CN110616226A - Specific molecular marker of pear PbELF3b gene and application thereof - Google Patents

Abstract

The invention discloses a specific molecular marker of pear PbELF3b gene and application thereof, and the invention separates and clones PbELF3b allelic gene N type and D type and modified N-D type and D + D type from Chinese pear and Xinjiang pear respectively. The D type is deleted relative to the N type, and a D fragment with the size of 58bp is deleted. Deletion of this fragment resulted in a stronger delayed flowering activity of the PbELF3b gene. An InDel sequence specific marker primer designed according to the intron deletion fragment is SEQ ID NO:4 and SEQ ID NO:5, the molecular marker can be used for identifying the differentiation and development conditions of pear flower buds so as to improve the breeding efficiency, and different types of PbELF3b can be used for regulating and controlling the flowering time of other plant species by using a genetic engineering method.

Description

Specific molecular marker of pear PbELF3b gene and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a molecular marker for pear flower bud differentiation and development and application thereof. The molecular marker of the invention is derived from PbELF3b gene. The invention discloses an N type and a D type of PbELF3b allele separated and cloned from Chinese pear and Xinjiang pear respectively, and an N-D type and a D + D type after modification. The D type is deleted relative to the N type, and a D fragment with the size of 58bp is deleted. Deletion of this fragment resulted in a stronger delayed flowering activity of the PbELF3b gene.

Background

China is the origin center of the plants of the genus Pyri and is also one of the diversity centers of cultivated pears in the world. The pear trees are widely distributed in China, the cultivation area is large, and the yield is high. In recent years, superior cultivars represented by 'Cuiguan', 'Yulu-Xiang' and the like are successively cultivated on the basis of the conventional main cultivars. Cui Guang is cultivated by gardening research institute of agricultural academy of sciences in Zhejiang province, has wide adaptability and strong tree vigor, and is high in yield and early-maturing [1 ]. Yulu Xiang is bred by fruit tree research institute of Shanxi province academy of agricultural sciences with Xinjiang pear 'Kuerle fragrant pear' with good quality and good taste as female parent. 'Kuerle bergamot pear' native Sinkiang, also showed excellent in Shanxi, Henan, Hebei, Shandong, etc., brought considerable income to fruit growers [2 ]. However, the introduction and cultivation of 'Korla pear' and its hybrid generation 'Yulu Xiang' in south areas of Jiangsu, Zhejiang and the like have low fruiting rate, and are mainly poor in early flower bud differentiation and development.

Plants are very sensitive to the environment, and the distribution and phenology of plants changes with climatic changes. This growth and development change requires the integration of various environmental signals (e.g., light and temperature) into the endogenous gene expression program, during which the biological clock system plays a critical role [3 ]. Studies in various plants have shown that the biological clock system of plants is involved in the regulation of the flowering process [4 ]. It has been reported that the ELF3 mutant exhibits early flowering and is not sensitive to photoperiod, and the ELF3 gene is mainly expressed in the evening as an important biological clock gene [5 ]. In Arabidopsis thaliana, it has been reported that ELF3 can bind to proteins such as LUX, ELF4, GI, COP1, PhyB, PIF4, SVP and TOC1, and integrate external signals such as biological clock, photoperiod and temperature, and regulate the flowering process [6 ]. The ELF3 protein is relatively conserved in pear, apple, tomato, soybean, Arabidopsis, rice, corn and other species, but has no clear functional structural domain. The J gene associated with soybean flowering phase, the ELF3 gene in soybean, has been mapped by classical genetic means [7 ]. The resource analysis J gene of soybeans planted at different latitudes is selected to find that sequence polymorphism exists, and various experiments prove that soybeans can be distributed in a wider latitude range due to the polymorphism of the ELF3 gene. Similarly, the photoperiod as a latitude-related environmental factor also has an important influence on the flowering process of pear trees and even rosaceous trees. The method is based on sequence analysis and functional verification of ELF3 homologous genes of representative varieties of Chinese pears and Xinjiang pears, and finds a polymorphic site with the size of 58 bp. When the site is deleted, the pear PbELF3b gene has stronger flowering delaying activity in plants.

[1] Zhangjun, Liu Xiao Dong, Shidexi, Lu Shi Hua, China "emerald jade" and "Cuiguan" pear in Jining area introduction performance and benefit analysis, forestry science and technology communication, (2019) 105-plus 106.

[2] Wangke, Li Xiugou, Guozui, Zhengjie, Wanglong, Xuhuabo, Suyan, Yangjian, application of the superior local variety 'Kuerle fragrant pear' in breeding, Xueshou Xue, 35(2018)26-30.

[3]D.Ezer,J.H.Jung,H.Lan,S.Biswas,L.Gregoire,M.S.Box,V.Charoensawan,S.Cortijo,X.Lai,D.Stockle,C.Zubieta,K.E.Jaeger,P.A.Wigge,The evening complexcoordinates environmental and endogenous signals in Arabidopsis,Nat Plants,3(2017)17087.

[4]C.Bendix,C.M.Marshall,F.G.Harmon,Circadian Clock Genes Universally Control Key Agricultural Traits,Mol Plant,8(2015)1135-1152.

[5]M.T.Zagotta,K.A.Hicks,C.I.Jacobs,J.C.Young,R.P.Hangarter,D.R.Meeks-Wagner,The Arabidopsis ELF3gene regulates vegetativephotomorphogenesis and the photoperiodic induction of flowering,PlantJournal,10(1996)691-702.

[6]H.Huang,D.A.Nusinow,Into the Evening:Complex Interactions in the Arabidopsis Circadian Clock,Trends Genet,32(2016)674-686.

[7]S.Lu,X.Zhao,Y.Hu,S.Liu,H.Nan,X.Li,C.Fang,D.Cao,X.Shi,L.Kong,T.Su,F.Zhang,S.Li,Z.Wang,X.Yuan,E.R.Cober,J.L.Weller,B.Liu,X.Hou,Z.Tian,F.Kong,Natural variation at the soybean J locus improves adaptation to the tropicsand enhances yield,Nat Genet,49(2017)773-779.

Disclosure of Invention

The invention aims to identify the difference of different varieties of Xinjiang pear and Chinese pear on the PbELF3b gene sequence, to determine the functions of the Xinjiang pear and Chinese pear in the process of regulating plant flowering, and to develop a gene specific molecular marker for pear flower bud differentiation and development and application thereof.

In order to achieve the above object, the present invention provides the following technical solutions:

a functional gene PbELF3b (N type) with the character of delaying plant flowering, which is separated and cloned from Chinese pear, and the genome DNA sequence is shown in sequence table SEQ ID No. 1.

A functional gene PbELF3b (D type) with the character of delaying plant flowering, which is separated and cloned from Xinjiang pear, and the genome DNA sequence is shown in the sequence table SEQ ID No. 2.

The primer pair for amplifying the N-type and D-type full-length sequences of the pear PbELF3b allele also belongs to the protection scope of the patent of the invention, and the DNA sequences of the primer pair are shown as SEQ ID No.6 and SEQ ID No. 7.

An InDel molecular marker related to pear flower bud differentiation and development is disclosed, wherein the InDel molecular marker sequence is shown as SEQ ID No.3, and the existence or deletion of the InDel molecular marker sequence on a pear PbELF3b genome intron can influence the flowering character of a plant. The deletion of the InDel molecular marker sequence can lead the PbELF3b gene to have stronger delayed flowering activity.

The InDel molecular marker primer related to pear flower bud differentiation and development has a forward primer PbELF3b-InDel-F sequence of tcgttgtgttaactgttttctg and a reverse primer PbELF3b-InDel-R sequence of ccaaacaaatccccactatg.

The molecular marker or the primer of the molecular marker is applied to detecting the differentiation and development condition of pear flower buds or the auxiliary breeding of new pear varieties.

A PbELF3b (N-d type) gene modified by a pear PbELF3b (N type) functional gene has a nucleotide sequence shown in a sequence table SEQ ID No. 13.

A PbELF3b (D + D type) gene modified by using Xinjiang pear PbELF3b (D type) functional gene has a nucleotide sequence shown in a sequence table SEQ ID No. 14.

The primer pair for amplifying the full-length sequence of the modified PbELF3b gene also belongs to the protection scope of the patent of the invention, wherein, the primer pair for amplifying the N-d type PbELF3b gene in the modified Chinese pear is shown as SEQ ID NO. 9 and SEQ ID NO. 10; the primer pair for amplifying the D + D type PbELF3b gene in the modified Xinjiang pear is shown as SEQ ID NO. 11 and SEQ ID NO. 12.

The recombinant vector containing the gene and the engineering bacteria of the vector also belong to the protection scope of the patent of the invention.

The application of the gene in delaying plant flowering also belongs to the protection scope of the patent of the invention. The specific process of the application is to infect the engineering bacteria on plants to obtain transgenic plants with delayed flowering.

According to the obtained results of the redetermination of the Chinese pears and Xinjiang pears, the full-length information of the PbELF3b gene DNA (the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2) which respectively corresponds to the Chinese pears and Xinjiang pears is mined, 3 synonymous mutations are found on the exon, 2 base mutations and a 58bp InDel mutation are found on the intron (the sequences are shown in SEQ ID NO: 3). The PbELF3b allele obtained in Pyrus pyrifolia was designated as N-type, while the PbELF3b allele obtained in Sinkiang Pear was designated as D-type. The applicant designs a pair of PCR-based InDel specific markers according to the InDel sequence difference of 2670-2728 th sites of an intron of a PbELF3b gene, wherein the markers consist of two primer sequences, and the specific DNA sequences are shown as follows: forward primer PbELF3 b-InDel-F: 5'-tcgttgtgttaactgttttctg-3', reverse primer PbELF3b-InDel-R: 5'-ccaaacaaatccccactatg-3' (shown in SEQ ID NO:4 and SEQ ID NO: 5). PCR amplification is carried out on DNA samples of 4 parts of Chinese pear leaves, 4 parts of Chinese pear flower buds, 4 parts of Xinjiang pear leaves and 4 parts of Xinjiang pear flower buds, and the sizes of fragments obtained by primer amplification are different, so that the InDel difference is found to be true.

