Aiwa .Rab albumen, function and evolution. the chemical > > of < < life, 2004, 24 (1): 31-33).The steady state of the Rab albumen that process is modified is subject to the control of RabGDI.

RabGDI (Rab GDP dissociation inhibitor proteins) is a kind of GDP inhibitor that dissociates, and is one of required regulatory factor of RabGDP/RabGTP conversion process.This factor plays an important role in Rab protein regulation vesica transport process.It can suppress Rab protein delivery GDP(guanosine diphosphate(GDP)), thus make Rab albumen can not with GTP(guanosine triphosphate) combination, make it maintain non-activity state.Membrane-bound activated Rab-GTP, participates in the adjusting of vesica transportation, is finally transformed into Rab-GDP, under the effect of RabGDI with membrane sepn.The process of RabGDI separation of Ra b-GDP may be spontaneous, but this process also needs the adjusting of other factors, GTPase activator (GTPase activating protein for example, GAP) and guanine nucleotide exchange factor (guanine nucleotide exchange factor, GEF, Yao-Wen Wu, Kui-Thong Tan, Herbert Waldmann, et al.Alexandrov interaction analysis of prenylated Rab GTPase with Rab escort protein and GDP dissociation inhibitor explains the need for both regulators.PNAS, 2007, 104 (30): 12294-12299).

RabGDI, from ox brain cell matter, separation obtains the earliest, and research originally finds that GDI is the albumen that a kind of GDP of inhibition dissociates from Rab3A.Research subsequently finds that GDI can make deactivated RabGDP separated from film, thereby get back to, enters next circulation in cytosol.GDI has the characteristic of wide application, the GDI for example Rab3A being worked works to other Rab albumen detecting in the Mammals obtaining, therefore unified called after " RabGDI " (Takashi Ueda, Noriyuki Matsuda, Toyoaki Anai, et al.An Arabidopsis gene lsolated by a nove1 method for detecting genetic interaction in Yeast encodes the GDP dissociation inhibitor of Ara4 GT Pase.The Plant Cell, 1996,8:2079-2091).Research subsequently finds in yeast, to only have 1 GDI gene, by GDI1/SEC19, is encoded, and the mutant of this gene shows multiple phenotype, and vesica transport pathway is impacted.And in the genome of mouse, at least there is 5 GDI genes (Janoueix-Lerosey I., Jollivet F., Camonis J., et al.Two-hybrid system screen with the small GTP-binding protein Rab6.Biol Chem, 1995,270:14801-14808).

Ueda1996 has found the gene of a coding Arabidopis thaliana RabGDI, i.e. AtRabGDI1, and this is first GDI locating in higher plant.Follow-up research is not only in Arabidopis thaliana but also found AtRabGDI2.Find at present to exist the gene of three coding RabGDI: AtRabGDI1-AtRabGDI3 in Arabidopis thaliana.Wherein by yeast mutants sec19 function complementation experiment, confirm AtRabGDI1(At2g44100) and AtRabGDI2(At3g59920) in yeast and plant, there is conservative functionally active.Research shows that AtRabGDI1 all has expression in each tissue; and AtRabGDI2 expression amount in root is higher; in spending, express on a small quantity; and in other tissue extremely low (the Ueda T. of expression amount; MatsudaN.; Anai T.; et al.An Arabidopsis gene isolated by a novel method for detecting genetic interaction in yeast encodes the GDP dissociation inhibitor of Ara4 GTPase.Plant Cell; 1996,8:2079-2091; Ueda T., Yoshizumi T., Anai T., et al.AtGDI2, a novel Arabidopsis gene encoding a Rab GDP dissociation inhibitor.Gene, 1998,206:137-143; Zarsky V., Cvrckova F., Bischoff F., et al.At-GDI1from Arabidopsis thaliana encodes a rab-specific GDP dissociation inhibitor that complements the sec19 mutation of Saccharomyces cerevisiae.FEBS Lett, 1997,403:303-308.Kim etc. find in the experimental study by fungal infection paddy rice: infect early stage, two RabGDI(OsGDI1 in paddy rice and OsGDI2) express and occur raising.Although concrete molecular mechanism is not clear, infer that OsGDI has vital role plant to the early stage signal diffusion of resisting of cause of disease infringement.The albumen homology of simultaneously finding they and tobacco GDI is 86%-87%, with arabis protein homology be 82%-84%, illustrate that this gene may also have certain researching value (Kim W.Y. aspect plant resistance to environment stress, Kim C.Y., Cheong N.E., et al.Characterization of two fungal-elicitor induced rice cDNAs encoding functional homologues of the rab-specific GDP-dissociation inhibitor.Planta1999,210:143-149).Expression analysis and other correlative study about AtRabGDI3 and BnRabGDI3 have no report.

In recent years, artificial microRNA (artificial miRNA, the amiRNA) technology developing based on microRNA (microRNA, miRNA) action principle is a kind of novel RNA perturbation technique.It utilizes the stem sequence (being generally 21-22nt) of the particular sequence displacement Mirnas of plant of target gene, builds the expression that amiRNA expression vector carrys out jamming target gene.This technology not only can be disturbed reticent all target sequences or gene as traditional RNAi technology simultaneously, also can disturb accurately the single special objective gene in gene family or allelotrope simultaneously, specificity and the high efficiency with height, overcome gene metabolism compensating action, and (effector molecule is siRNA can to overcome traditional RNAi technology, small interfering RNA, siRNA) problem (Ossowski S such as " missing the target " of occurring in experimental implementation process, Schwab R, Weigel D.Gene silencing in plants using artificial microRNAs and other small RNAs.Plant J.53:674-690., 2008), effectively raise the efficiency that gene disturbs.

Rape, as the main oil crops of China, is extensively planted in the Yangtze valley, and national economy is had to material impact.Rape heterosis is obvious, and utilizing the combination of nuclear male sterility hybridization advantage is the important channel of heterosis utilization.Found at present polytype nuclear male sterility material both at home and abroad, and obtained impressive progress in theoretical and application aspect, and the discovery of new kind of male sterility source and research are the bases of Study on Heterosis always, and create more natural and artificial sterile material with this, by breed and production is applied.

Therefore, the present invention has developed that one and Pollen Brassicae campestris are grown and fertility regulates and controls relevant gene BnRabGDI3.By this gene of fluorescence quantitative PCR detection a large amount in the stamen of fertile plant, express.By transgenic experiments, confirm, the expression that suppresses AtRabGDI3 can cause Arabidopis thaliana flower pesticide heteroplasia, causes male sterile; And by cross expression BnRabGDI3 gene in Arabidopis thaliana, and the hybridization of male sterile transfer-gen plant can make the expression level of RabGdDI3 gene in filial generation be restored, the fertility of flower pesticide and pollen granule also returns to normal level simultaneously.Applicant's result is indicating that RabGDI3, controlling rape and Arabidopis thaliana pollen fertility, creates in male sterile transgenic material and has suitable application prospect.

Summary of the invention

The object of the invention is to be to provide a kind of rape BnRabGDI3 gene, this gene is high efficient expression in the bud of rape and stamen, by suppressing the expression of this gene, can reduce the fertility of plant anther, thereby obtain male sterile plants, be applied to cross-breeding.And this gene do not express in other majority of plant tissue, therefore in plant genetic engineering, the expression of reticent this gene can not cause the variation in vegetation growth of plant stage.

Another object of the present invention is the preparation method who has been to provide a kind of rape BnRabGDI3 gene, by BLAST, compare Arabidopis thaliana and rape, Chinese cabbage, wild cabbage, swede type rape order gene order-checking column database, at the sequence two ends design homologous primer that comprises full length gene, apply simple PCR method and can obtain the sequence of this gene.

A further object of the invention is to be to provide the application of a kind of rape BnRabGDI3 gene in controlling rape and Arabidopis thaliana pollen fertility.By the expression of reticent this gene, contriver can manually create male sterile based material; And utilize genetic engineering technique to cross, express the restorer material that this gene obtains, can make the fertility of male sterile material pollen be restored.This pair of material can application in rape cross-breeding is produced.

In order to complete above-mentioned purpose, the present invention adopts following technical scheme:

In order to obtain the present invention, contriver has carried out deeply and comprehensively research the genes involved in pollen development process, found that a new gene BnRabGDI3, high efficient expression in the flower pesticide of fertile plant, and express hardly in sterile plant, so the regulation and control of the fertility of this gene and plant pollen are relevant.Transgenic experiments has also confirmed this point: the expression that suppresses this gene can cause Arabidopis thaliana flower pesticide heteroplasia, causes male sterile.

According to an aspect of the present invention, above-mentioned purpose can be by providing the efficient expressing gene BnRabGDI3 of rape flower pesticide to realize, described gene contain described in SEQ ID No.1 nucleotide sequence or with they nucleotide sequences of homology in fact.

According to another aspect of the present invention, above-mentioned purpose can be by providing the efficient express polypeptide BnRabGDI3 of vegetables oil cauliflower medicine to realize, described polypeptide contain SEQ ID No.2 aminoacid sequence or with they aminoacid sequences of homology in fact.

According to another aspect of the present invention, above-mentioned purpose is by providing the artificial microRNA that contains BnRabGDI3 gene target (AATUTUTATATUUTGTUGAG) sequence to disturb recombinant vectors (pamiRNAi-RabGDI3) to realize the inhibition to RabGDI3 gene expression amount in Arabidopis thaliana.

According to another aspect of the present invention, above-mentioned purpose can be by providing microorganism (the agrobacterium tumefaciens EHA105 transforming with described recombinant vectors (pamiRNAi-BnRabGDI3), purchased from Dalian precious biotinylated biomolecule Products Co., Ltd, identical below) realize the conversion to Arabidopis thaliana, thus suppress the expression amount of RabGDI3 gene in Arabidopis thaliana.

According to another aspect of the present invention, above-mentioned purpose can by providing, with described microorganism, (transgenic plant that include the agrobacterium tumefaciens EHA105 conversion of pamiRNAi – RabGDI3 recombinant vectors be realized the regulation and control to flower pesticide fertility, obtain male sterile transfer-gen plant.

A preparation method for rape BnRabGDI3 gene, the steps include:

1, the clone of the efficient expressing gene of rape flower pesticide:

The primer sequence of 1.1 rape BnRabGDI3 genes:

According to this laboratory, carry out swede type rape (Brassica napus) gene order-checking resource, by ORF Find er and BLAST software, to all, surveying resource sequence analysis, determining BnRabGDI3 sequence.So by after compare of analysis, the homology zone design primer that comprises ORF in known rape sequence, thus guarantee that amplified production is full length sequence.Primer is: BnRabGDI3S:5 '-GTAAGATAGGAGGTGGTGG-3 ' and BnRabGDI3A:5 '-CGTAAAACCACTCAGCCAA-3 '.