The full-length DNA sequences of the PbELF3b genes respectively corresponding to the Chinese pear and the Xinjiang pear are cloned and constructed in an arabidopsis thaliana overexpression vector. And transforming the constructed expression vector into Arabidopsis thaliana Col-0 by using an agrobacterium floral dip method to obtain transgenic T1 and T2 generation positive seedlings. The results show that in the long-day condition, the arabidopsis thaliana plant over-expressing the D-type gene sequence of the Xinjiang pear PbELF3b flowers later than the N-type arabidopsis thaliana plant over-expressing the Xinjiang pear PbELF3b, and the flowering time of the two transgenic plants is later than that of the arabidopsis thaliana in the control group. Consistent results were obtained regardless of flowering time or rosette leaf number. And detecting corresponding leaf DNA samples in the two types of transgenic positive seedlings by using InDel specific marker primers, and finding that InDel difference also exists in the two types of transgenic positive seedlings. Thus, it is believed that both the Pyrus pyrifolia and Sinkiang Pear PbELF3b alleles have a plant flowering-delaying effect, but the delaying effect of the D-allele of Sinkiang Pear PbELF3b is stronger than that of the N-allele of Pyrus pyrifolia.

In order to eliminate the influence of 3 synonymous mutations on exons and 2 base mutations on introns and clarify the function of InDel variation, specific gene modification primers are designed to respectively re-amplify the Chinese pear and Xinjiang pear templates to obtain corresponding fragments, and a multi-fragment homologous recombination mode is used to construct new PbELF3b allelic genotypes, namely N-D (i.e. the InDel sequence is deleted from the Chinese pear type PbELF3b gene) and D + D (i.e. the InDel sequence is supplemented to the Xinjiang pear type PbELF3b gene) (shown as SEQ ID NO:13 and SEQ ID NO: 14).

The full-length DNA sequences of PbELF3b corresponding to the modified N-D type and the modified D + D type respectively are also constructed in an arabidopsis thaliana overexpression vector, and transgenic T1 and T2 generation positive seedlings taking Col-0 as background are obtained. The result shows that under the long-day condition, the flowering time of the Arabidopsis plant over-expressing the D + D type gene sequence has no obvious difference with that of a control group, the lotus throne leaf number is slightly larger than that of the control group, the Arabidopsis plant over-expressing the N-D type gene sequence flowers obviously later than that of the control group, and the lotus throne leaf number is obviously increased. Meanwhile, detecting corresponding leaf DNA samples in the two transgenic positive seedlings by using InDel specific marker primers, and finding that InDel difference exists in the two transgenic positive seedlings. Therefore, the InDel sequence deleted on the intron of PbELF3b allele of Xinjiang pear has the function of delaying the flowering of plants.

The molecular marker and the screening method can be used for the auxiliary breeding of the new varieties of the conventional pear varieties or the hybrid pear progeny.

For a more detailed technical scheme, refer to the detailed description.

The sequence table SEQ ID NO 1 is the full-length DNA sequence of PbELF3b gene N type in the cloned Chinese pear, and the fragment length is 4163 bp.

The sequence table SEQ ID NO.2 is the full-length DNA sequence of the cloned D type PbELF3b gene in Xinjiang pear, and the fragment length is 4105 bp.

The sequence table SEQ ID NO 3 is a 58bp sequence of the cloned D type PbELF3b gene in Xinjiang pear which is deleted compared with the N type sequence of PbELF3b gene in cloned Chinese pear.

The sequence tables SEQ ID NO. 4 and SEQ ID NO. 5 are the nucleotide sequences of the InDel sequence specific molecular marker primers screened by the invention.

The sequence tables SEQ ID NO.6 and SEQ ID NO.7 are nucleotide sequences of primers for cloning the full-length sequence of the pear PbELF3b gene.

The sequence table SEQ ID NO. 8 is the nucleotide sequence of the sequencing primer of which the gene is constructed in an overexpression vector.

The sequence tables SEQ ID NO 9 and SEQ ID NO 10 are nucleotide sequences of N-d type primers of PbELF3b gene in Chinese pear cloned and modified by the invention.

The sequence tables SEQ ID NO. 11 and SEQ ID NO. 12 are nucleotide sequences of primers of the D + D type of PbELF3b gene in Xinjiang pear cloned and modified by the invention.

The sequence table SEQ ID NO 13 is the full-length DNA sequence of PbELF3b gene N-d type in Chinese pear cloned and modified by the invention, and the fragment length is 4105 bp.

The sequence table SEQ ID NO.14 is the full-length DNA sequence of the D + D type PbELF3b gene in Xinjiang pear cloned and modified by the invention, and the fragment length is 4163 bp.

Compared with the prior art, the invention has the following advantages and effects:

the PbELF3b gene in Chinese pear and Xinjiang pear is cloned and separated, and the N-type and D-type genes of two corresponding genotypes of the PbELF3b gene are identified to play roles in delaying flowering respectively.

Through sequence difference comparison, specific molecular marker primers aiming at an InDel sequence in an intron of the PbELF3b gene are designed, alleles of N-D type and D + D type PbELF3b genes are constructed through genetic modification, and it is proved that the deletion of a 58bp D fragment can cause the PbELF3b gene to have a stronger flowering delaying effect.

The discovery of the InDel sequence of the PbELF3b gene and the design of a specific molecular marker primer can be used as a molecular marker for identifying the differentiation and development conditions of pear flower buds, thereby improving the breeding efficiency.

Drawings

FIG. 1, the structure of the pear PbELF3b gene and the position of the 58bp deletion fragment.

FIG. 2, PCR detection of the InDel sequence amplification of the PbELF3b gene in leaves and flower buds of different Chinese pears and Xinjiang pears. The reference numerals indicate that lanes 1-4 are Pyrus pyrifolia leaf samples, lanes 5-8 are Pyrus pyrifolia flower bud samples, lanes 9-12 are Sinkiang Pyri leaf samples, and lanes 13-16 are Sinkiang Pyri flower bud samples; lane M shows a 10kb marker, and the band sizes are 10000bp, 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp from top to bottom, wherein the brightest band is 1000 bp.

FIG. 3, detection of PCR products of full-length amplification of DNA of type N and type D of PbELF3b gene of Pyrus pyrifolia and Sinkiang Pear. Description of reference numerals: lane M shows 10kb marker.

FIG. 4, Arabidopsis phenotype over-expressing the N-type of the Pyrus pyrifolia PbELF3b allele. Description of reference numerals: in FIG. 4, panel A, N-OE7, N-OE13 and N-OE27 are Arabidopsis strains overexpressing the N-type allele of the Pyrus pyrifolia PbELF3b, and Vector control is an over-expression unloaded Arabidopsis control group; FIG. 4B is a graph showing the statistical comparison of flowering-time and rosette leaf number of long-day-condition Arabidopsis overexpression positive lines with those of the control group.

FIG. 5 Arabidopsis phenotype overexpressing the D-form of the PbELF3b allele of Sinkiang pear. Description of reference numerals: in FIG. 5, panel A, D-OE6, D-OE10 and D-OE23 are Arabidopsis strains overexpressing the D-type of PbELF3b allele of Xinjiang pear, and VectorControl is an Arabidopsis control group overexpressing a null load; FIG. 5, panel B, is a statistical comparison of flowering-time and rosette leaf number for long-day streak Arabidopsis overexpressing positive lines versus control groups.

FIG. 6, the sequence of the allele-specific marker InDel of PbELF3b was examined in transgenic Arabidopsis thaliana. Description of reference numerals: lanes 1-8 are DNA samples of PbELF3b-D-OE transgenic Arabidopsis, and 9-16 are DNA samples of PbELF3b-N-OE transgenic Arabidopsis. Lane M shows 10kb marker.

FIG. 7, PCR product detection of modified Chinese pear and Xinjiang pear PbELF3b gene DNA segment amplification. Description of reference numerals: designing a PbELF3b-N-d gene modification primer, and using DNA of Chinese pear as a template to clone the DNA sequence of the PbELF3b gene in segments, wherein the sizes of the PbELF3b-N-d-1 and PbELF3b-N-d-2 segments are 2670bp and 1442bp respectively; the PbELF3b-D + D gene modification primer is designed, the DNA sequence of PbELF3b gene is cloned in segments by using DNA of Xinjiang pear as a template, and the sizes of the PbELF3b-D + D-1 fragment and the PbELF3b-D + D-2 fragment are 2707bp and 1475bp respectively. Lane M shows 10kb marker.

FIG. 8, Arabidopsis phenotype of D + D type of the engineered PbELF3b allele after overexpression. Description of reference numerals: in FIG. 8, panel A, D + D-OE1, D + D-OE11 and D + D-OE18, are Arabidopsis strains with D + D type of modified PbELF3b allele after overexpression, and Vector control is an over-expression unloaded Arabidopsis control group; FIG. 8, panel B, is a statistical comparison of flowering-time and rosette leaf number for long-day-conditioned Arabidopsis overexpression positive lines and control groups.

FIG. 9 Arabidopsis phenotype of the N-d type of the engineered PbELF3b allele after overexpression. Description of reference numerals: FIG. 9A is a drawing A in which N-d-OE2, N-d-OE4 and N-d-OE24 are modified by overexpression of an N-d type Arabidopsis thaliana strain of PbELF3b allele, and Vector control is an over-expression unloaded Arabidopsis thaliana control group; FIG. 9, panel B, is a statistical comparison of flowering-time and rosette leaf number for long-day streak Arabidopsis overexpressing positive lines versus control groups.

FIG. 10, the sequence of the allele-specific marker InDel of PbELF3b was examined in the transgenic Arabidopsis thaliana after modification. Description of reference numerals: lanes 1-9 are DNA samples of PbELF3b-D + D-OE transgenic Arabidopsis, 10-18 are DNA samples of PbELF3b-N-D-OE transgenic Arabidopsis. Lane M shows 10kb marker.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1: InDel sequence identification of internal intron region of PbELF3b gene of Chinese pear and Xinjiang pear

According to a white pear genome database of the pear engineering technology center of Nanjing agriculture university and resequencing data of different pear varieties, the full-length DNA sequences of the PbELF3b genes of Chinese pears and Xinjiang pears are obtained in a homologous comparison mode. The sequences of the two varieties were aligned and analyzed by MUSCLE (https:// www.ebi.ac.uk/Tools/msa/MUSCLE /), and the sequence information is shown in SEQ ID NO:1 and sequence information as shown in SEQ ID NO:2, respectively. The alignment showed 3 synonymous mutations in both exons and 2 base mutations and 1 long InDel sequence in the intron. Specifically, the Xinjiang pear has a 58bp fragment deletion relative to the Chinese pear sequence (figure 1). Thus, the sand pear PbELF3b gene was named N-type and Xinjiang pear PbELF3b gene was named D-type, respectively.

Aiming at the difference of deleted sequences between the N type and the D type of the PbELF3b gene, a specific marker primer is designed, and a forward primer PbELF3 b-InDel-F: tcgttgtgttaactgttttctg (SEQ ID NO: 4), and a reverse primer PbELF3b-InDel-R: ccaaacaaatccccactatg (SEQ ID NO: 5). Using InDel specificityThe PCR amplification of the labeled primers identifies 4 parts of Chinese pear leaves, 4 parts of Chinese pear flower buds, 4 parts of Xinjiang pear leaves and 4 parts of Xinjiang pear flower buds. PCR reaction (20. mu.L): 10 μ L of 2 XTAQIX (containing Taq enzyme, buffer and dNTP, etc.), 10 μ M of each of 1 μ L of forward and reverse primers, 1 μ L of DNA template, ddH₂The content of O is filled to 20 mu L. The reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; 35 amplification cycles comprising denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 30 s; after the circulation is finished, the extension is carried out for 10min at 72 ℃, and the heat preservation is carried out for 5min at 20 ℃. mu.L of PCR amplification product was added to 1. mu.L of 10 Xloading buffer, and after electrophoresis in 1% agarose gel, the band shown in FIG. 2 was observed by a gel imager. Wherein all the Chinese pear samples show consistent fragment length, namely 292bp of the N-type InDel specific marker amplification product of the PbELF3b gene; while all samples of Xinjiang pear showed a consistent fragment length, i.e., 234bp for the amplification product of the PbELF3b gene type D InDel-specific marker.

Example 2: cloning and vector construction of PbELF3b genes of Chinese pear and Xinjiang pear

The sequences of the vector and the PbELF3b gene are selected according to the demand of recombinase construction vector, Primer premier 5.0 is used for designing primers, and the DNA corresponding to two representative pear varieties is respectively used as a template for PCR amplification of the full length. The detailed steps are as follows:

research materials A representative variety of Chinese pears, namely Cuiguan pears and a representative variety of Xinjiang pears, namely Kuerle fragrant pears, are planted in the germplasm resource center of Jiangpu pears, gardening academy of Nanjing university of agriculture, and the age of the Chinese pears is about 10 years. Healthy pear leaves are all selected, 500mg of samples are randomly weighed, are quickly frozen by liquid nitrogen immediately, and are extracted by a plant genome DNA extraction kit (purchased from Chengdu Fuji organisms, China) completely according to the steps of the specification. After extraction was completed, the quality of the DNA was checked by electrophoresis on a 1% agarose gel, and the concentration and quality of the DNA were checked by a spectrophotometer.

The designed specific primers are used for amplifying the full-length DNA sequences of the PbELF3b genes of the N type Chinese pear and the D type Xinjiang pear respectively. The amplification primers were as follows: PbELF3 b-GFP-F:gagaacacgggggactctagaatgaggagggggaacgag(SEQ ID NO：6),PbELF3b-GFP-R：gcccttgctcaccatggatccggttgaatcctgctgttttcc (SEQ ID NO: 7), with homologous sequences upstream and downstream of the vector multiple cloning site underlined. The amplification system, which preferably is a 50. mu.L system, includes 100ng template DNA, 10. mu.L of 5 XPisuion GC Buffer, 1. mu.L dNTPs (10mM), 1. mu.L of a High-Fidelity DNA Polymerase, 10.0. mu.M of a forward primer and 10.0. mu.M of a reverse primer, 2.5. mu.L of a supplemental ddH₂O to 50. mu.L. Phusion High-Fidelity DNA Polymerase described in the present invention was purchased from Thermo Scientific. The procedure of the amplification reaction in the present invention is preferably: pre-denaturation at 98 ℃ for 2 min; 30 amplification cycles comprising denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 4 min; after the circulation is finished, the extension is carried out for 10min at 72 ℃, and the heat preservation is carried out for 5min at 20 ℃. Taking 50 mu L of PCR amplification product, adding 5 mu L of Loading buffer solution 10 Xloading buffer, carrying out 1% agarose gel electrophoresis, observing by using a gel imager to obtain 4163bp and 4105bp products (shown in figure 3) corresponding to the N type and the D type of the PbELF3b gene respectively, and recovering a target band according to the using and extracting steps of a gel kit (purchased from China, Kangshi century, China).

The vector pCAMBIA1300-35S CDS-GFP (Fang and Spector,2010) plasmid was double digested with XbaI and BamHI restriction enzymes, and 50. mu.L of the digestion system included: mu.g vector plasmid DNA, 6. mu.L buffer, 2. mu.LXBaI and 2. mu.LBamHI, supplemented with ddH₂O to 50. mu.L. And (3) carrying out double enzyme digestion for 3 hours, and then recovering the linearized vector fragment after enzyme digestion. And detecting the concentration and quality of the gene amplification fragment and the enzyme digestion vector fragment by using a spectrophotometer and recording. The gene fragment and the vector fragment are ligated using a recombinase system. Firstly, calculating corresponding concentration according to a formula in the specification, the length of the fragment and the length of the vector, and measuring the concentration by combining a spectrophotometer to obtain the volume of the PCR amplification gene fragment and the volume of the recovery product of the enzyme digestion vector. The reaction system 20. mu.L was as follows: calculated gene fragment volume, linearized vector volume, 4. mu.L of 5 × CE II Buffer, 2. mu.L of Exnase II, supplemented with ddH₂O to 20. mu.L. React at 37 ℃ for 30min and immediately cool on ice. 10 mu L of recombinant product is taken, escherichia coli DH5 alpha is transformed by a heat shock method, positive clones are screened in an LB solid plate containing 100mg/L kanamycin, and 3 positive clones are selected for sequencing confirmation. Using a sequence on the vector as an assaySequencing the selected positive monoclonal by a sequence primer GFP-R: CGTCGTCCTTGAAGAAGATG (SEQ ID NO: 8), wherein the sequencing result shows that the gene fragment is constructed on the vector, the gene sequence is completely consistent with the database prediction result, and the DNA full-length sequences of the N-type and D-type Xinjiang pear PbELF3b genes of the Chinese pear have the above-mentioned base mutation and InDel sequence.

Example 3: PbELF3b gene function identification of Chinese pear and Xinjiang pear

The recombinant plasmids with correct sequencing are named pCAMBIA1300-35S, PbELF3b-N-GFP and pCAMBIA1300-35S, PbELF3b-D-GFP, and are abbreviated as PbELF3b-N and PbELF3b-D, respectively. Extracting the corresponding recombinant plasmid. The recombinant plasmids PbELF3b-N and PbELF3b-D are introduced into Agrobacterium GV3101 by freeze-thawing method to obtain positive Agrobacterium strain.

The agrobacterium infection arabidopsis adopts a classical flower soaking method, and the specific steps are as follows:

first, a positive Agrobacterium strain stored in an ultra-low temperature refrigerator (-80 ℃) is streaked on a plate culture medium added with LB of 100mg/L kanamycin and 50mg/L rifampicin for activation, a 28 ℃ incubator is used for inverted culture for 1-2 days, a single clone with good growth state is picked up and is subjected to shaking culture in 100ml LB liquid culture medium added with 100mg/L kanamycin and 50mg/L rifampicin, thallus is collected when the shaking culture is carried out at the temperature of 28 ℃ and at the rpm of 220/min till OD600 is between 0.6 and 0.8, the thallus is centrifuged at the room temperature of 5000rpm/min for 10min, and the whole thallus is collected repeatedly. Secondly, preparing an induced staining solution, 1/2MS, 5% of sucrose, 10 mu g/L of 6-BA, adjusting the pH value to 5.70 by KOH, 0.025% of Sillwet-77, and suspending the thalli in the equal volume of the staining solution. And (3) selecting the wild arabidopsis thaliana Col-0 to be flowering after bolting, inversely buckling the wild arabidopsis thaliana Col-0 in a 100ml beaker filled with a heavy suspension, soaking the whole inflorescence in a bacterial liquid, vacuumizing to 380mmHg, and infecting for 7 min. And (3) culturing the infected arabidopsis thaliana plants in the dark at the temperature of 22 ℃ overnight, and then taking out the plants to be normally cultured to obtain seeds.