The preparation of 1.2 rape BnRabGDI3 genes:

The present invention's rape used is two No. nine (the Wang Xinfa assistant researcher of oil crops institute provides, below identical) in swede type rape (Brassica napus L.).In two be seeded in land for growing field crops No. nine, normal field management.Utilize SDS cracking process (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, below identical) extract genomic dna.As masterplate, carry out pcr amplification (Fig. 1).Step is: extract genomic dna 25 μ l, as template, increase, reaction system is 50 μ l, adds respectively 10 * Ex Taq buffer5 μ l, dNTP4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq0.5 μ l, the about 100ng of DNA masterplate 1 μ l, ddH ₂o37.5 μ l.The BnRabGDI3 gene order design PCR the primer obtaining according to rape genome sequencing is BnRabGDI3S and BnRabGDI3A (already described above).Amplified production size is 2064bp, PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours, PCR product is through 1.0%(sepharose/TE solution quality volume ratio, identical below) agarose gel electrophoresis detection, gel reclaims test kit (purchased from root biochemical technology Beijing, sky company limited, identical below) after purifying reclaims, be connected to pMD18-T carrier (purchased from Dalian precious biotechnology company limited, identical below), heat shock method (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) competent cell that transforms gold bacterial strain is (purchased from Dalian precious biotechnology company limited, identical below), coat and contain penbritin 50 μ g/mL(mass volume ratios, identical below) LB solid medium (fill a prescription as follows: take respectively 10 grams of Tryptoness, 5 grams of yeast extracts and 10 grams of sodium-chlor, 8 grams of agar are dissolved in distilled water successively, constant volume is in 1000 milliliters.Be sub-packed in 500 milliliters of triangular flasks, 121 ℃, under 6.859 * 104Pa, autoclave sterilization is 20 minutes.Minute install in culture dish, 4 ℃ of refrigerations are standby, below identical) on flat board, 37 ℃ of overnight incubation, select 6 of hickies.Adopt M13 primer: 5 '-TGTAAAACGACGGCCAGT-3 ' and 5 '-CAGGAAACAGCTATGACC-3 ', is bacterium colony PCR and detects.Bacterium colony PCR concrete grammar (following identical) is to do masterplate by a small amount of bacterial plaque of toothpick picking of sterilizing, and reaction system is that 10 μ L include: 10 * Taq buffer(is containing MgCl ₂) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH ₂o6.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 33 circulations, 72 ℃ 10 minutes, amplification size is 2744bp, already described before 1.0%() agarose gel electrophoresis detected magnitude correctly after.The correct bacterial plaque of PCR detected magnitude is inoculated into containing the liquid LB substratum of penbritin 50 μ g/mL and (is filled a prescription as follows: take respectively 10 grams of Tryptoness, 5 grams of yeast extracts and 10 grams of sodium-chlor, be dissolved in distilled water, constant volume is in 1000 milliliters, 121 ℃, under 6.859 * 104Pa, autoclave sterilization is 20 minutes, identical below), at 37 ℃, 200r/min shaking culture is spent the night, (J. Pehanorm Brooker .D.W. Russell is outstanding for alkaline process in a small amount, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) extraction plasmid, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (being 2064bp), (2 kinds of enzymes are purchased from TaKaRa company to adopt Kpn I/Xba I enzyme, identical below) cut plasmid is carried out to double digestion (following identical), it is 10 μ l that enzyme is cut system (following identical), comprise plasmid DNA 5 μ l, Kpn I 0.5 μ l, Xba I0.5 μ l, ddH ₂o4 μ l, 37 ℃ are spent the night, already described before 1.0%() agarose gel electrophoresis detects.The correct positive recombinant clone called after pMD18-BnRabGDI3(of detection is connected into pMD18-T vector construction by goal gene sequence B nRabGDI3 to be formed, identical below), sequence information in order to ensure promotor in carrier, pMD18-BnRabGDI3 is served to Hai Yingjun company to check order, analytical results shows, obtained a kind of rape BnRabGDI3 full length gene of separation, its sequence is nucleotide sequence shown in SEQ ID NO:1.

By online software Genescan(http: //genes.mit.edu/GENSCAN.html) analyze CDS sequence and the aminoacid sequence that obtains this gene.The CDS sequence of gene and Arabidopis thaliana CDS sequence, by NCBI compare of analysis, are found to contain in this section of region complete ORF reading frame and initiator codon ATG.The rape BnRabGDI3 albumen total length that has obtained a kind of separation, its sequence is aminoacid sequence shown in SEQ ID NO:2.The molecular weight of protein and theoretical iso-electric point are carried out at line computation (http://us.expasyorgtools/pi too1.htm).BLAST finds that BnRabGDI3 and AtRabGDI3CDS nucleotide homology are greater than 90%, utilizes DNA MAN and online software TCOFFEE(http: //www.tcoffee.org/) their amino acid identity reaches 97%.Result shows that cloned rape RabGDI3 is the homologous gene of AtRabGDI3, by its called after BnRabGDI3.

By GSDS(Gene Structure Display Server) ( http:// gsds.cbi.pku.edu.cn/) analyses and prediction find BnRabGDI3 and AtRabGDI3 gene structure closely similar.This gene start codon is ATG, and terminator codon is TGA.Contain 12 exons, 11 introns, the size of each intron, exon, distribution etc. are identical with AtRabGDI3.By online software Genescan(http: //genes.mit.edu/GENSCAN.html) analyze CDS sequence and the aminoacid sequence that obtains this gene.BLAST finds to be greater than 90%, AtRabGDI3 and BnRabGDI3 homologous gene 445,436 amino acid of having encoded respectively with AtRabGDI3CDS nucleotide homology.Application SOPMA prediction finds that two coded by said gene albumen are very conservative in secondary structure, and its ɑ spiral, extended chain, β-bend are very similar with the irregular proportion of composing such as curling.By online software Pro tScale(http: //www.expasy.ch/tools/protscale.html) analyze arranging of the two amino acid whose hydrophilic and hydrophobic more consistent, the most amino acid of two sequences is below 0 axis, and therefore most amino acid belongs to hydrophilic amino acid.We utilize the online software of TMHMM (http://ww.cbs.dtu.dk/services/TMHMM/) to analyze the membrane spaning domain of 2 RabGDI3 albumen.The AAs value of the protein sequence of Arabidopis thaliana and swede type rape shows that two sequences does not have signal peptide section, there is no obvious cross-film region, and the N-in value of two protein sequences is all lower, so RabGDI3 is not a membranin.Application PSORT program (http://psort.hgc.jp/) is carried out Subcellular Localization to it, and result shows that this albumen may be present in tenuigenin.Software prediction result is consistent with the environment of GDI in Rab protein circulation.Therefore BnRabGDI3 is the same with other GDI genes plays an important role in Rab protein regulation vesica transport process, has the function of controlling vesica transportation.The present invention finds after building the rna interference vector arabidopsis thaliana transformation of RabGDI3, and male sterile phenotype has all appearred in transfer-gen plant because the expression of RabGDI3 is suppressed.Illustrate that RabGDI3 has the new function of controlling the growth of Arabidopis thaliana flower pesticide and pollen fertility.

2, the expression pattern of rape BnRabGDI3 gene:

The present invention's another kind of rape used is swede type rape (Brassica napusL.) dominant genic male sterile heterozygosis sterile line J03AB(Msmsrfrf*msmsrfrf).System is through backcrossing and hand over and be bred as with sister for many years.Sterile strain called after A, fertile plant called after B, the two can be considered a pair of near isogenic line, only exist sterile Site discrepancy (Hu Shengwu, Yu Chengyu, Zhao Huixian, road is bright, the seed selection of hybrid rape dominant core sterile material Shaan-GMS homozygous two-type line 803AB.Northwest agricultural journal, 2002, ii (4): 25-2).For examination material, be seeded in land for growing field crops, normal field management.

From the identical fertile plant of same grown in field condition, get root, stem, leaf, bud, angle fruit, anatomical isolation gynoecium and stamen (flower pesticide) from bud, every kind of material is at least got three repetitions, each repeats at least one strain, after sampling, with masking foil, wrap up, be positioned over rapidly in liquid nitrogen-80 ℃ of preservations.In land for growing field crops, from rape fertile plant and sterile plant, get bud respectively, take back behind laboratory, stamen and gynoecium on ice chest in difference picking fertile plant and sterile plant bud, every kind of material is at least got three repetitions, each repeats at least one strain, after sampling, with masking foil parcel, be positioned over rapidly in liquid nitrogen-80 ℃ of preservations.While extracting RNA, in liquid nitrogen, plant sample is ground to powdery, the extraction of RNA is carried out in the requirement that utilizes Trirol to extract test kit (purchased from Invitrogen company, below identical).Total RNA that carries is dissolved in the distilled water without RNase.DNase I (purchased from Promega company, below identical) is removed DNA that may be residual.With Protein Detection instrument (DU650BECKMAN, USA), detecting respectively RNA at 260 nanometers and 280 nanometer absorbance values, in conjunction with 1%(mass volume ratio) agarose gel electrophoresis identifies purity and the concentration of RNA.The RNA obtaining of take is template, according to the explanation of Promega company reversed transcriptive enzyme, carries out reverse transcription, after the cDNA packing obtaining, in-80 ℃, saves backup.

Quantitative real time PCR Instrument is IQ5(Bio Rad Laboratories), adopt rape Actin as internal standard gene (accession number AF111812), Actin gene primer is 5 ' CTGGAATTGCTGACCGTATGAG3 ' and 5 ' ATCTGTTGGAAAGTGCTGAGGG3 '.According to the BnRabGDI3 gene primer of the conservative section design of Arabidopis thaliana and rape RabGDI3 gene C DS sequence, be 5 '-CCCCGACTACTATGGAGGAGAA-3 ' and 5 '-AGCGTGTGGATTAGGGTTTGA-3 '.

Quantitative fluorescent PCR reacts every group of experiment and all completes three biology repetitions, and each biology repeats at least to do three technology and repeats.Detect respectively the expression of BnRabGDI3 in Oil Rape Tissue (root, stem, leaf, flower, angle fruit, large, medium and small bud, stamen, gynoecium).

With the relative expression quantity that compares Ct method (Δ Δ Ct) calculating gene.By 2 ^{-Δ Δ Ct}relative expression quantity and systematic error (Kenneth J Livak.Thomas D Schmittgen.2001, the Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the2 of estimation goal gene ^{-△ △ C}t Method.METHODS25,402 – 408.).When calculating relative expression quantity, the sample of root of take is reference, is about to its value and converts 1(standard value to), other sample again with its relatively, obtain relative expression's value.

3, the functional verification of RabGDI3 gene:

The artificial microRNA of 3.1RabGDI3 gene disturbs the structure of plant expression vector: pamiRNAi-AtRabGDI3

In order to study the function of the efficient expressing gene BnRabGDI3 of pollen in the present invention, adopted amiRNAi(artificial microRNA interference, artificial microRNA disturbs, below identical) technology.Due to the RabGDI3 of rape BnRabGDI3 and Arabidopis thaliana have similar expression pattern, gene structure (Li Zhenbo. the functional study .[master thesis of rape microspore development related gene B nRabGDI3]. Wuhan, Hubei: albumen homology South-Center University For Nationalities) and more than 90%, infer that both have identical function, so the function of rape BnRabGDI3 is gain-of-function by research Arabidopis thaliana AtRabGDI3.The structure principle of artificial microRNA interference carrier is (Schwab R. as shown in Figure 3, Ossowski S., Riester M., et al.Highly specific gene silencing by artificial microRNAs in Arabidopsis.Plant Cell, 2006,18 (5): 1121-1133).The target sequence of choosing is: TTACACAGCACTCAAACGTGG, corresponding Oligo DNA is: AATGTGTCGTGAGTTTGCACC.On this method basis, the invention such as Yan has proposed a kind of construction process (Yan H. of plant manpower fine RNA expression vector rapidly and efficiently, Deng X., et al.A novel approach for the construction of plant amiRNA expressionvectors.Journal of Biotechnology, 2011,151:9-14), with reference to above-mentioned bibliographical information method, completed the structure of artificial microRNA interference carrier pamiRNAi-AtRabGDI3 in this experiment.