The transgenic arabidopsis positive seedlings are screened by hygromycin and identified by using a PCR technology, and the method comprises the following specific steps:

harvesting mature T1 generation seeds from Arabidopsis thaliana infected with PbELF3b-N and PbELF3b-D Agrobacterium bacteria solution, adding silica gel, drying for 7 days, and screening. Preparation of sterilized Lantern heads and ddH in clean bench₂Sterilizing with 70% ethanol for 1min, and sterilizing with sterile ddH₂Cleaning with water for 3 times, sterilizing with 10% sodium hypochlorite solution for 5min, and sterilizing with sterile ddH₂And cleaning for 5 times by using O. The surface of T1 generation seeds is disinfected and cleaned, and then sown on an MS culture medium containing 20mg/L hygromycin, 100mg/L timentin and 100mg/L carbenicillin sodium, and the seeds are firstly cultured in a dark condition at 4 ℃ for 3 days and then normally cultured in a long-day condition (16h light/8 h dark). The positive seedlings grow to 10-12 days under long-day sunlight, and are transplanted to nutrient soil: in a nutrition pot with 1:1.5 vermiculite, the seeds grow normally to maturity, and T2 seeds are harvested according to a single plant. The flowering time and the rosette leaf number at the first flower of the PbELF3b-N and PbELF3b-D transgenic seedlings were counted during the growth process.

When the transgenic seedlings grow to blossom, 2 rosette leaves of each plant are respectively cut as materials, and the DNA of arabidopsis is extracted by adopting a CTAB method. The CTAB method for extracting the arabidopsis DNA comprises the following specific steps: firstly, taking Arabidopsis thaliana leaves into a 1.5ml centrifuge tube, adding 400 mu L CTAB buffer solution (2% CTAB, 100mmol/L Tris-HCl pH 8.0, 20mmol/L EDTA,1.4mol4/LNaCl), and fully grinding; incubating the ground sample for 1h at 65 ℃, cooling at room temperature, adding 500 mu L chloroform, violently oscillating for 3min, and centrifuging for 10min at room temperature of 10000 g; transferring the supernatant into a new 1.5ml centrifuge tube, adding isopropanol with the same volume, gently inverting and mixing uniformly, and centrifuging at room temperature of 10000g for 10 min; carefully removing supernatant, washing the precipitate with 70% ethanol, completely removing ethanol, standing and drying; add 40. mu.L sterile ddH₂Dissolving O to be used as a PCR amplification template.

Specific marker primers designed for the difference in deleted sequences between type N and type D of PbELF3b gene, SEQ ID NO:4 and SEQ ID NO: and 5, finishing PCR reaction to identify positive seedlings. The PCR reaction system (20. mu.L) and the reaction procedure were the same as those of the PCR in example 1, and different templates were used for detection, respectively.

According to the PCR identification result and the phenotype statistical result, 3 strains of the PbELF3b-N and PbELF3b-D transgenic seedlings are respectively selected as representatives, harvested T2 generation seeds are transplanted into a nutrition pot after being disinfected, cleaned and screened, the seeds grow under the same long-day culture environment, and the first flowering time and the number of rosette leaves are counted. The phenotypic results for the PbELF3b-N and PbELF3b-D transgenic shoots are shown in FIGS. 4 and 5, respectively. The average flowering time of the arabidopsis thaliana in the control group is 24.7 days after illumination, while the average flowering time of the PbELF3b-N transgenic seedlings is 25.9 days, and the average flowering time of the PbELF3b-D transgenic seedlings is 28.1 days. The average rosette leaf number of the control arabidopsis thaliana when the first flower is opened is 8.4, while the average of the PbELF3b-N transgenic shoots is 9.5, and the average rosette leaf number of the PbELF3b-D transgenic shoots is 11.5. Compared with a control plant, the flowering time of both transgenic seedlings is delayed, the number of rosette leaves is increased, but the flowering delaying effect of the PbELF3b-D transgenic seedlings is more obvious, which indicates that the PbELF3b allele has the effect of delaying flowering of arabidopsis, but the delaying effect of the D-type PbELF3b allele in Xinjiang pear is stronger than that of the N-type allele in Chinese pear. Specific marker primers designed for the difference in deleted sequences between type N and type D of PbELF3b gene, SEQ ID NO:5 and SEQ ID NO:6 identification of two classes of transgenic positive shoot DNA (FIG. 6), it is clear that the PbELF3b allele InDel sequence is indeed present in T2 seedlings. The length of the N-type amplification product of the PbELF3b gene is 292bp, and the length of the D-type amplification product of the PbELF3b gene is 234 bp.

Example 4: PbELF3b gene modification of Chinese pear and Xinjiang pear

Under the condition that two kinds of PbELF3b alleles respectively existing in the Chinese pear and the Xinjiang pear have certain functions in delaying plant flowering and the phenotype of the D-type transgenic positive seedlings of the Xinjiang pear is more obvious, further experiments are still needed to prove whether the functional difference of the PbELF3b genes of the Chinese pear and the Xinjiang pear is caused by the InDel sequence difference. PbELF3b genes of Chinese pear and Xinjiang pear are modified, and N-D type of PbELF3b gene without exon and intron base mutation and with only InDel region sequence deletion and D + D type of PbELF3b gene with exon and intron base mutation and without InDel region sequence deletion are obtained.

Primers were designed as follows:

PbELF3b-GFP-F:gagaacacgggggactctagaatgaggagggggaacgag

PbELF3b-N-d-R1:agtatctgcttaggcgtgatattgatcagga

PbELF3b-N-d-F2:cgcctaagcagatactttgtgactaaagcacttag

PbELF3b-GFP-R:gcccttgctcaccatggatccggttgaatcctgctgttttctc

PbELF3b-D+d-R1:agcccattaactccacctgaccaaccccaaggtaatccttaggcgtgatattgatcaggat

PbELF3b-D+d-F2:gtggagttaatgggctatggtgtttttcacgggtaagcagatactttgtgactaaagcacttagtc

the specific gene modification and vector construction process is as follows:

the DNA samples of Pyrus pyrifolia and Sinkiang pears mentioned in example 2 were used as templates to clone the desired modified gene fragments in segments. The construction process of the PbELF3b gene N-d type is to use Chinese pear DNA as a template, PbELF3b-GFP-F/PbELF3b-N-d-R1 and PbELF3b-N-d-F2/PbELF3b-GFP-R two groups of primers, and use high fidelity DNA polymerase to carry out PCR reaction. PCR reaction (50. mu.L): 100ng template DNA, 10. mu.L of 5 XPCR buffer, 1. mu.L dNTPs (10mM), 1. mu.L high fidelity DNA polymerase (2U), 10.0. mu.M forward primer and 10.0. mu.M reverse primer 2.5. mu.L, supplemented with ddH2O to 50. mu.L. The reaction procedure is as follows: pre-denaturation at 98 ℃ for 2 min; 30 amplification cycles comprising denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 2.5 min; after the circulation is finished, the extension is carried out for 10min at 72 ℃, and the heat preservation is carried out for 5min at 20 ℃. 50 μ L of PCR amplification product was added to 5 μ L of loading buffer 10 XLoadingbuffer, and after electrophoresis in 1% agarose gel, the product PbELF3b-N-d-1 corresponding to N-d type segment of PbELF3b gene was 2670bp and PbELF3b-N-d-2 was 1442bp (FIG. 7). And simultaneously amplifying the D + D type of the PbELF3b gene, taking Sinkiang pear DNA as a template, using two groups of primers of PbELF3b-GFP-F/PbELF3b-D + D-R1, PbELF3b-D + D-F2/PbELF3b-GFP-R, and using the same PCR system and program to obtain a product of which the product PbELF3b-D + D-1 is 2707bp and the product PbELF3b-D + D-2 is 1475bp corresponding to the D + D type segmentation of the PbELF3b gene (figure 7). Specific fragments of corresponding length were recovered and the concentration and quality of PCR product recovery was checked using a spectrophotometer.

Two PCR amplified fragments of the PbELF3b gene, N-D and D + D, were constructed using a multi-fragment recombinase on the pCAMBIA1300-35S CDS-GFP plasmid, respectively. The basic procedure is similar to that already mentioned above, firstly the volume used needs to be calculated according to the length and concentration of different gene fragments and vector fragments, the reaction system is changed to the volume of gene fragment 1, gene fragment 2 and linearized vector fragment to be ligated, 4. mu.L of 5 × CE II Buffer, 2. mu.L of Exnase II, and ddH2O to 20. mu.L are supplemented. The recombinant plasmid is transferred into DH5 alpha colibacillus competence, and PbELF3b-GFP-F and PbELF3b-GFP-R primers are used for identifying positive clones, and 3 positive clones are selected from each genotype and are subjected to sequencing verification by using the GFP-R primers. The target sequence is obtained and correctly constructed on a carrier, and the sequences of the modified PbELF3b gene N-D type and D + D type are respectively shown as SEQ ID NO:13 and SEQ ID NO: as shown at 14. Wherein only an InDel sequence 58bp deletion exists in an N-D type sequence of the PbELF3b gene, and 2 base mutations on an intron and 3 synonymous mutations on a fourth exon exist in a D + D type sequence of the PbELF3b gene.

Example 5: functional identification of PbELF3b gene InDel sequence of Chinese pear and Xinjiang pear

The recombinant plasmids with correct sequencing are named pCAMBIA1300-35S, PbELF3b-N-D-GFP and pCAMBIA1300-35S, PbELF3b-D + D-GFP, and are abbreviated as PbELF3b-N-D and PbELF3b-D + D, respectively. The recombinant plasmids with correct sequencing are respectively transferred into agrobacterium GV3101, wild arabidopsis Col-0 is infected by using the method for infecting arabidopsis as mentioned in example 3, transgenic over-expression positive seedlings of T1 generation and T2 generation are screened and identified, and the flowering time and the number of rosette leaves at the time of opening the first flower are counted. According to the results of the identified and observed T1 generation positive seedlings, 3 overexpression lines are respectively selected to screen and plant T2 generation positive seedlings for statistical analysis of phenotype. The statistics of the flowering time of the first flower showed that the control group Arabidopsis took 25.2 days after being irradiated, the average time of 3 transgenic lines of PbELF3b-D + D was 25.1 days, and the average time of 3 transgenic lines of PbELF3b-N-D was 29.3 days. Meanwhile, the statistical result of the number of rosette leaves of the plants at the time of first flowering is that the control Arabidopsis was 9.6 leaves, and the average rosette leaf numbers of the PbELF3b-D + D and PbELF3b-N-D transgenic lines were 10.4 and 11.9 leaves, respectively. The results of the Arabidopsis phenotype relative to the control group were that 3 transgenic lines of PbELF3b-N-D all showed significant delayed flowering time and increased rosette leaf number (FIG. 9), i.e., significant suppression of flowering performance of Arabidopsis plants, while 3 transgenic lines of PbELF3b-D + D showed an increase in rosette leaf number, but the increase was not significant and there was no statistical delay in flowering time (FIG. 8). Specific marker primers designed for InDel sequence differences were also used, SEQ ID NO:4 and SEQ ID NO:5 identifying two kinds of transgenic positive seedlings DNA (figure 10), wherein the length of the amplification product fragment in the transgenic line positive seedlings of PbELF3b-D + D is 292bp, while the length of the amplification product fragment in the transgenic line positive seedlings of PbELF3b-N-D is 234bp, namely, the deletion difference of specific regions on the intron really exists in the corresponding transgenic lines of two PbELF3b genotypes. The combination of phenotypic results and PCR identification results indicate that the presence of a 58bp sequence deletion of the intron affected the PbELF3b gene and resulted in a significant delay in flowering in arabidopsis thaliana.

By combining the four groups of PbELF3b genotype sequences and the flowering phenotype of the transgenic positive seedlings, it is considered that the 58bp long fragment deletion existing on the intron of the Xinjiang pear PbELF3b gene can influence the flowering character of plants. Therefore, the InDel sequence specific marker primer designed according to the intron deletion fragment has the sequence shown in SEQ ID NO:4 and SEQ ID NO:5, the molecular marker can be used for identifying the differentiation and development conditions of pear flower buds so as to improve the breeding efficiency, and different types of PbELF3b can be used for regulating and controlling the flowering time of other plant species by using a genetic engineering method.

SEQ ID NO：1 PbELF3b-N

atgaggagggggaacgaggagaaggttatgggacctatgttcccaaggctccatgtgaatgatgcagataaaggagggccgagagctcctccaagaaacaagatggccctctatgagcagctgagcatcccatctcagaggttcaatcctggggtgctgcctttgaattcaaataaccaggtaatttaatcataatttgtgcttactcttttcttaattatttgtttggattattttgaaatgttattgctttaaacttgtagttaggtaatggattttctcaggctttttggttttttgtttttgtagtagttaactgtaagtgttgttttatgctatattgagtaatgttgcatatgactatgtctatatgtcgtgttttaatggctattaattgtaaaaaaagaagttaaaatatgccaagatagctactatttgcagcatgctgcaattaagagggaaaaaacaacggtgtgttgataaatagtgttgcaagcttgtttagtatggacggaaaatgattatcgcgtatctgaattttgggagcaatttatgttttcaggggagtcgttcagatggaaatttggcttttccacttcgtggtcgtacatctacacctactcatcaggctgtgatgtttcatggtcgccagtctgacagagcaaatgtaaacgtgccatttgaacacaccgacctaagaaggaagatcggagatgaagatgattttagtgttcctgtatttgttcaatcaaggatgggtcttggtcacagtaaaactccaattggtagtgaggaaaaacttacttccatcagctcgcctcattctgaccatttagtaaaagtaagaaacgtggggaagaaggatccaaaacaaataagctccccaactctgaatttaacacgagaattgagaagtgaaagagaagaggacctaatagaagtaagcggttcgagtaagggccattcaggaaaatttgccgcaaaaatatcaaccatacaaaagattgatgggcccgtagaagcgaatgcatcaccaaatcaagaggatgcagaatgttctgttccgagattcaacaggttagctgagagtgatgcttgcttacaacaagagtctagatctgggtcacagccaaacgttactggacaaggtgatggtcttgttgagtcttcaagggatgtagagaagggaactctttcccaggaaaaaagtgtttcttgttctggggcggatcctaccagtcccaatgaccctgataatgacagcgaataccgtggagacagaaagtgtatttcacttcaaatgggacatgtagacaaaagtgatgatgtctcagagacctccatggtggattctatatccggcatggacatctctcctgatgatgttgtaggaataataggccagaaacatttctggaaggcaagaaaagcaattgtcaagtaagtctctattttctccagtagttcatttcagttgttactttgcgctttagaattttgaagttcacttttttcccagtatgcagtatatgaagcatttggtctcataatatcttcgtgttgttgagtatttcttcacttatgttttgtgattattttttttctgtttcttttttaattcttccgtatggctgtcttagactgttatttatataacaattaggaatatagatataatttgaagggaggtgagatttcatagtacagagtcccgggattccttctaaagtggaattattttgtgttataaggccctcgataacattttaacagtggatatggatcgtcttacagcagggataaatacatcttaatagagttaccttgtgcaacgtgacctccgagacggcatatcatctcgttattcattgcctttttgtatctgcctgttgggtttattcctgtctcggtttggtaatgcttgggggtttccctgttcactatcaaaagatttcccttcatggcacttgagggctgggagcaagaaggggaacaagtaatgaaggattatccttgggactacattgtgtggatcttggactatatttgagaatatagttgacatggtggtgaggaggattacatctcttatgtagtattttgatgtggtgtattggaagttggaagattttattaggtcggggtttgtgttgtctttcttatacgctttatagaatatgagagtatcccctatatatgggttcttctaatcattacaccttttttatttttcattatgaaatgtgaatcatttacatgtgaatcagaaagctttagtttgtacatttcttttatgattttaattgaatattacaaattttaagctgtttttgtgttaaagaaaggagatttgcagacatctaaatgatttatgtcgcagatatttgccatgtttcagaatctgttgtagcatttagctttcgtttttattgctctgaagatttatgtcgcagatatttgctatgttttggatctgttgtagcatttagctatcgttttatagttttgaagtggtttttgtatccattattaattttattgctctgaattacctcgttgtgttaactgttttctgatgagcaatttgctgcatccatccttaagctgtttccttcccatgtttggtaaatgtcatatttgtctacaatcctgatcaatatcacgcctaaggattaccttggggttggtcaggtggagttaatgggctatggtgtttttcacgggtaagcagatactttgtgactaaagcacttagtcatttttctgttatctcttaaataacatgagtttctattttctgttccgatgcatgtaatccaataatccatagtggggatttgtttggtacaaatgattgtcaactgcccaatttttcatttttttgtccagtttattgttttgttttctcgtattggttttgtttttgtgatttaccaagcttcatatggtttggtgtgtattgtgcaactatgtttttgacatgactccttgtactttctacagtcagcaaagattgtttgcggttcaagtatttgagttgcatagactcattaaggtaagactaaatggatggattgtgtttgatttctttttgttgagaatgtacacacacgcgcgcatatcagttgacttagattggaaaaattagctgaataaaattcttttttgaacaggtccaacgactgattgctggatctccacatcttttgcttgaagatactgcttttctgggcacatctactttaaggggatccccggcaacaaaactctcatcagagtatgttgtaaagccactactacatgttgtaaagcgcaaacacgaacctgagaagccaaacaacaaaatggaatgttctgcggaaaatgcagtagggaaaagccagtccttggtgtttccatatttaggaaatccacagccaactcctatggcttctgataaagccagtccttggtgtttccatcagtctcctggacatcaattgttaattccagtaatgtcgccttctgaaggacttgtgtacaagccgtataatggaccaggatttatgggagggccagtttgtggaggatgtggaccctacggctcaactccgatgatgggcaactttgttaagccatcttacggggttccatctcatcatcttcaaggaatgggggttcttcctgtccctccatcactcaatggtcatacttactttcctccatatggcatgtccgttatgaatcctgccatgccgagctcagcagttgaacaaatgcattggtttgctggacccgtttcccatggtcacaccgatcagtcatcgggagggggtgcaaactccaatttgcagcaccaaagctcatgcaacatgccccagaaaaatgtcaccattcctaacgccaaaaggcttcagccatctaatgacagtgggttacaaggaagtacagcaaataatacaggcgacagagccccaatgaggacggatcaaaatcctgaaggaagcgatgcgctccaacttttccccatggctccagtgattccagacggagttccccaatctcacgacataggccagccaatgcgagctataaaagttgtgcctcacaatccaagaactgcaactgcgtcggctgctcgaattttccagtccatacaagcagagagaaaacagcaggattcaacctag