By freeze-thaw method (J. Pehanorm Brooker .D.W. Russell work, Huang Peitang etc. translate molecular cloning test guide (third edition) Science Press, identical below) plasmid of the pamiRNAi-AtRabGDI3 carrier that contains above-mentioned acquisition is transformed to Agrobacterium EHA105(purchased from Dalian precious biotinylated biomolecule Products Co., Ltd, below identical): step is as follows:

1: get 0.2ml competence Agrobacterium, in ice, slowly melt.

2: add approximately 2 μ g recombinant plasmid dnas, mix gently, after ice bath 30min, drop into liquid nitrogen flash freezer 1min, then 37 ℃ of water-bath 5min, melt cell.

3: add 800 μ l not containing microbiotic LB liquid nutrient medium (already described) above, 28 ℃ of jogs are cultivated 4-5h.

4:12000rpm, 30s, removes supernatant, and cell is resuspended in 0.2ml LB liquid nutrient medium (already described) substratum above.

5: culture is uniformly coated on containing Rif(50mg/L) on LB solid medium and Str(50mg/L) (already described above) agar plate, cultivate 2 days for 28 ℃, after there is transformant on flat board, choose bacterium, with

BarF:5 '-TTTCGGTGACGGGCAGGAC-3 ' and BarR:5 '-CTGCACCATCGTCAACCAC-3 ' carry out bacterium colony PCR detection for primer.Detection method is as follows: be to do template by a small amount of bacterial plaque of toothpick picking of sterilizing, reaction system is that 10 μ l include: template DNA template 1 μ L (about 100ng), 10 * Taq buffer(is containing MgCl2) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH2O5.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 80 seconds, 72 ℃ 1 minute, 32 circulations, 72 ℃ 10 minutes, amplification size be 1028bp.PamiRNAi-AtRabGDI3 is proceeded to before agrobacterium tumefaciens EHA105(already described), by the screening of Rifampin (50 μ g/mL) resistant panel, picking bacterial plaque, bacterium colony PCR detection validation (already described above).Genetic transformation and the transfer-gen plant screening of 3.2amiRNAi plant expression vector: pamiRNAi-AtRabGDI3 in Arabidopis thaliana: adopt inflorescence infestation method (Zhang X.R.et al.Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method.Nature, 2006,1:1-6, below identical) carry out transformation of Arabidopsis thaliana.Already described before the agrobacterium tumefaciens EHA105(that preparation contains recombinant vectors pamiRNAi-AtRabGDI3) bacterium liquid, transform proceed to the day before yesterday the LB liquid nutrient medium that contains Rifampin 50 μ g/ml (in (already described above), 28 ℃ of incubated overnight.Second day detects the light absorption value of bacterium liquid with ultraviolet spectrophotometer (SPEKOL1300) under 276nm nano wave length, when the light absorption value of bacterium liquid reaches between 1.6-2.0, takes out.Room temperature (20-25 ℃, below identical), with the centrifugal 10min of 4000g, is abandoned supernatant, and precipitation is suspended in isopyknic 5% sucrose solution (mass volume ratio of sucrose and distilled water, below identical).Muddy sucrose solution is poured in a large culture dish, and before conversion, adding final concentration is 0.02%(volume ratio) Silwet l-77(purchased from the Five continents, Beijing unit industry science and trade center, below identical).Mix afterwards the whole inflorescence of Arabidopis thaliana to be transformed being immersed in sucrose gently, silent several 15 seconds, take out plant.Plant after conversion is wrapped with a black plastic bag, is placed on growth case and cultivates.Second day is opened plastics bag, and cultivate in the place that is placed on light intensity.Conversion tried again every one week.Cultivate and gather in the crops seed in about one month, seed is dry 3-5 days under incubator or daylight.

The T0 that transforms results is broadcast in being mixed with the vermiculite of PNS nutritive medium for seed, (PNS nutritive medium composition is: every liter containing 5ml1M KNO3,2ml1M Ca (NO3) 2 ˙ 4H2O, 2ml1M MgSO4 ˙ 7H2O, 2.5ml20mM Fe.EDTA, 2.5ml 1M phosphoric acid buffer (pH5.5), 1ml MS trace element).Transfer to temperature 20-25 ℃, intensity of illumination 5000-10000 lumen, the photoperiod is 16 hours illumination/8 hour dark, during atmospheric moisture is greater than between more than 80% cultivation, normal management.According to distinctive Glufosinate ammonium (Bar) resistance screening positive plant on expression vector.Arabidopis thaliana grows after a slice true leaf, sprays the weedicide Basta(of 30ppm purchased from Bayer AG).After one week, spray the Basta of 50ppm, obtain Arabidopis thaliana transgenic positive seedling.The transformed plant that screening obtains, claims T1 for transformed plant (following identical).When blade grows to enough size (3-4 leaf phase), get a little green seedling leaf, extract before DNA(already described), carry out the PCR positive detection (following identical) of converting material.Primer sequence is BarF:5 '-TTTCGGTGACGGGCAGGAC-3 ' and BarR:5 '-CTGCACCATCGTCAACCAC-3 ', reaction system is that 10 μ l include: template DNA template 1 μ L (about 100ng), 10 * Taq buffer(is containing MgCl2) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH2O5.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 80 seconds, 72 ℃ 1 minute, 32 circulations, 72 ℃ 10 minutes, amplification size be 1028bp.With 1% agarose gel electrophoresis, detect (already described) above, result shows, the artificial microRNA of RabGDI3 gene disturbs plant expression vector pamiRNAi-AtRabGDI3 successfully to proceed to Arabidopis thaliana.Obtained altogether 11 strain transgenic positive plant (plant that contains testing goal fragment claims positive plant, below identical, Fig. 4), called after MI-1 respectively, MI-2 etc. (following identical).

3.3 artificial microRNA interference carrier pamiRNAi-AtRabGDI3 transgenic arabidopsis Phenotypic Observations:

The transgenic positive plant obtaining after herbicide screening and PCR detect between growth in normal management observe its phenotype.In flowering period, white but unopened flower has been leaked on the branch top of choosing each transfer-gen plant, pushes bud aside.At magnifying glass (3 times) and lower flower pesticide and the pollen observed of stereoscopic microscope (OLYMPUS SZ61TRC).With dissecting needle, isolate flower pesticide, with reference to Alexandria staining (Alexander, M.P.Differential staining of aborted and non-aborted pollen.Stain Technol, , 44:117-122., 1969, identical below), 40 ℃ of heating in water bath Alexandria staining fluids (take that to prepare about 100 milliliters of staining fluids be example: ethanol 10ml, 1% malachite green spirituous solution 1ml, distilled water 50ml, glycerine 25ml, 1% C.I. 42685 aqueous solution 5ml, 1% orange G aqueous solution 0.5ml, Glacial acetic acid 1-4ml, 5 grams of phenol, 5 grams of Chloral Hydrates, identical below) and soak flower pesticide spend the night (10-15 hour), with pressed disc method Observation of Microspore under microscope (OLYMPUS IX71).By observing and add up the abortive degree of the ratio judgement sporule of normal sporule (dying orange) and abortion sporule (dying green).Productive phase the detect by an unaided eye solid situation of transgenic arabidopsis.Dyeing observations shows: the flower pesticide of wild-type Arabidopis thaliana is full and be full of sporule, and sporule is all dyed orange, illustrates that microspore development is normal.And the medium and small spore number of the flower pesticide of transgenic arabidopsis is all far less than wild-type, there is a small amount of normal sporule number, other is empty flat or is dyed to the sporule (Fig. 5) of green abortion.Through all transgenic progeny plant are observed to statistics, result shows that male sterile phenotype has all appearred in most of transgenic progeny Arabidopis thaliana, illustrates that typical male sterile phenotype has appearred in AtRabGDI3 interference of transgene plant.

4, the complementary function of BnRabGDI3 gene checking:

The structure of 4.1BnRabGDI3 gene overexpression plant expression vector OX-BnRabGDI3 and the conversion of agrobacterium tumefaciens bacterial strain EHA105.

In order further to confirm that rape BnRabGDI3 gene and Arabidopis thaliana AtRabGDI3 gene have identical function, we build BnRabGDI3 gene overexpression plant expression vector, arabidopsis thaliana transformation.By the OX-BnRabGDI3 transgenic progeny obtaining, be male parent, the pamiRNAi-AtRabGDI3 male sterile transgenic progeny that the artificial microRNA of take disturbs is hybridized as female parent, and whether the flower pesticide fertility that detects filial generation plant can be restored.The construction process of over-express vector is as follows:

The rape florescence, in field, collect rape bud, drop into liquid nitrogen flash freezer.According to Trirol, extract test kit (purchased from Invit rogen company, before already described) requirement extract in the RNA of two No. nine (already described above) buds, the RNA obtaining of take is template, according to the explanation of Promega company reversed transcriptive enzyme, carry out reverse transcription (already described) above, after the cDNA packing obtaining, in-80 ℃, save backup.The bud cDNA that obtains of take carries out the pcr amplification of BnRabGDI3 gene CDNA fragment as template.According to swede type rape BnPABP5 gene order (SEQ ID NO:1) design primer, RabGDI3F:GACGAGCTCTCACTCCGTTGAGGAGGG and RabGDI3R:GACATCTAGAATGGTTGATCAAGTCATCCC.5 ' end of primer sequence has been introduced respectively XbalI and SacI restriction endonuclease sites.PCR reaction system is that 25 μ L include: 1 * PCR buffer, MgCI1.5mmol/L, every liter of dNTP0.2mmol/L(mmole), primer concentration is 0.5mol/L ，PfuMei 1.5 units, the about 100ng of template.PCR response procedures is as follows: 94 ℃ of 5min; 94 ℃ of 30sec, 55 ℃ of 45sec, 72 ℃ of 1min, 35 circulations; 72 ° of C extend 8min.PCR product is through 1.0%(mass volume ratio) agarose gel electrophoresis detection (already described above).After completing, with gel, reclaim test kit and reclaim purifying object fragment (already described) above, obtain BnRabGDI3 gene CDNA full length sequence.

With the BnRabGDI3 gene CDNA full length sequence obtaining, replace the gus gene sequence in pBI121 plant expression vector, obtain the plant over-express vector of BnRabGDI3 gene.

For completing this object, first use Xba I/SacI double digestion (2 kinds of enzymes are purchased from TaKaRa company) BnRabGDI3 gene CDNA fragment, with Xba I/SacI enzyme, cut pBI121(Chen simultaneously, P.Y., Wang, C.K., Soong, S.C.To, K.Y.Complete sequence of the binary vector pBI121and its application in cloning T-DNAinsertion from transgenic plants.Mol.Breed.11,287-293) the GUS fragment of plasmid.The enzyme system of cutting is already described before 10 μ l(), endonuclease reaction carries out in 37 degree incubators, after about 4-6 hour, use 1%(mass volume ratio) agarose gel electrophoresis detection.