SEQ ID NO：2 PbELF3b-D

atgaggagggggaacgaggagaaggttatgggacctatgttcccaaggctccatgtgaatgatgcagataaaggagggccgagagctcctccaagaaacaagatggccctctatgagcagctgagcatcccatctcagaggttcaatcctggggtgctgcctttgaattcaaataaccaggtaatttaatcataatttgtgcttactcttttcttaattatttgtttggattattttgaaatgttattgctttaaacttgtagttaggtaatggattttctcaggctttttggttttttgtttttgtagtagttaactgtaagtgttgttttatgctatattgagtaatgttgcatatgactatgtctatatgtcgtgttttaatggctattaattgtaaaaaaagaagttaaaatatgccaagatagctactatttgcagcatgctgcaattaagagggaaaaaacaacggtgtgttgataaatagtgttgcaagcttgtttagtatggacggaaaatgattatcgcAtatctgaattttgggagcaatttatgttttcaggggagtcgttcagatggaaatttggcttttccacttcgtggtcgtacatctacacctactcatcaggctgtgatgtttcatggtcgccagtctgacagagcaaatgtaaacgtgccatttgaacacaccgacctaagaaggaagatcggagatgaagatgattttagtgttcctgtatttgttcaatcaaggatgggtcttggtcacagtaaaactccaattggtagtgaggaaaaacttacttccatcagctcgcctcattctgaccatttagtaaaagtaagaaacgtggggaagaaggatccaaaacaaataagctccccaactctgaatttaacacgagaattgagaagtgaaagagaagaggacctaatagaagtaagcggttcgagtaagggccattcaggaaaatttgccgcaaaaatatcaaccatacaaaagattgatgggcccgtagaagcgaatgcatcaccaaatcaagaggatgcagaatgttctgttccgagattcaacaggttagctgagagtgatgcttgcttacaacaagagtctagatctgggtcacagccaaacgttactggacaaggtgatggtcttgttgagtcttcaagggatgtagagaagggaactctttcccaggaaaaaagtgtttcttgttctggggcggatcctaccagtcccaatgaccctgataatgacagcgaataccgtggagacagaaagtgtatttcacttcaaatgggacatgtagacaaaagtgatgatgtctcagagacctccatggtggattctatatccggcatggacatctctcctgatgatgttgtaggaataataggccagaaacatttctggaaggcaagaaaagcaattgtcaagtaagtctctattttctccagtagttcatttcagttgttactttgcgctttagaattttgaagttcacttttttcccagtatgcagtatatgaagcatttggtctcataatatcttcgtgttgttgagtatttcttcacttatgttttgtgattattttttttctgtttcttttttaattcttccgtatggctgtcttagactgttatttatataacaattaggaatatagatataatttgaagggaggtgagatttcatagtacagagtcccgggattccttctaaagtggaattattttgtgttataaggccctcgataacattttaacagtggatatggatcgtcttacagcagggataaatacatcttaatagagttaccttgtgcaacgtgacctccgagacggcatatcatctcgttattcattgcctttttgtatctgcctgttgggtttattcctgtctcggtttggtaatgcttgggggtttccctgttcactatcaaaagatttcccttcatggcacttgagggctgggagcaagaaggggaacaagtaatgaaggattatccttgggactacattgtgtggatcttggactatatttgagaatatagttgacatggtggtgaggaggattacatctcttatgtagtattttgatgtggtgtattggaagttggaagattttattaggtcggggtttgtgttgtctttcttatacgctttatagaatatgagagtatcccctatatatgggttcttctaatcattacaccttttttatttttcattatgaaatgtgaatcatttacatgtgaatcagaaagctttagtttgtacatttcttttatgattttaattgaatattacaaattttaagctgtttttgtgttaaagaaaggagatttgcagacatctaaatgatttatgtcgcagatatttgccatgtttcagaatctgttgtagcatttagctttcgtttttattgctctgaagatttatgtcgcagatatttgctatgttttggatctgttgtagcatttagctatcgttttatagttttgaagtggtttttgtatccattattaattttattgctctgaattacctcgttgtgttaactgttttctgatgagcaatttgctgcatccatccttaagctgtttccttcccatgtttggtaaatgtcatatttgtctacaatcctgatcaatatcacgcctaag----------------------------------------------------------cagataTtttgtgactaaagcacttagtcatttttctgttatctcttaaataacatgagtttctattttctgttccgatgcatgtaatccaataatccatagtggggatttgtttggtacaaatgattgtcaactgcccaatttttcatttttttgtccagtttattgttttgttttctcgtattggttttgtttttgtgatttaccaagcttcatatggtttggtgtgtattgtgcaactatgtttttgacatgactccttgtactttctacagtcagcaaagattgtttgcggttcaagtatttgagttgcatagactcattaaggtaagactaaatggatggattgtgtttgatttctttttgttgagaatgtacacacacgcgcgcatatcagttgacttagattggaaaaattagctgaataaaattcttttttgaacaggtccaacgactgattgctggatctccacatcttttgcttgaagatactgcttttctgggcacatctactttaaggggatccccggcaacaaaactctcatcagagtatgttgtaaagccactactacatgttgtaaagcgcaaacacgaacctgagaaAccaaacaacaaaatggaatgttctgcggaaaatgcagtagggaaaagccagtccttggtgtttccatatttaggaaatccacagccaactcctatggcttctgataaagccagtccttggtgtttccatcagtctcctggacatcaattgttaattccagtaatgtcgccttctgaaggacttgtgtacaagccgtataatggaccaggatttatgggagggccagtttgtggaggatgtggaccTtacggctcaactccgatgatgggcaactttgttaagccatcttacggggttccatctcatcatcttcaaggaatgggggttcttcctgtccctccatcactcaatggtcatacttactttcctccatatggcatgtcTgttatgaatcctgccatgccgagctcagcagttgaacaaatgcattggtttgctggacccgtttcccatggtcacaccgatcagtcatcgggagggggtgcaaactccaatttgcagcaccaaagctcatgcaacatgccccagaaaaatgtcaccattcctaacgccaaaaggcttcagccatctaatgacagtgggttacaaggaagtacagcaaataatacaggcgacagagccccaatgaggacggatcaaaatcctgaaggaagcgatgcgctccaacttttccccatggctccagtgattccagacggagttccccaatctcacgacataggccagccaatgcgagctataaaagttgtgcctcacaatccaagaactgcaactgcgtcggctgctcgaattttccagtccatacaagcagagagaaaacagcaggattcaacctag

SEQ ID NO：3

InDel sequence: gattaccttggggttggtcaggtggagttaatgggctatggtgtttttcacgggtaag

SEQ ID NO：4

PbELF3b-InDel-F:tcgttgtgttaactgttttctg

SEQ ID NO：5

PbELF3b-InDel-R:ccaaacaaatccccactatg

SEQ ID NO：6

PbELF3b-GFP-F：gagaacacgggggactctagaatgaggagggggaacgag

SEQ ID NO：7

PbELF3b-GFP-R：gcccttgctcaccatggatccggttgaatcctgctgttttctc

SEQ ID NO：8

GFP-R:CGTCGTCCTTGAAGAAGATG

SEQ ID NO：9

PbELF3b-N-d-R1:agtatctgcttaggcgtgatattgatcagga

SEQ ID NO：10

PbELF3b-N-d-F2:cgcctaagcagatactttgtgactaaagcacttag

SEQ ID NO：11

PbELF3b-D+d-R1:agcccattaactccacctgaccaaccccaaggtaatccttaggcgtgatattgatcaggat

SEQ ID NO：12

PbELF3b-D+d-F2:gtggagttaatgggctatggtgtttttcacgggtaagcagatactttgtgactaaagcacttagtc

SEQ ID NO：13PbELF3b-N-d

atgaggagggggaacgaggagaaggttatgggacctatgttcccaaggctccatgtgaatgatgcagataaaggagggccgagagctcctccaagaaacaagatggccctctatgagcagctgagcatcccatctcagaggttcaatcctggggtgctgcctttgaattcaaataaccaggtaatttaatcataatttgtgcttactcttttcttaattatttgtttggattattttgaaatgttattgctttaaacttgtagttaggtaatggattttctcaggctttttggttttttgtttttgtagtagttaactgtaagtgttgttttatgctatattgagtaatgttgcatatgactatgtctatatgtcgtgttttaatggctattaattgtaaaaaaagaagttaaaatatgccaagatagctactatttgcagcatgctgcaattaagagggaaaaaacaacggtgtgttgataaatagtgttgcaagcttgtttagtatggacggaaaatgattatcgcgtatctgaattttgggagcaatttatgttttcaggggagtcgttcagatggaaatttggcttttccacttcgtggtcgtacatctacacctactcatcaggctgtgatgtttcatggtcgccagtctgacagagcaaatgtaaacgtgccatttgaacacaccgacctaagaaggaagatcggagatgaagatgattttagtgttcctgtatttgttcaatcaaggatgggtcttggtcacagtaaaactccaattggtagtgaggaaaaacttacttccatcagctcgcctcattctgaccatttagtaaaagtaagaaacgtggggaagaaggatccaaaacaaataagctccccaactctgaatttaacacgagaattgagaagtgaaagagaagaggacctaatagaagtaagcggttcgagtaagggccattcaggaaaatttgccgcaaaaatatcaaccatacaaaagattgatgggcccgtagaagcgaatgcatcaccaaatcaagaggatgcagaatgttctgttccgagattcaacaggttagctgagagtgatgcttgcttacaacaagagtctagatctgggtcacagccaaacgttactggacaaggtgatggtcttgttgagtcttcaagggatgtagagaagggaactctttcccaggaaaaaagtgtttcttgttctggggcggatcctaccagtcccaatgaccctgataatgacagcgaataccgtggagacagaaagtgtatttcacttcaaatgggacatgtagacaaaagtgatgatgtctcagagacctccatggtggattctatatccggcatggacatctctcctgatgatgttgtaggaataataggccagaaacatttctggaaggcaagaaaagcaattgtcaagtaagtctctattttctccagtagttcatttcagttgttactttgcgctttagaattttgaagttcacttttttcccagtatgcagtatatgaagcatttggtctcataatatcttcgtgttgttgagtatttcttcacttatgttttgtgattattttttttctgtttcttttttaattcttccgtatggctgtcttagactgttatttatataacaattaggaatatagatataatttgaagggaggtgagatttcatagtacagagtcccgggattccttctaaagtggaattattttgtgttataaggccctcgataacattttaacagtggatatggatcgtcttacagcagggataaatacatcttaatagagttaccttgtgcaacgtgacctccgagacggcatatcatctcgttattcattgcctttttgtatctgcctgttgggtttattcctgtctcggtttggtaatgcttgggggtttccctgttcactatcaaaagatttcccttcatggcacttgagggctgggagcaagaaggggaacaagtaatgaaggattatccttgggactacattgtgtggatcttggactatatttgagaatatagttgacatggtggtgaggaggattacatctcttatgtagtattttgatgtggtgtattggaagttggaagattttattaggtcggggtttgtgttgtctttcttatacgctttatagaatatgagagtatcccctatatatgggttcttctaatcattacaccttttttatttttcattatgaaatgtgaatcatttacatgtgaatcagaaagctttagtttgtacatttcttttatgattttaattgaatattacaaattttaagctgtttttgtgttaaagaaaggagatttgcagacatctaaatgatttatgtcgcagatatttgccatgtttcagaatctgttgtagcatttagctttcgtttttattgctctgaagatttatgtcgcagatatttgctatgttttggatctgttgtagcatttagctatcgttttatagttttgaagtggtttttgtatccattattaattttattgctctgaattacctcgttgtgttaactgttttctgatgagcaatttgctgcatccatccttaagctgtttccttcccatgtttggtaaatgtcatatttgtctacaatcctgatcaatatcacgcctaag----------------------------------------------------------cagatactttgtgactaaagcacttagtcatttttctgttatctcttaaataacatgagtttctattttctgttccgatgcatgtaatccaataatccatagtggggatttgtttggtacaaatgattgtcaactgcccaatttttcatttttttgtccagtttattgttttgttttctcgtattggttttgtttttgtgatttaccaagcttcatatggtttggtgtgtattgtgcaactatgtttttgacatgactccttgtactttctacagtcagcaaagattgtttgcggttcaagtatttgagttgcatagactcattaaggtaagactaaatggatggattgtgtttgatttctttttgttgagaatgtacacacacgcgcgcatatcagttgacttagattggaaaaattagctgaataaaattcttttttgaacaggtccaacgactgattgctggatctccacatcttttgcttgaagatactgcttttctgggcacatctactttaaggggatccccggcaacaaaactctcatcagagtatgttgtaaagccactactacatgttgtaaagcgcaaacacgaacctgagaagccaaacaacaaaatggaatgttctgcggaaaatgcagtagggaaaagccagtccttggtgtttccatatttaggaaatccacagccaactcctatggcttctgataaagccagtccttggtgtttccatcagtctcctggacatcaattgttaattccagtaatgtcgccttctgaaggacttgtgtacaagccgtataatggaccaggatttatgggagggccagtttgtggaggatgtggaccctacggctcaactccgatgatgggcaactttgttaagccatcttacggggttccatctcatcatcttcaaggaatgggggttcttcctgtccctccatcactcaatggtcatacttactttcctccatatggcatgtccgttatgaatcctgccatgccgagctcagcagttgaacaaatgcattggtttgctggacccgtttcccatggtcacaccgatcagtcatcgggagggggtgcaaactccaatttgcagcaccaaagctcatgcaacatgccccagaaaaatgtcaccattcctaacgccaaaaggcttcagccatctaatgacagtgggttacaaggaagtacagcaaataatacaggcgacagagccccaatgaggacggatcaaaatcctgaaggaagcgatgcgctccaacttttccccatggctccagtgattccagacggagttccccaatctcacgacataggccagccaatgcgagctataaaagttgtgcctcacaatccaagaactgcaactgcgtcggctgctcgaattttccagtccatacaagcagagagaaaacagcaggattcaacctag

SEQ ID NO：14PbELF3b-D+d

atgaggagggggaacgaggagaaggttatgggacctatgttcccaaggctccatgtgaatgatgcagataaaggagggccgagagctcctccaagaaacaagatggccctctatgagcagctgagcatcccatctcagaggttcaatcctggggtgctgcctttgaattcaaataaccaggtaatttaatcataatttgtgcttactcttttcttaattatttgtttggattattttgaaatgttattgctttaaacttgtagttaggtaatggattttctcaggctttttggttttttgtttttgtagtagttaactgtaagtgttgttttatgctatattgagtaatgttgcatatgactatgtctatatgtcgtgttttaatggctattaattgtaaaaaaagaagttaaaatatgccaagatagctactatttgcagcatgctgcaattaagagggaaaaaacaacggtgtgttgataaatagtgttgcaagcttgtttagtatggacggaaaatgattatcgcAtatctgaattttgggagcaatttatgttttcaggggagtcgttcagatggaaatttggcttttccacttcgtggtcgtacatctacacctactcatcaggctgtgatgtttcatggtcgccagtctgacagagcaaatgtaaacgtgccatttgaacacaccgacctaagaaggaagatcggagatgaagatgattttagtgttcctgtatttgttcaatcaaggatgggtcttggtcacagtaaaactccaattggtagtgaggaaaaacttacttccatcagctcgcctcattctgaccatttagtaaaagtaagaaacgtggggaagaaggatccaaaacaaataagctccccaactctgaatttaacacgagaattgagaagtgaaagagaagaggacctaatagaagtaagcggttcgagtaagggccattcaggaaaatttgccgcaaaaatatcaaccatacaaaagattgatgggcccgtagaagcgaatgcatcaccaaatcaagaggatgcagaatgttctgttccgagattcaacaggttagctgagagtgatgcttgcttacaacaagagtctagatctgggtcacagccaaacgttactggacaaggtgatggtcttgttgagtcttcaagggatgtagagaagggaactctttcccaggaaaaaagtgtttcttgttctggggcggatcctaccagtcccaatgaccctgataatgacagcgaataccgtggagacagaaagtgtatttcacttcaaatgggacatgtagacaaaagtgatgatgtctcagagacctccatggtggattctatatccggcatggacatctctcctgatgatgttgtaggaataataggccagaaacatttctggaaggcaagaaaagcaattgtcaagtaagtctctattttctccagtagttcatttcagttgttactttgcgctttagaattttgaagttcacttttttcccagtatgcagtatatgaagcatttggtctcataatatcttcgtgttgttgagtatttcttcacttatgttttgtgattattttttttctgtttcttttttaattcttccgtatggctgtcttagactgttatttatataacaattaggaatatagatataatttgaagggaggtgagatttcatagtacagagtcccgggattccttctaaagtggaattattttgtgttataaggccctcgataacattttaacagtggatatggatcgtcttacagcagggataaatacatcttaatagagttaccttgtgcaacgtgacctccgagacggcatatcatctcgttattcattgcctttttgtatctgcctgttgggtttattcctgtctcggtttggtaatgcttgggggtttccctgttcactatcaaaagatttcccttcatggcacttgagggctgggagcaagaaggggaacaagtaatgaaggattatccttgggactacattgtgtggatcttggactatatttgagaatatagttgacatggtggtgaggaggattacatctcttatgtagtattttgatgtggtgtattggaagttggaagattttattaggtcggggtttgtgttgtctttcttatacgctttatagaatatgagagtatcccctatatatgggttcttctaatcattacaccttttttatttttcattatgaaatgtgaatcatttacatgtgaatcagaaagctttagtttgtacatttcttttatgattttaattgaatattacaaattttaagctgtttttgtgttaaagaaaggagatttgcagacatctaaatgatttatgtcgcagatatttgccatgtttcagaatctgttgtagcatttagctttcgtttttattgctctgaagatttatgtcgcagatatttgctatgttttggatctgttgtagcatttagctatcgttttatagttttgaagtggtttttgtatccattattaattttattgctctgaattacctcgttgtgttaactgttttctgatgagcaatttgctgcatccatccttaagctgtttccttcccatgtttggtaaatgtcatatttgtctacaatcctgatcaatatcacgcctaaggattaccttggggttggtcaggtggagttaatgggctatggtgtttttcacgggtaagcagataTtttgtgactaaagcacttagtcatttttctgttatctcttaaataacatgagtttctattttctgttccgatgcatgtaatccaataatccatagtggggatttgtttggtacaaatgattgtcaactgcccaatttttcatttttttgtccagtttattgttttgttttctcgtattggttttgtttttgtgatttaccaagcttcatatggtttggtgtgtattgtgcaactatgtttttgacatgactccttgtactttctacagtcagcaaagattgtttgcggttcaagtatttgagttgcatagactcattaaggtaagactaaatggatggattgtgtttgatttctttttgttgagaatgtacacacacgcgcgcatatcagttgacttagattggaaaaattagctgaataaaattcttttttgaacaggtccaacgactgattgctggatctccacatcttttgcttgaagatactgcttttctgggcacatctactttaaggggatccccggcaacaaaactctcatcagagtatgttgtaaagccactactacatgttgtaaagcgcaaacacgaacctgagaaAccaaacaacaaaatggaatgttctgcggaaaatgcagtagggaaaagccagtccttggtgtttccatatttaggaaatccacagccaactcctatggcttctgataaagccagtccttggtgtttccatcagtctcctggacatcaattgttaattccagtaatgtcgccttctgaaggacttgtgtacaagccgtataatggaccaggatttatgggagggccagtttgtggaggatgtggaccTtacggctcaactccgatgatgggcaactttgttaagccatcttacggggttccatctcatcatcttcaaggaatgggggttcttcctgtccctccatcactcaatggtcatacttactttcctccatatggcatgtcTgttatgaatcctgccatgccgagctcagcagttgaacaaatgcattggtttgctggacccgtttcccatggtcacaccgatcagtcatcgggagggggtgcaaactccaatttgcagcaccaaagctcatgcaacatgccccagaaaaatgtcaccattcctaacgccaaaaggcttcagccatctaatgacagtgggttacaaggaagtacagcaaataatacaggcgacagagccccaatgaggacggatcaaaatcctgaaggaagcgatgcgctccaacttttccccatggctccagtgattccagacggagttccccaatctcacgacataggccagccaatgcgagctataaaagttgtgcctcacaatccaagaactgcaactgcgtcggctgctcgaattttccagtccatacaagcagagagaaaacagcaggattcaacctag