The enzyme of BnRabGDI3 gene CDNA fragment is cut to the large fragment cutting on product and cloning vector pBI121 and reclaimed test kit (already described) recovery above with DNA gel.In the enzyme of BnRabGDI3 gene CDNA fragment, cut product than pBI121 carrier segments (150ng BnRabGDI3 gene CDNA fragment: the ratio of 50ng carrier segments)=3:1 (molar concentration rate) biased sample, add T4DNA ligase enzyme 5 units, 10 * reaction buffer, sterilized water supplements volume to 20 μ L, and 16 ℃ of connections are spent the night.After conversion, screen containing on kantlex (50 μ g/mL) solid LB flat board, with NPT II F:5 '-GATGGATTGCACGCAGGT-3 ' and NPT II R:5 '-TCAGAAGAACTCGTCAAG-3 ' primer, carry out bacterium colony PCR detection after choosing spot.Bacterium colony PCR concrete grammar (following identical) is to do masterplate by a small amount of bacterial plaque of toothpick picking of sterilizing, and reaction system is that 10 μ L include: 10 * Taq buffer(is containing MgCl ₂) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH ₂o6.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 1 minute, 55 ℃ 30 seconds, 72 ℃ 2 minutes 30 seconds, 33 circulations, 72 ℃ 10 minutes, amplification size is 800bp, already described before 1.0%() agarose gel electrophoresis detected magnitude correctly after.Take before BarF and BarR(already described) already described before primer is bacterium colony PCR(), select positive strain upgrading grain, enzyme is cut the recombinant plasmid called after OX-BnRabGDI3 that checking is correct.Then utilize freeze-thaw method (already described) that OX-BnRabGDI3 is proceeded to before agrobacterium tumefaciens EHA105(already described above), kantlex (50 μ g/mL) and the dual anti-property plate screening of Rifampin (50 μ g/mL), choose spot, carry out bacterium colony PCR detection validation (already described) above.

Genetic transformation and the transfer-gen plant screening of 4.2OX-BnRabGDI3 in Arabidopis thaliana:

Adopt inflorescence infestation method to carry out transformation of Arabidopsis thaliana (already described) above.In arabidopsis thaliana transformation the day before yesterday, already described before the agrobacterium tumefaciens EHA105(that preparation is contained to carrier OX-BnRabGDI3) bacterium liquid proceeds in the LB liquid nutrient medium that contains kantlex 50 μ g/ml, Rifampin 50 μ g/ml, 28 ℃ of incubated overnight.Second day detects light absorption value with ultraviolet spectrophotometer (SPEKOL1300) under 276 nano wave lengths, when the light absorption value of bacterium liquid is between 1.6-2.0, takes out.Room temperature (20-25 ℃, below identical), with the centrifugal 10min of 4000g, is abandoned supernatant, and precipitation is suspended in isopyknic 5%(mass volume ratio) in sucrose.Muddy sucrose solution is poured in a large culture dish, and before conversion, adding final concentration is 0.02%(volume ratio) Silwet l-77(purchased from the Five continents, Beijing unit industry science and trade center, below identical).Mix afterwards the whole inflorescence of Arabidopis thaliana to be transformed being immersed in sucrose gently, silent several 15 seconds, take out plant.Plant after conversion is wrapped with a black plastic bag, is placed on growth case and cultivates.Second day is opened plastics bag, and cultivate in the place that is placed on light intensity.Conversion tried again every one week.Cultivate and gather in the crops seed in about one month, seed is dry 3-5 days under incubator or daylight.By the T0 that transforms results for seed 70%(volume ratio) alcohol and 0.01%(volume ratio) and mercuric chloride surface sterilization after 10 minutes with distilled water wash (5～7 times) for several times, then MS solid screening culture medium (MS macroelement mother liquor 100ml is arrived in piping and druming equably; MS trace element mother liquor 10ml; The organic mother liquor 10ml of MS; MS molysite 10ml; Inositol 10ml; Sucrose 30g; With 1M NaOH, adjust PH to 5.8,12g agar powder, is settled to 1L, standby after high pressure 121 degree sterilizings.Add 8g agar powder to can be configured to solid medium.Various mother liquor formulas are in Table 1) surface.4 ℃ of vernalization 4-6 days, put into constant incubator and cultivate.According to peculiar kalamycin resistance on expression vector, screen positive seedling.When blade grows to enough size (3-4 leaf phase), get a little green seedling leaf and carry out PCR positive detection, primer is NPT II F: and already described before NPT II R(), reaction system is 10 μ l.Include: template DNA 1 μ L (about 100ng), 10 * Taqbuffer(is containing MgCl ₂) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH ₂o5.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute, 32 circulations, 72 ℃ 10 minutes, amplification size be 800bp.Result shows that (Fig. 7) obtained transgenic positive plant (plant that contains testing goal fragment claims positive plant, below identical).By more than 3 generations of positive plant selfing, obtain 8 T3 that isozygoty for strain.Difference called after OX-1, OX-7 etc. (following identical).

Table 1MS substratum mother liquor formula

The hybridization that 4.3AtRabGDI3RNAI interference of transgene male sterile Arabidopis thaliana and BnRabGDI3 cross express transgenic plant:

The Arabidopis thaliana male sterile transfer-gen plant that artificial microRNA obtains after disturbing plant expression vector pamiRNAi-AtRabGDI3 to transform through the weedicide Basta(in seedling stage purchased from Bayer AG, before already described) (already described above) normal management after screening.Sow after the same method wild-type Arabidopis thaliana the same period, spraying herbicide Basta, does not make its florescence synchronous.Arabidopis thaliana entered after the florescence, and every morning, 10 pollen of later getting wild-type plant were pollinated to transgenosis sterile plant.After seed maturity, results seed.Planting seed, in vermiculite, is coverd with plastic cloth, and 4 ℃ of vernalization 4-5 days, transfer in growth case and sprout.After sprouting according to above described in 3.2 method in seedling stage, carry out herbicide screening, obtain AtRabGDI3 transgenosis male sterile plants (be called for short MI plant below, below identical).

The same period, by OX-BnRabGDI3 transform by kantlex screening (already described above) and PCR verify (already described above) be positive T3 for transfer-gen plant seed at MS substratum (already described above) upper seeding wheel.Method is as follows: by T3 for seed 70%(volume ratio) alcohol surface sterilization is after 2-3 minute, use 0.01%(volume ratio) mercuric chloride surface sterilization 10 minutes, then with distilled water wash several (5～7 times), then MS solid screening culture medium (containing kantlex 50 μ g/ml) surface is arrived in piping and druming equably.4 ℃ of vernalization 4-6 days, put into constant incubator and cultivate.After growing 2-3 sheet true leaf, be transplanted in vermiculite, obtain BnRabGDI3 and cross express transgenic plant (be called for short OX plant below, below identical).

After male sterile MI plant and OX plant blossom, every morning, 10 pollen of later getting OX plant were pollinated to MI plant.After seed maturity, gather in the crops cenospecies.

The screening of 4.4 filial generations and Phenotypic Observation:

The cenospecies of results is seeded at MS(kantlex 50 μ g/ml) on substratum (already described above), grow after 2-3 sheet true leaf, by the plantlet of transplant of survival in vermiculite, normal management (already described above) between growth.After seedling recovers stalwartness, spray before the weedicide Basta(of 30ppm already described).After one week, again spray the Basta of 50ppm, the plant of final survival is the hybridization transgenic progeny that simultaneously contains pamiRNAi-AtRabGDI3 and OX-BnRabGDI3 object fragment.By its called after MI * OX plant.

MI * OX plant entered after flowering period, chose each plant branch top and had leaked white but unopened flower, pushed bud aside.At magnifying glass (3 times) and lower flower pesticide and the pollen observed of stereoscopic microscope (OLYMPUS SZ61TRC).With dissecting needle, isolate flower pesticide, with Alexandria staining Observation of Microspore (already described) under microscope (OLYMPUS IX71) above.By observing and add up the abortive degree of the ratio judgement sporule of normal sporule (dying orange) and abortion sporule (dying green).Productive phase the detect by an unaided eye solid situation of transgenic arabidopsis.Result shows (Fig. 8), in filial generation flower pesticide, has been full of pollen granule, and wherein major part presents orange.After entering productive phase, the angle of filial generation MI * OX plant fruit can reach maturity, and the seed development normal (Fig. 8) in the fruit of angle, illustrates that the flower pesticide of filial generation MI * OX plant can produce a large amount of fertile flower medicines.MI male sterile plants through with OX plant hybridization pollination after, the pollen fertility of filial generation MI * OX plant of acquisition has obtained recovery.This result has fully confirmed the male sterile phenotype that cross expressing of rape BnRabGDI3 gene can be complementary causes due to Arabidopis thaliana AtRabGDI3 gene silencing.The BnRabGDI3 gene function with control pollen fertility the same as Arabidopis thaliana AtRabGDI3 gene.

5, the expression level analysis of RabGDI3 gene in transgenic arabidopsis offspring:

By MI plant, rear (already described) sowed respectively and screened to OX plant and MI * OX plant above.The bud of winning respectively survival plant at the florescence, quick-frozen, in liquid nitrogen, is analyzed the expression level of target gene RabGDI3 with FQ-PCR (method is with reference to technical scheme 2).In the AtRabGDI3RNAI interference of transgene male sterile MI strain of all detections, the expression amount of target gene RabGDI3 is all starkly lower than wild-type Arabidopis thaliana, and BnRabGDI3 crosses the expression amount of target gene RabGDI3 in express transgenic OX plant, is all significantly higher than wild-type Arabidopis thaliana.The fertility of offspring's flower pesticide be also restored (Fig. 8,9) when the expression amount of RabGDI3 recovers in the filial generation MI * OX plant of the two.

6, the functional analysis of BnRabGDI3 gene:

Expression study to BnRabGDI3 gene in rape different tissues organ is found: take root as with reference to being made as 1, BnRabGDI3 has a small amount of expression in the leaf of rape and angle fruit, in root and stem, substantially do not express, spending middle a large amount expression, be approximately 800 times of left and right of other tissue, be one and spending the gene of middle high efficient expression, as shown in Figure 2 A.The sterile strain J03A small bud (<1mm) of take is reference, and the expression of BnRabGDI3 in sterile strain is subject to obvious inhibition, at later stage expression amount, slightly rises.In fertile plant growth course, this gene expression amount rises gradually, the highest at development later stage expression amount, is gradually the trend rising, and is with reference to more than 4 times, as shown in Figure 2 B of expression level in 80 times of sample and sterile strain bud.The gynoecium (AP) of sterile strain J03A of take is reference, and RabGDI3 gene is very obvious in sterile strain and fertile plant stamen differential expression, and the expression amount in fertile plant stamen is the highest, is more than 4000 times in sterile strain.As shown in Figure 2 C.The result shows that BnRabGDI3 is a specifically expressing in stamen, with the closely-related gene of microspore development.

The description (obtaining in the clone of the efficient expressing gene of technical scheme 1 Pollen Brassicae campestris) of the efficient expressing gene BnRabGDI3 of a kind of rape flower full length sequence SEQ ID NO:1.Utilize homologous clone method to obtain the efficient expressing gene BnRab GDI3 that spends of rape, by online software Genescan(http: //genes.mit.edu/GENSCAN.html) analyze C DS sequence and the aminoacid sequence that obtains this gene.BLAST finds to be greater than 90%, AtRab GDI3 and BnRabGDI3 homologous gene 445,436 amino acid of having encoded respectively with AtRabGDI3CDS nucleotide homology.Application SOPMA prediction finds that two coded by said gene albumen are very conservative in secondary structure.By online software Pro tScale(http: //www.expasy.ch/tool s/protscale.html) analyze arranging of the two amino acid whose hydrophilic and hydrophobic more consistent, the most amino acid of two sequences is below 0 axis, and therefore most amino acid belongs to hydrophilic amino acid.By GSDS(Gene Structure Display Ser ver) ( http:// gsds.cbi.pku.edu.cn/) analyses and prediction find BnRabGDI3 and AtRabGDI3 gene structure closely similar.This gene start codon is ATG, and terminator codon is TGA.Contain 12 exons, 11 introns, the size of each intron, exon, distribution etc. are identical with AtRabGDI3.

Therefore the present invention utilizes Arabidopis thaliana to study the function of BnRabGDI3.Utilize artificial microRNA technology in Arabidopis thaliana, to suppress the expression level of RabGDI3 gene, obtain MI transfer-gen plant.Utilize quantitative fluorescent PCR to T ₂expression level detected result for target gene AtRabGDI3 in transgenic positive seedling bud shows that the interference effect of constructed amiRNA carrier arabidopsis thaliana transformation is remarkable, and the expression of RabGDI3 in transgenic progeny plant bud is subject to obvious inhibition (Fig. 9 A).And Phenotypic Observation result shows that transfer-gen plant is not tied angle fruit or angle fruit is little and flat; In bud, filigree is very short, and pollen is less; And not full, the shrivelled debility of seed, demonstrates certain sterile phenotype.Sporule Alexandria dyeing observations shows that the flower pesticide of wild-type Arabidopis thaliana is full and be full of sporule, and sporule is all dyed orange, and microspore development is normal.And the medium and small spore number of the flower pesticide of transgenic arabidopsis is all far less than wild-type, there is a small amount of normal sporule number, other is empty flat or is dyed to the sporule (Fig. 5) of green abortion.Through all transgenic progeny plant are observed to statistics, result shows that male sterile phenotype has all appearred in most of transgenic progeny Arabidopis thaliana, illustrates that male sterile phenotype has appearred in AtRabGDI3 interference of transgene plant.The expression that shows inhibition or reduction AtRabGDI3 gene can cause plant pollen abortion, makes the ability of plant decline or lose completely, obtains male sterile plants.

In addition, the present invention has built rape BnRabGDI3 over-express vector arabidopsis thaliana transformation simultaneously.Obtained expression OX transgenic progeny.By the pollen with OX plant, pollinate Phenotypic Observation that the filial generation that obtains carries out and RabGDI3 gene expression dose of MI plant detected and found: the crossing to express of BnRabGDI3 can be recovered the expression level that AtRabGDI3 disturbs target gene in plant, disturbs the fertility of plant flower pesticide to be also restored (Fig. 8) simultaneously.Confirmed that BnRabGDI3 gene is equally a gene that microspore development is relevant with Arabidopis thaliana AtRabGDI3 gene, played the effect of regulation and control pollen fertility.The expression that shows inhibition or reduction BnRabGDI3 gene by indirect experiment can cause plant pollen abortion, makes the ability of plant decline or lose completely, obtains male sterile plants.BnRabGDI3 gene has the function of controlling pollen fertility, for utilizing genetic engineering technique to create male sterile material, has using value.

The present invention compared with prior art, has the following advantages and effect:

1, by this gene of clone, study this gene in the developmental effect of rape flower pesticide, clear and definite this gene has the function of controlling anther development.By disturbing the expression of this gene, applicant can manually create male sterile material, for realizing manually operated pollination system, provides new sterile gene.

2, by building the artificial microRNA carrier pamiRNAi-AtRabGDI3 of RabGDI3 gene, arabidopsis thaliana transformation, the transfer-gen plant of acquisition high interference efficiency, for research gene function provides an effective means.

3, by the Phenotypic Observation that transgenic arabidopsis is carried out, identify, contriver obtains the transgenic arabidopsis that 11 strains have male sterile phenotype, illustrates that RabGDI3 gene has the function of efficient control plant anther fertility.

4, utilized the transfer-gen plant of expressing rape BnRabGDI3 with Human disturbance Arabidopis thaliana AtRabGDI3 gene, to cause male sterile plant hybridization, offspring plant fertility restorer.Proof BnRabGDI3 and AtRabGDI3 gene have the function of identical control pollen fertility.

5, applicant can above-mentioned artificial microRNA perturbation technique and is crossed expression technology, manual creation has the restorer of male sterile material and this sterile material of some excellent economical character, as exploitation has other sterile line or the restorer of excellent proterties of high sense, high resistance, floorboard with high oil content or some, for realizing manually operated pollination system, provide new three series mating system.

Accompanying drawing explanation:

Fig. 1 is the clone's of the efficient expressing gene of a kind of rape flower electrophorogram.

The nucleic acid Marker that swimming lane 1 is DL2000; Swimming lane 2 is for take the gene fragment result of the pcr amplification that genomic dna is template.

Fig. 2 is the expression pattern analysis chart of the efficient expressing gene of a kind of rape flower.

A figure: the expression amount in rape different tissues.Show that this gene spending middle high efficient expression.B figure: the sterile strain of rape J03 (A) and the expression amount of fertile plant (B) in three etap.AS/BS: (abortion in earlier stage for Meiosis, bud length L EssT.LTssT.LT1mm), AM/BM: tetrad is to monokaryotic stage (abortion mid-term, bud length 1-3mm), AL/BL: three core phases (abortion later stage, bud length >3mm).Show that this gene, at high efficient expression in fertile plant bud abortion mid-term, expresses and be suppressed in sterile strain bud.C figure: the expression amount in rape bud Pistil And Stamen.AP: sterile gynoecium, AS: parastamen, BP: can educate gynoecium, BS: Fertile stamen.Show this gene high efficient expression in the flower pesticide of fertile plant, and do not express in sterile plant.

Fig. 3 is a kind of structure Arabidopis thaliana interference carrier neck ring structure principle schematic.

Fig. 4 is a kind of transfer-gen plant PCR evaluation figure that transforms RNAi carrier pamiRNAi-AtRabGDI3.

The nucleic acid Marker that swimming lane 1 is DL2000; Swimming lane 2 is pamiRNAi-AtRabGDI3 positive plasmid; Swimming lane 3 is wild-type Arabidopis thaliana; Swimming lane 4-14 is transgenic positive plant.

Fig. 5 is a kind of phenotypic map of pamiRNAi-AtRabGDI3 transgenic arabidopsis.

A is wild-type and transgenic arabidopsis plant; B is the flower of wild-type and transgenic arabidopsis; C is the angle fruit of wild-type and transgenic arabidopsis; D is the sporule (Alexandria dyeing) of wild-type and transgenic arabidopsis; Wherein, N: normal sporule (orange); A: abortion sporule (green).

Fig. 6 is a kind of design of graphics of BnRabGDI3 gene overexpression carrier.

Fig. 7 is a kind of OX-BnRabGDI3 transfer-gen plant PCR evaluation figure.

Swimming lane M is the nucleic acid Marker of DL2000; Swimming lane 1 is OX-BnRabGDI3 positive plasmid; Swimming lane 19 is wild-type Arabidopis thaliana; Swimming lane 2-18 is transgenic positive plant.

Fig. 8 is the phenotypic map of a kind of MI and OX plant filial generation.

A figure is the Alexandria colored graph of transgenic arabidopsis offspring sporule; B is angle fruit picture

Fig. 9 is RabGDI3 gene expression dose figure in a kind of transgenic progeny bud

A figure: pamiRNAi-AtRabGDI3 transforms RabGDI3 gene expression dose in interference of transgene MI offspring.

B figure: OX-BnRabGDI3 transformed RabGDI3 gene expression dose in expression OX offspring.

C figure: RabGDI3 gene expression dose in MI and OX filial generation.

According to following examples, can better understand the present invention, but described embodiment is in order better to explain the present invention rather than limitation of the present invention.

Embodiment

Embodiment 1.:

The clone of the efficient expressing gene BnRabGDI3 of a kind of rape flower and expression pattern analysis:

1, the clone of the efficient expressing gene BnRabGDI3 of a kind of rape flower:

The primer sequence of 1.1 rape BnRabGDI3 genes:

According to this laboratory, carry out swede type rape (Brassica napus) gene order-checking resource, by ORF Find er and BLAST software, to all, surveying resource sequence analysis, determining BnRabGDI3 sequence.So by after compare of analysis, the homology zone design primer that comprises ORF in known rape sequence, thus guarantee that amplified production is full length sequence.Primer is: BnRabGDI3S:5 '-GTAAGATAGGAGGTGGTGG-3 ' and BnRabGDI3A:5 '-CGTAAAACCACTCAGCCAA-3 '.

The preparation of 1.2 rape BnRabGDI3 genes:

The present invention's rape used is two No. nine (already described above) in swede type rape (Brassica napus L.).In two be seeded in land for growing field crops No. nine, normal field management.Utilize SDS cracking process (already described) to extract genomic dna above.As masterplate, carry out pcr amplification.Step is: extract genomic dna 25 μ l, as template, increase, reaction system is 50 μ l, adds respectively 10 * Ex Taq buffer5 μ l, dNTP4 μ l, 5 ' primer 1 μ l, 3 ' primer 1 μ l, ExTaq0.5 μ l, the about 100ng of DNA masterplate 1 μ l, ddH ₂o37.5 μ l.The BnRabGDI3 gene order design PCR the primer obtaining according to rape genome sequencing is BnRabGDI3S and BnRabGDI3A (already described above).Amplified production size is 2064bp(Fig. 1), PCR response procedures be 94 ℃ 5 minutes, 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 2 minutes, 33 circulations, 72 ℃ 10 minutes, 16 ℃ 3 hours.PCR reaction product is electrophoresis on (already described above) low melting-point agarose of 1%, with gel, reclaiming test kit (already described) purifying above reclaims, concrete steps are as follows: amplified production band is cut from glue, put into 1.5ml Eppendoff centrifuge tube, 65 ℃ of water-bath 15min, add equal-volume phenol (PH7.9), put upside down and shake up 5min, 13000 revs/min centrifugal 8 minutes, get supernatant, add equal-volume chloroform: primary isoamyl alcohol (volume ratio 24:1) solution is put upside down and shaken up 5min, 13000 revs/min centrifugal 8 minutes, get supernatant, 3 mol/L sodium-acetate (PH5.2) solution that add 1/10 volume, the 95%(mass volume ratio of 2 times of volume precoolings, identical below) ethanol, mix in ℃ refrigerator of postposition-20 more than 20min, 13000 revs/min centrifugal 15 minutes, outwell before 95%(already described) use again 75%(mass volume ratio after ethanol, identical below) ethanol embathes precipitation, natural air drying, DNA precipitation is dissolved in 20 μ l aseptic deionized waters.The PCR purified product obtaining, press before pMD18-T(already described) carrier specification sheets, be connected on pMD18-T carrier, heat shock method (already described above) transforms the competent cell (already described) of gold bacterial strain above, coat contain before penbritin 50 μ g/mL(already described) LB solid medium (already described above) flat board on, 37 ℃ of overnight incubation, select 6 of hickies.Adopt M13 primer (already described) to be bacterium colony PCR above and detect (already described) above.The correct bacterial plaque of PCR detected magnitude is inoculated into the liquid LB substratum (already described) containing penbritin 50 μ g/mL above, at 37 ℃, 200r/min shaking culture is spent the night, alkaline process (already described above) extracts plasmid in a small amount, already described before 1.0%() agarose gel electrophoresis detection plasmid DNA size correct rear (being 2064bp), adopt Kpn I/Xba I enzyme (already described) to cut above plasmid is carried out to double digestion, the enzyme system of cutting is 10 μ l, comprise plasmid DNA 5 μ l, Kpn I 0.5 μ l, Xba I0.5 μ l, ddH ₂o4 μ l, 37 ℃ are spent the night, already described before 1.0%() agarose gel electrophoresis detects.The correct positive recombinant clone called after pMD18-BnRabGDI3(of detection is connected into pMD18-T vector construction by goal gene sequence B nRabGDI3 to be formed, identical below), sequence information in order to ensure gene in carrier, pMD18-BnRabGDI3 is served to Hai Yingjun company to check order, analytical results shows, obtained a kind of rape BnRabGDI3 full length gene of separation, its sequence is nucleotide sequence shown in SEQ ID NO:1.

By online software Genescan(http: //genes.mit.edu/GENSCAN.html) analyze CDS sequence and the aminoacid sequence that obtains this gene.Utilize the open reading frame of NCBI, finder (ORF founder) is determined the open reading frame of nucleotide sequence shown in SEQ ID No.1, derives the amino acid of protein sequence coding.The rape BnRabGDI3 polypeptide total length that has obtained a kind of separation, its sequence is aminoacid sequence shown in SEQ ID NO:2.With the Conserved Domains instrument (http://wwwncb.inlm.nih.gov/Structure/cdd/wrpsb.cgi) of NCBI, carry out online conservative region analytical results and show that this gene belongs to RabGDI family.The CDS sequence of gene and Arabidopis thaliana CDS sequence, by NCBI compare of analysis, are found to contain in this section of region complete ORF reading frame and initiator codon ATG.The molecular weight of protein and theoretical iso-electric point are carried out at line computation (http://us.expasyorg/tools/pi too1.htm).Basic structure territory with this protein of Prosite software on-line analysis.According to aforesaid method analytical results, show: predict 436 amino acid of protein sequence coding that the opening code-reading frame of this gene is derived.SignalP and Tmpred analytical results show: BnRabGDI3 is a non-membranin, and most amino acid belongs to hydrophilic amino acid.There is no signal peptide section, there is no obvious cross-film region.BLAST finds that BnRabGDI3 and AtRabGDI3CDS nucleotide homology are greater than 90%, utilizes DNA MAN and online software TCOFFEE(http: //www.tcoffee.org/) their amino acid identity reaches 97%.According to sequencing data library information, all homologous genes have been carried out to phylogenetic tree and homology tree and have analyzed, result show studied BnRabGDI3 and Arabidopis thaliana AtRabGDI3 sibship nearest.Therefore the gene of inferring amplification is really the RabGDI3 full length gene sequence of rape, is the homologous gene of AtRabGDI3, by its called after BnRabGDI3.

2, the expression pattern analysis of the efficient expressing gene BnRabGDI3 of a kind of rape flower:

The present invention's another kind of rape used (Brassica napus L.) is dominant genic male sterile heterozygosis sterile line J03AB(Msmsrfrf * msmsrfrf) (material is that oil crops functional genome of institute of the Chinese Academy of Agricultural Sciences and Molecular Biology Research Lab preserve, before already described).System, through backcrossing and hand over and be bred as (the two can be considered a pair of near isogenic line for sterile strain called after A, fertile plant called after B, only has sterile Site discrepancy) with sister for many years, is seeded in land for growing field crops for examination material, normal field management.

From the identical fertile plant of same grown in field condition, get root, stem, leaf, bud, angle fruit, get respectively flowering period can educate with sterile plant on get different times bud, and from bud anatomical isolation gynoecium and stamen, every kind of material is at least got three repetitions, each repeats at least one strain, after sampling, with masking foil parcel, be positioned over rapidly in liquid nitrogen-80 ℃ of preservations.According to Trirol, extract the requirement of test kit (already described) above and carry out the extraction of RNA, concrete grammar is as follows: get respectively the sample of 0.05-0.1g, be ground to powdery in liquid nitrogen, extract the requirement of test kit carry out the extraction of RNA according to Trirol.The total RNA extracting is dissolved in the distilled water without RNase of 60uL.DNase I is removed DNA that may be residual.With Protein Detection instrument (DU650BECKMAN, USA), detecting respectively the absorbance value of RNA under 260 nanometers and 280 nanometers, in conjunction with 1%(mass volume ratio) agarose gel electrophoresis identifies purity and the concentration of RNA.The RNA of above-mentioned acquisition of take carries out reverse transcription by following scheme as template: in 2 μ gRNA, add 1 μ L Oligo(dT), 70 ℃ of incubation 5min, be placed in immediately 5min on ice, of short duration centrifugal, add 5 * M-MLV Buffer4 μ L, dNTP(10mmol/L) 1 μ L, RNase Inhibitor20 unit, M-MLV reversed transcriptive enzyme (purchased from Promega company) 200 units, the sterilized water of processing with DEPC is mended to cumulative volume 20 μ L, mixes 42 ℃ of incubation 1h, 70 ℃ of water-bath 15min, save backup in-20 ℃ after the cDNA packing obtaining.

Quantitative real time PCR Instrument is RT ^tM-Cycler(is rich difficult to understand), adopt rape Actin(accession number AF111812) as internal standard gene, Actin gene primer is forward primer 5 '-CTGGAATTGCTGACCGTATGAG-3 ' and reverse primer 5 '-ATCTGTTGGAAAGTGCTGAGGG-3 '.According to the BnRabGDI3 gene forward primer of the conservative section design of Arabidopis thaliana and rape RabGDI3 gene C DS sequence, be 5 '-CCCCGACTACTATGGAGGAGAA-3 '; Reverse primer is 5 '-AGCGTGTGGATTAGGGTTTGA-3 '.

Quantitative fluorescent PCR reaction system is 20 μ L: contain SYBR Mix10 μ L, and each 0.8 μ L of forward and reverse primer (10 μ mol/L), template 2 μ L, the sterilized water that DEPC processed complements to 20 μ L.Amplification condition is: 94 ℃, and 5min:94 ℃, 15s, 60 ℃, 20s, 72 ℃, 30s, 40 circulations; Each is circulated in 72 ℃ of renaturation ends and carries out fluoroscopic examination.Reaction finishes to be first heated to 95 ℃ afterwards, is then down to 72 ℃, is more slowly warming up to 95 ℃, records the variation of fluorescent signal, draws the melting curve of amplified production.Every group of experiment all completes three biology and repeats, and each biology repeats at least to do three technology and repeats.Detect respectively the expression of BnRabGDI3 in Oil Rape Tissue (root, stem, leaf, flower, angle fruit, large, medium and small bud, gynoecium, stamen).

With the relative expression quantity that compares Ct method (Δ Δ Ct) calculating gene.By 2 ^{-Δ Δ Ct}relative expression quantity and the systematic error (already described above) of estimation goal gene.When calculating relative expression quantity, the sample of root of take is reference, is about to its value and converts 1(standard value to), other sample again with its relatively, obtain relative expression's value.

Result shows (Fig. 2): take root as having a small amount of expression with reference to being made as 1, RabGDI3 in leaf and angle fruit, in root and stem, substantially do not express, spending middle a large amount expression, be approximately 800 times of left and right of other tissue, be one and spending the gene of middle high efficient expression, as shown in Figure 2 A.The sterile strain J03A small bud (<1mm) of take is reference, and the expression of gene RabGDI3 in sterile strain is subject to obvious inhibition, at later stage expression amount, slightly rises.In fertile plant growth course, this gene expression amount rises gradually, the highest at development later stage expression amount, is gradually the trend rising, and is with reference to more than 4 times, as shown in Figure 2 B of expression level in 80 times of sample and sterile strain bud.The gynoecium (AP) of sterile strain J03A of take is reference, and RabGDI3 gene is very obvious in sterile strain and fertile plant stamen differential expression, and the expression amount in fertile plant stamen is the highest, is more than 4000 times in sterile strain.As shown in Figure 8.The result shows that RabGDI3 is the gene of a high efficient expression in pollen.

Embodiment 2:

The functional analysis of RabGDI3 gene

1, the structure of RabGDI3 gene RNAi plant expression vector:

The pCAMBIA1301 (purchased from Jing Cheng bio tech ltd, Wuhan) of take is basic plasmid, build to obtain RabGDI3 gene RNAi plant expression vector: pamiRNAi-AtRabGDI3(Fig. 3), the carrier freeze-thaw method building is proceeded to before Agrobacterium EHA105(already described).

2, the transformation of Arabidopsis thaliana of artificial microRNA interference carrier pamiRNAi-AtRabGDI3 and the evaluation of positive plant:

According to the method for already described document above by BnRabGDI3 gene RNAi plant expression vector pamiRNAi-AtRabGDI3 arabidopsis thaliana transformation and gather in the crops seed.Arabidopis thaliana planting seed is on the composite soil of vermiculite and Nutrition Soil 1:1, and 4 ℃ of vernalization 2-5 days, transfer to temperature 20-25 ℃, intensity of illumination 5000-10000 lumen, photoperiod is 16 hours illumination/8 hour dark, during atmospheric moisture is greater than between more than 80% cultivation, and normal management.Arabidopis thaliana grows after a slice true leaf, sprays before the weedicide Basta(of 30ppm already described).After one week, spray the Basta of 50ppm, obtain the positive seedling of 11 strains.Plant to be planted grows after inflorescence, gets a slice true leaf, extracts before DNA(method already described), do PCR positive identification.Concrete grammar is as follows: primer sequence is BarF:5 '-CATGGAGTCAAAGATTCAAATAGAGG-3 ' and BarR:5 '-CCCGATCTAGTAACATAGATGACACCG-3 '; The cumulative volume of PCR reaction system is 20 μ l, genomic dna template 1ul (about 50ng), 1 * Taq enzyme reaction buffer solution, 25mM MgCL ₂1.2ul, 2mM dNTP1.5ul, each 0.2ul of 10uM primer, 50% glycerine 2ul, 0.3u Taq enzyme (Takara company), add sterilized water to 20 μ l.Response procedures is: 94 ℃ of sex change 3min, and 94 ℃ of 50s, 55 ℃ of 60s, 72 ℃ of 90s35 circulations, 72 ℃ are extended 5min.With 1% agarose gel electrophoresis, detect, result shows that in the positive seedling of (Fig. 4) all survivals, RabGDI3 gene RNAi plant expression vector pamiRNAi-AtRabGDI3 has successfully proceeded to Arabidopis thaliana.(plant that contains testing goal fragment claims positive plant, Fig. 4), distinguishes called after MI-1, MI-4 etc. to have obtained altogether 11 strain transgenic positive plant.

3, artificial microRNA interference carrier pamiRNAi-AtRabGDI3 transgenic arabidopsis phenotypic evaluation:

The solid situation of transgenic arabidopsis detects by an unaided eye.Growth with Alexandria staining check flower pesticide.Alexandria staining concrete grammar is as follows: prepare slide glass, tweezers, staining fluid, pencil, pipettor and rifle head, gloves, spirit lamp, filter paper etc.For each strain transgenic arabidopsis, get the Arabidopis thaliana bud just having showed money or valuables one carries unintentionally, with needle point by the strip off gently of petal, sepal, avoid hurting flower pesticide, carry out Alexandria dyeing, process is as follows: flower pesticide is put into 1.5ml centrifuge tube, add Alexandria dye liquor (already described) above, flower pesticide is soaked in 50 ℃ of dyeing 24h in staining fluid; Take out sample, with filter paper, blot the moisture on sample, micro-Microscopic observation.With pressed disc method Observation of Microspore under microscope (OLYMPUS IX71).By observing and add up the abortive degree of the ratio judgement sporule of normal sporule (dying orange) and abortion sporule (dying green).Productive phase the detect by an unaided eye solid situation of transgenic arabidopsis.Result is as Fig. 5 and table 2.Dyeing observations shows: the flower pesticide of wild-type Arabidopis thaliana is full and be full of sporule, and sporule is all dyed orange, illustrates that microspore development is normal.And the medium and small spore number of the flower pesticide of transgenic arabidopsis is all far less than wild-type, there is a small amount of normal sporule number, other is empty flat or is dyed to the sporule (Fig. 5) of green abortion.Compare with wild-type Arabidopis thaliana, transgenic arabidopsis all occurs that setting percentage is low, flower pesticide smaller volume, the phenotype that pollen obviously reduces, the abortion level of pollen obviously raises.Through all transgenic progeny plant are observed to statistics, result shows that typical male sterile phenotype has appearred in AtRabGDI3 interference of transgene plant.The silence that RabGDI3 gene in Arabidopis thaliana is described can cause the abortion of plant.AtRabGDI3 gene has the function of controlling pollen fertility and plant ability.

The solid cartogram of table 2amiRNAi transformed plant

Embodiment 3:

The complementary function checking of BnRabGDI3 gene:

In order further to confirm that rape BnRabGDI3 gene and Arabidopis thaliana AtRabGDI3 gene have identical function, we build BnRabGDI3 gene overexpression plant expression vector, arabidopsis thaliana transformation.By the OX-BnRabGDI3 transgenic progeny obtaining, be male parent, the male sterile transgenic progeny that the artificial microRNA of take disturbs is hybridized as female parent, and whether the flower pesticide fertility that detects filial generation plant can be restored.

1, the conversion of the structure of BnRabGDI3 gene overexpression plant expression vector OX-BnRabGDI3 and agrobacterium tumefaciens bacterial strain EHA105:

The rape florescence, in field, collect rape bud, drop into liquid nitrogen flash freezer.According to Trirol, extract test kit (purchased from Invit rogen company, before already described) requirement extract in the RNA of two No. nine (already described above) buds, the RNA obtaining of take is template, according to the explanation of Promega company reversed transcriptive enzyme, carry out reverse transcription (already described) above, after the cDNA packing obtaining, in-80 ℃, save backup.The bud cDNA that obtains of take carries out the pcr amplification of BnRabGDI3 gene CDNA fragment as template.According to swede type rape BnPABP5 gene order (SEQ ID NO:1) design primer, RabGDI3F:5 '-GACGAGCTC TCACTCCGTTGAGGAGGG and RabGDI3R:5 '-GACATCTAGAATGGTTGATCAAGTCATCCC.5 ' end of primer sequence has been introduced respectively XbalI and SacI restriction endonuclease sites.PCR reaction system is that 25 μ L include: 1 * PCR buffer, MgCI1.5mmol/L, every liter of dNTP0.2mmol/L(mmole), primer concentration is 0.5mol/L ，PfuMei 1.5 units, the about 100ng of template.PCR response procedures is as follows: 94 ℃ of 5min; 94 ℃ of 30sec, 55 ℃ of 45sec, 72 ℃ of 1min, 35 circulations; 72 ° of C extend 8min.PCR product is through 1.0%(mass volume ratio) agarose gel electrophoresis detection (already described above).After completing, with gel, reclaim test kit and reclaim purifying object fragment (already described) above, obtain BnRabGDI3 gene CDNA full length sequence.

By already described method above, the BnRabGDI3 gene CDNA full length sequence obtaining is replaced to the gus gene sequence in pBI121 plant expression vector, obtain the plant over-express vector of BnRabGDI3 gene.Called after OX-BnRabGDI3.Then utilize freeze-thaw method (already described) that OX-BnRabGDI3 is proceeded to before agrobacterium tumefaciens EHA105(already described above), kantlex (50 μ g/mL) and the dual anti-property plate screening of Rifampin (50 μ g/L), choose spot, carry out bacterium colony PCR detection validation (already described) above.

2, the transformation of Arabidopsis thaliana of OX-BnRabGDI3 and screening:

According to the method for already described document above by BnRabGDI3 gene overexpression plant expression vector OX-BnRabGDI3 arabidopsis thaliana transformation and gather in the crops seed.By the T0 that transforms results for seed 70%(volume ratio) alcohol and 0.01%(volume ratio) and mercuric chloride surface sterilization after 10 minutes with distilled water wash (5～7 times) for several times, then MS solid screening culture medium (already described) surface is arrived in piping and druming above equably.4 ℃ of vernalization 4-6 days, put into constant incubator and cultivate.According to peculiar kalamycin resistance on expression vector, screen positive seedling.When blade grows to enough size (3-4 leaf phase), get a little green seedling leaf and carry out PCR positive detection.Primer is already described before NPT II F and NPT II R(), reaction system is that 10 μ l include: template DNA template 1 μ L (about 100ng), 10 * Taq buffer(is containing MgCl ₂) 1 μ l, 1.5mmol/L dNTP (10mmol/L) 1 μ l, 5 ' primer (10 μ mol/L), 0.5 μ l, 3 ' primer (10 μ mol/L), 0.5 μ l, Taq (5U/ μ l) 0.5 μ l, ddH ₂o5.5 μ l.Reaction conditions be 94 ℃ 5 minutes, 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 1 minute, 32 circulations, 72 ℃ 10 minutes, amplification size be 800bp.Result shows that (Fig. 7) obtained 17 transgenic positive plant (plant that contains testing goal fragment claims positive plant).The detect by an unaided eye solid situation of transgenic arabidopsis, finds that these 17 transfer-gen plants all can be normally solid, is fertile plant.By more than 3 generations of positive plant selfing, obtain 8 T3 that isozygoty for strain.Difference called after OX-1, OX-7 etc. (following identical).

3, the hybridization that AtRabGDI3RNAI interference of transgene male sterile MI Arabidopis thaliana and BnRabGDI3 cross express transgenic OX plant:

The Arabidopis thaliana male sterile transfer-gen plant that artificial microRNA obtains after disturbing plant expression vector pamiRNAi-AtRabGDI3 to transform through the weedicide Basta(in seedling stage purchased from Bayer AG, before already described) (already described above) normal management after screening.Sow after the same method wild-type Arabidopis thaliana the same period, spraying herbicide Basta, does not make its florescence synchronous.Arabidopis thaliana entered after the florescence, and every morning, 10 pollen of later getting wild-type plant were pollinated to transgenosis sterile plant.After seed maturity, results seed.Planting seed, in vermiculite, is coverd with plastic cloth, and 4 ℃ of vernalization 4-5 days, transfer in growth case and sprout.After sprouting, according to method described in previous technique scheme 3.2, in seedling stage, carry out herbicide screening, obtain AtRabGDI3 transgenosis male sterile MI plant.

The same period, by OX-BnRabGDI3 transform by kantlex screening (already described above) and PCR verify (already described above) be positive T3 for transfer-gen plant seed at MS substratum (already described above) upper seeding wheel.Method is as follows: by T3 for 70% alcohol for seed (already described above) after surface sterilization 2-3 minute, mercuric chloride with 0.01% (already described above) surface sterilization 10 minutes, then with distilled water wash several (already described above), then MS solid screening culture medium (containing kantlex 50 μ g/ml) surface (already described) is arrived in piping and druming above equably.4 ℃ of vernalization 4-6 days, put into constant incubator and cultivate.After growing 2-3 sheet true leaf, be transplanted in vermiculite, obtain BnRabGDI3 and cross express transgenic OX plant.

After male sterile MI plant and OX plant blossom, every morning, 10 pollen of getting respectively OX-7 and OX-11 plant were later pollinated to the different individual plants of MI-1 plant.After seed maturity, gather in the crops cenospecies.

4, the screening of filial generation and Phenotypic Observation:

The cenospecies of results is seeded at MS(kantlex 50 μ g/ml) on substratum (already described above), grow after 2-3 sheet true leaf, by the plantlet of transplant of survival in vermiculite, normal management (already described above) between growth.After seedling recovers stalwartness, spray before the weedicide Basta(of 30ppm already described).After one week, again spray the Basta of 50ppm, the plant of final survival is the hybridization transgenic progeny that simultaneously contains pamiRNAi-AtRabGDI3 and OX-BnRabGDI3 object fragment.By its called after MI * OX plant.

MI * OX plant entered after flowering period, and white but unopened flower has been leaked on the branch top of choosing each plant, pushes bud aside.At magnifying glass (3 times) and lower flower pesticide and the pollen observed of stereoscopic microscope (OLYMPUS SZ61TRC).With dissecting needle, isolate flower pesticide, with Alexandria staining Observation of Microspore (already described) under microscope (OLYMPUS IX71) above.By observing and add up the abortive degree of the ratio judgement sporule of normal sporule (dying orange) and abortion sporule (dying green).Productive phase the detect by an unaided eye solid situation of transgenic arabidopsis.

Result shows (Fig. 8), in MI1 * OX11 filial generation flower pesticide, has been full of pollen granule, and wherein major part presents orange, approximately has the pollen granule of 40-50% to dye green.After entering productive phase, the angle fruit of filial generation MI1 * OX11 plant can reach maturity, seed development in the fruit of angle is normal, but quantity is also shorter than wild-type than wild-type angle fruit the youthful and the elderly degree, there is typical half sterile phenotype (Fig. 8), illustrate that the pollen fertility of filial generation MI1 * OX11 obtains part recovery.And in MI1 * OX7 filial generation flower pesticide, be full of pollen granule, wherein major part presents orange, there is no to observe the pollen granule of dying green white abortion.After entering productive phase, the angle fruit of filial generation MI1 * OX7 plant can reach maturity, seed development in the fruit of angle is normal, angle fruit quantity is similar to wild-type with Pod length, have and typically can educate phenotype (Fig. 8), the flower pesticide that filial generation MI1 * OX7 plant is described can produce a large amount of fertile pollens, and the pollen fertility of filial generation is recovered completely.

MI male sterile plants through with OX plant hybridization pollination after, the pollen fertility of filial generation MI * OX plant of acquisition has obtained recovery in various degree.This result has fully confirmed the male sterile phenotype that cross expressing of rape BnRabGDI3 gene can be complementary causes due to Arabidopis thaliana AtRabGDI3 gene silencing.The BnRabGDI3 gene function with control pollen fertility the same as Arabidopis thaliana AtRabGDI3 gene.

5, the expression level analysis of RabGDI3 gene in transgenic arabidopsis offspring:

By MI plant, rear (already described) sowed respectively and screened to OX plant and MI * OX plant above.The bud of winning respectively survival plant at the florescence, quick-frozen, in liquid nitrogen, is analyzed the expression level of target gene RabGDI3 with FQ-PCR (method is with reference to technical scheme 2).In the AtRabGDI3RNAI interference of transgene male sterile MI transgenic line of all detections, the expression amount of target gene RabGDI3 is all starkly lower than wild-type Arabidopis thaliana, and BnRabGDI3 crosses the expression amount of target gene RabGDI3 in express transgenic OX plant, is all significantly higher than wild-type Arabidopis thaliana.The fertility of offspring's flower pesticide be also restored (Fig. 8,9) when the expression amount of RabGDI3 recovers in the filial generation MI * OX plant of the two.

Result is as shown in Figure 9 A: in eight AtRabGDI3 interference of transgene MI strains that detect, the expression amount of target gene RabGDI3 is all starkly lower than wild-type Arabidopis thaliana, less than 50% of wild-type plant expression amount.MI-1 wherein, in MI-4 and MI-7 strain, the expression level of RabGDI3 is minimum, and lower than 10% of wild-type, the average suppression efficiency of all transgenic lines reaches 40%-90%.This result shows that the interference effect of microRNA is obvious, and the expression of target gene is significantly lowered.8 BnRabGDI3 that simultaneously detect cross the expression amount of target gene RabGDI3 in express transgenic OX strain, and result shows that the expression amount of RabGDI3 in all OX strains is all significantly higher than wild-type Arabidopis thaliana, on average increases more than 10 times.OX-1 wherein, in tri-strains of OX-7 and OX-14, the expression amount of target gene has raised 40 times above (Fig. 9 B).This result shows the successful of the BnRabGDI3 over-express vector that we build, and the expression of target gene is significantly raised.

Use respectively the gynoecium after fertilization of the pollen of OX-7 and OX-11 to MI-1 male sterile plants, gather in the crops two kinds of filial generation seed: MI1 * OX7 and MI1 * OX11.Expression amount to RabGDI3 in these two kinds hybridization filial generation MI * OX plant buds also detects, send out the OX-7 of 40 times of active list level raisings as male parent and MI-1 after fertilization, in the offspring MI1 * OX7 plant obtaining, the expression amount of RabGDI3 returns to 2.5 times of wild-type, and the fertility of flower pesticide is recovered completely.With sending out active list level, improve the OX-1 of 10 times as male parent and MI-1 after fertilization, in offspring MI1 * OX1 plant of acquisition, the expression amount of RabGDI3 returns to 0.5 times of wild-type, and the fertility of flower pesticide obtains recovery (Fig. 9 C) partly.This result shows that this result has fully confirmed expression has recovered AtRabGDI3 interference plant flower pesticide in the recovering AtRabGDI3 interference plant fertility in RabGDI3 gene expression dose of crossing of rape BnRabGDI3 gene.

SEQUENCE LISTING

<110> Inst. of Oil Crops, Chinese Academy of Agriculture

<120> rape BnRabGDI3 gene and application thereof

<130> rape BnRabGDI3 gene and application thereof

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 2551

<212> DNA

<213> rape

<400> 1

atggatgaag agtatgatgt gattgttctt ggtactggtc tcaaggagtg tattcttagt 60

ggtctcctct ctgtcgatgg cctcaaggtt ctctttcaat tcaattccaa atgcatgatt 120

atttttgtgc atgatcacat gcatgtatac tatagcttta tttttacgtt tagttctggt 180

ttttgtttta gttatgaatc ttatgtcaga tcaatagttg aattgccgcc tttggcagtg 240

aagtatagtg ctccaataat agccttttga cctttgaacg agattttgtt tcgtagacca 300

tgaatgatat tataagatga ttagtgtgaa gtgtgttatt ttagaaacac atacataaat 360

acatttatct ttcaaatatg taatcatcta tataggtact gcatatggat agaaacgact 420

actatggagg agaatcaagc tctcttaacc tcactcagct atggaagcgt ttcaggggaa 480

gtgacactcc tgaagaaaat cttggagcaa ttagagaata caatgtcgat atgatcccaa 540

aggtatgtac atatctatta gtgaatattc acatatatgt aatgtgaatc gataaataag 600

gagataatgg tttcttgatc tgcagtttat aatggctaat ggactccttg ttcaaaccct 660

aatccacact gatgtcacca agtatcttaa cttcaaagcc gttgatggca gcttcgtcta 720

caataagggc aaggtagtga ttaagtctat tttttttacc ttaaatataa gtaactacta 780

gctagagatt ttgatcatcc gtaccattca aacgtcagat ctataaagtc ccagccactg 840

atgtggaagc cctaaagtcg ccattgatgg gactattcga gaaacgacgt gcgagaaagt 900

tcttcatcta tgtgcaagac tacgatgaga aggatcctaa gtctcacgaa ggacttgacc 960

ttagcaaagt cactgctaga gagatcatct cgtacgtcca actcaaaatc atttcatcat 1020

ttgtttcttg cgttacaagc tttgtctctc tgttttctct tttcccaata ggaagtacgg 1080

acttgaagat gatacaatcg acttcatcgg tcatgcctta gcgcttcaca atgacgatga 1140

ctacttggat caaccagcca ttgattttgt taagagaatc aaggtaaagt gttttatttt 1200

cttcttgaat atggaaatgt tctgatctca atgtgcattt tattgtttgt tatgtggtaa 1260

agctctacgc agagtccttg gctcgattca aggagggtct ccttacatct acccactgta 1320

tggtctagga gagttgccac aggtccgtgt tcaccttatt ctcatgaaac atgttaggtt 1380

tcatcttaat ttaagaccat tttctatgtt aaaatctctg tttatattct caggctttcg 1440

cgcgtttgag cgctgtgtat ggagggactt acatgctgaa caagcctgaa tgcaaggtta 1500

cacaccatcc ataattaatc tcttctttct cggttttgtt tattagaaat ctcatatcca 1560

taaatgtata agatagctcg aaactcatga atatctttaa cattatccct aacaggttga 1620

gtttgatggc tccggaaaag ctatcggtgt cacttctgca ggagaaactg ctaaatgcaa 1680

gaaagttgtc tgtgatcctt cttacttgtc tgacaaggta actctaaacc catttcacct 1740

ataaaggttg gttcaccact tgattctcgc aaaggcctag taacgttcta ataagacggt 1800

ttccttgtgt ttcaggttaa gaaagttggg aaagtggctc gagcggtgtg tataatgagc 1860

catcctattc cagacaccaa cgacgctcac tcggtccaaa tcattcttcc acaagaagca 1920

gctcggacgc aaatcagaca tgtaagagat tataatcaaa gaacacatat ttaaatgtag 1980

agacataatc attctttttt tttgtaggta cttgttctgt tgctcatacg ctcacaacgt 2040

agcaccaaag ggcaaataca ttgcttttgt ctctgcagaa gctgagactg acaatccaga 2100

agaagagctt aaacctggaa tcgaattgct tggacctatt gatgagatct tttaccattc 2160

ttatgacaca tacgttccga ccaataagca agaagaagac aactgcttca tctcaggtgt 2220

aagtgaatat catagtcata tagtctcaat aatttttttt tgtttattac atgtctttgc 2280

ttttttttgt tgatgttact ttgtttttat tttcttatca gacttatgat gcaacaacac 2340

atttcgagag tacagtggtg gatgtactag agatgtacac caagatcact ggaaaggtat 2400

aaaactaaaa actcatcatc actctttttt tcttggttca caagtaaaca taaaaacatt 2460

tttgagtact gagtttatct tcactgttat tttgcagact cttgatttgt ctgtggactt 2520

gagtgctgcg agtgctactg cagaaaaatg a 2551

<210> 1

<211> 436

<212> PRT

<213> rape

<400> 1

Met Asp Glu Glu Tyr Asp Val Ile Val Leu Gly Thr Gly Leu Lys Glu

1 5 10 15

Cys Ile Leu Ser Gly Leu Leu Ser Val Asp Gly Leu Lys Val Leu His

20 25 30

Met Asp Arg Asn Asp Tyr Tyr Gly Gly Glu Ser Ser Ser Leu Asn Leu

35 40 45

Thr Gln Leu Trp Lys Arg Phe Arg Gly Ser Asp Thr Pro Glu Glu Asn

50 55 60

Leu Gly Ala Ile Arg Glu Tyr Asn Val Asp Met Ile Pro Lys Phe Ile

65 70 75 80

Met Ala Asn Gly Leu Leu Val Gln Thr Leu Ile His Thr Asp Val Thr

85 90 95

Lys Tyr Leu Asn Phe Lys Ala Val Asp Gly Ser Phe Val Tyr Asn Lys

100 105 110

Gly Lys Ile Tyr Lys Val Pro Ala Thr Asp Val Glu Ala Leu Lys Ser

115 120 125

Pro Leu Met Gly Leu Phe Glu Lys Arg Arg Ala Arg Lys Phe Phe Ile

130 135 140

Tyr Val Gln Asp Tyr Asp Glu Lys Asp Pro Lys Ser His Glu Gly Leu

145 150 155 160

Asp Leu Ser Lys Val Thr Ala Arg Glu Ile Ile Ser Lys Tyr Gly Leu

165 170 175

Glu Asp Asp Thr Ile Asp Phe Ile Gly His Ala Leu Ala Leu His Asn

180 185 190

Asp Asp Asp Tyr Leu Asp Gln Pro Ala Ile Asp Phe Val Lys Arg Ile

195 200 205

Lys Leu Tyr Ala Glu Ser Leu Ala Arg Phe Gln Gly Gly Ser Pro Tyr

210 215 220

Ile Tyr Pro Leu Tyr Gly Leu Gly Glu Leu Pro Gln Ala Phe Ala Arg

225 230 235 240

Leu Ser Ala Val Tyr Gly Gly Thr Tyr Met Leu Asn Lys Pro Glu Cys

245 250 255

Lys Val Glu Phe Asp Gly Ser Gly Lys Ala Ile Gly Val Thr Ser Ala

260 265 270

Gly Glu Thr Ala Lys Cys Lys Lys Val Val Cys Asp Pro Ser Tyr Leu

275 280 285

Ser Asp Lys Val Lys Lys Val Gly Lys Val Ala Arg Ala Thr Pro Thr

290 295 300

Thr Leu Thr Arg Ser Lys Ser Phe Phe His Lys Lys Gln Leu Gly Arg

305 310 315 320

Lys Ser Asp Met Tyr Leu Phe Cys Cys Ser Tyr Ala His Asn Val Ala

325 330 335

Pro Lys Gly Lys Tyr Ile Ala Phe Val Ser Ala Glu Ala Glu Thr Asp

340 345 350

Asn Pro Glu Glu Glu Leu Lys Pro Gly Ile Glu Leu Leu Gly Pro Ile

355 360 365

Asp Glu Ile Phe Tyr His Ser Tyr Asp Thr Tyr Val Pro Thr Asn Lys

370 375 380

Gln Glu Glu Asp Asn Cys Phe Ile Ser Gly Thr Tyr Asp Ala Thr Thr

385 390 395 400

His Phe Glu Ser Thr Val Val Asp Val Leu Glu Met Tyr Thr Lys Ile

405 410 415

Thr Gly Lys Thr Leu Asp Leu Ser Val Asp Leu Ser Ala Ala Ser Ala

420 425 430

Thr Ala Glu Lys

435

Claims (6)

1. a separated gene, its sequence is the nucleotide sequence shown in SEQ ID No.1.

2. an isolated polypeptide, its sequence is the aminoacid sequence shown in SEQ ID No.2.

3. the application of the gene of a kind of separation claimed in claim 1 in controlling Arabidopis thaliana pollen fertility.

4. the application of a kind of isolated polypeptide claimed in claim 2 in controlling Arabidopis thaliana pollen fertility.

5. the application of the gene of a kind of separation claimed in claim 1 in controlling Pollen Brassicae campestris fertility.

6. the application of a kind of isolated polypeptide claimed in claim 2 in controlling Pollen Brassicae campestris fertility.

Images