Sequence listing

<110> Nanjing university of agriculture

<120> specific molecular marker of pear PbELF3b gene and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4169

<212> DNA

<213> Pyrus pyrifolia Nakai

<400> 1

atgaggaggg ggaacgagga gaaggttatg ggacctatgt tcccaaggct ccatgtgaat 60

gatgcagata aaggagggcc gagagctcct ccaagaaaca agatggccct ctatgagcag 120

ctgagcatcc catctcagag gttcaatcct ggggtgctgc ctttgaattc aaataaccag 180

gtaatttaat cataatttgt gcttactctt ttcttaatta tttgtttgga ttattttgaa 240

atgttattgc tttaaacttg tagttaggta atggattttc tcaggctttt tggttttttg 300

tttttgtagt agttaactgt aagtgttgtt ttatgctata ttgagtaatg ttgcatatga 360

ctatgtctat atgtcgtgtt ttaatggcta ttaattgtaa aaaaagaagt taaaatatgc 420

caagatagct actatttgca gcatgctgca attaagaggg aaaaaacaac ggtgtgttga 480

taaatagtgt tgcaagcttg tttagtatgg acggaaaatg attatcgcgt atctgaattt 540

tgggagcaat ttatgttttc aggggagtcg ttcagatgga aatttggctt ttccacttcg 600

tggtcgtaca tctacaccta ctcatcaggc tgtgatgttt catggtcgcc agtctgacag 660

agcaaatgta aacgtgccat ttgaacacac cgacctaaga aggaagatcg gagatgaaga 720

tgattttagt gttcctgtat ttgttcaatc aaggatgggt cttggtcaca gtaaaactcc 780

aattggtagt gaggaaaaac ttacttccat cagctcgcct cattctgacc atttagtaaa 840

agtaagaaac gtggggaaga aggatccaaa acaaataagc tccccaactc tgaatttaac 900

acgagaattg agaagtgaaa gagaagagga cctaatagaa gtaagcggtt cgagtaaggg 960

ccattcagga aaatttgccg caaaaatatc aaccatacaa aagattgatg ggcccgtaga 1020

agcgaatgca tcaccaaatc aagaggatgc agaatgttct gttccgagat tcaacaggtt 1080

agctgagagt gatgcttgct tacaacaaga gtctagatct gggtcacagc caaacgttac 1140

tggacaaggt gatggtcttg ttgagtcttc aagggatgta gagaagggaa ctctttccca 1200

ggaaaaaagt gtttcttgtt ctggggcgga tcctaccagt cccaatgacc ctgataatga 1260

cagcgaatac cgtggagaca gaaagtgtat ttcacttcaa atgggacatg tagacaaaag 1320

tgatgatgtc tcagagacct ccatggtgga ttctatatcc ggcatggaca tctctcctga 1380

tgatgttgta ggaataatag gccagaaaca tttctggaag gcaagaaaag caattgtcaa 1440

gtaagtctct attttctcca gtagttcatt tcagttgtta ctttgcgctt tagaattttg 1500

aagttcactt ttttcccagt atgcagtata tgaagcattt ggtctcataa tatcttcgtg 1560

ttgttgagta tttcttcact tatgttttgt gattattttt tttctgtttc ttttttaatt 1620

cttccgtatg gctgtcttag actgttattt atataacaat taggaatata gatataattt 1680

gaagggaggt gagatttcat agtacagagt cccgggattc cttctaaagt ggaattattt 1740

tgtgttataa ggccctcgat aacattttaa cagtggatat ggatcgtctt acagcaggga 1800

taaatacatc ttaatagagt taccttgtgc aacgtgacct ccgagacggc atatcatctc 1860

gttattcatt gcctttttgt atctgcctgt tgggtttatt cctgtctcgg tttggtaatg 1920

cttgggggtt tccctgttca ctatcaaaag atttcccttc atggcacttg agggctggga 1980

gcaagaaggg gaacaagtaa tgaaggatta tccttgggac tacattgtgt ggatcttgga 2040

ctatatttga gaatatagtt gacatggtgg tgaggaggat tacatctctt atgtagtatt 2100

ttgatgtggt gtattggaag ttggaagatt ttattaggtc ggggtttgtg ttgtctttct 2160

tatacgcttt atagaatatg agagtatccc ctatatatgg gttcttctaa tcattacacc 2220

ttttttattt ttcattatga aatgtgaatc atttacatgt gaatcagaaa gctttagttt 2280

gtacatttct tttatgattt taattgaata ttacaaattt taagctgttt ttgtgttaaa 2340

gaaaggagat ttgcagacat ctaaatgatt tatgtcgcag atatttgcca tgtttcagaa 2400

tctgttgtag catttagctt tcgtttttat tgctctgaag atttatgtcg cagatatttg 2460

ctatgttttg gatctgttgt agcatttagc tatcgtttta tagttttgaa gtggtttttg 2520

tatccattat taattttatt gctctgaatt acctcgttgt gttaactgtt ttctgatgag 2580

caatttgctg catccatcct taagctgttt ccttcccatg tttggtaaat gtcatatttg 2640

tctacaatcc tgatcaatat cacgcctaag gattaccttg gggttggtca ggtggagtta 2700

atgggctatg gtgtttttca cgggtaagca gatactttgt gactaaagca cttagtcatt 2760

tttctgttat ctcttaaata acatgagttt ctattttctg ttccgatgca tgtaatccaa 2820

taatccatag tggggatttg tttggtacaa atgattgtca actgcccaat ttttcatttt 2880

tttgtccagt ttattgtttt gttttctcgt attggttttg tttttgtgat ttaccaagct 2940

tcatatggtt tggtgtgtat tgtgcaacta tgtttttgac atgactcctt gtactttcta 3000

cagtcagcaa agattgtttg cggttcaagt atttgagttg catagactca ttaaggtaag 3060

actaaatgga tggattgtgt ttgatttctt tttgttgaga atgtacacac acgcgcgcat 3120

atcagttgac ttagattgga aaaattagct gaataaaatt cttttttgaa caggtccaac 3180

gactgattgc tggatctcca catcttttgc ttgaagatac tgcttttctg ggcacatcta 3240

ctttaagggg atccccggca acaaaactct catcagagta tgttgtaaag ccactactac 3300

atgttgtaaa gcgcaaacac gaacctgaga agccaaacaa caaaatggaa tgttctgcgg 3360

aaaatgcagt agggaaaagc cagtccttgg tgtttccata tttaggaaat ccacagccaa 3420

ctcctatggc ttctgataaa gccagtcctt ggtgtttcca tcagtctcct ggacatcaat 3480

tgttaattcc agtaatgtcg ccttctgaag gacttgtgta caagccgtat aatggaccag 3540

gatttatggg agggccagtt tgtggaggat gtggacccta cggctcaact ccgatgatgg 3600

gcaactttgt taagccatct tacggggttc catctcatca tcttcaagga atgggggttc 3660

ttcctgtccc tccatcactc aatggtcata cttactttcc tccatatggc atgtccgtta 3720

tgaatcctgc catgccgagc tcagcagttg aacaaatgca ttggtttgct ggacccgttt 3780

cccatggtca caccgatcag tcatcgggag ggggtgcaaa ctccaatttg cagcaccaaa 3840

gctcatgcaa catgccccag aaaaatgtca ccattcctaa cgccaaaagg cttcagccat 3900

ctaatgacag tgggttacaa ggaagtacag caaataatac aggcgacaga gccccaatga 3960

ggacggatca aaatcctgaa ggaagcgatg cgctccaact tttccccatg gctccagtga 4020

ttccagacgg agttccccaa tctcacgaca taggccagcc aatgcgagct ataaaagttg 4080

tgcctcacaa tccaagaact gcaactgcgt cggctgctcg aattttccag tccatacaag 4140

cagagagaaa acagcaggat tcaacctag 4169

<210> 2

<211> 4111

<212> DNA

<213> Sinkiang pear (Pyrus sinkiangensis T.T. Yu)

<400> 2

atgaggaggg ggaacgagga gaaggttatg ggacctatgt tcccaaggct ccatgtgaat 60

gatgcagata aaggagggcc gagagctcct ccaagaaaca agatggccct ctatgagcag 120

ctgagcatcc catctcagag gttcaatcct ggggtgctgc ctttgaattc aaataaccag 180

gtaatttaat cataatttgt gcttactctt ttcttaatta tttgtttgga ttattttgaa 240

atgttattgc tttaaacttg tagttaggta atggattttc tcaggctttt tggttttttg 300

tttttgtagt agttaactgt aagtgttgtt ttatgctata ttgagtaatg ttgcatatga 360

ctatgtctat atgtcgtgtt ttaatggcta ttaattgtaa aaaaagaagt taaaatatgc 420

caagatagct actatttgca gcatgctgca attaagaggg aaaaaacaac ggtgtgttga 480

taaatagtgt tgcaagcttg tttagtatgg acggaaaatg attatcgcat atctgaattt 540

tgggagcaat ttatgttttc aggggagtcg ttcagatgga aatttggctt ttccacttcg 600

tggtcgtaca tctacaccta ctcatcaggc tgtgatgttt catggtcgcc agtctgacag 660

agcaaatgta aacgtgccat ttgaacacac cgacctaaga aggaagatcg gagatgaaga 720

tgattttagt gttcctgtat ttgttcaatc aaggatgggt cttggtcaca gtaaaactcc 780

aattggtagt gaggaaaaac ttacttccat cagctcgcct cattctgacc atttagtaaa 840

agtaagaaac gtggggaaga aggatccaaa acaaataagc tccccaactc tgaatttaac 900

acgagaattg agaagtgaaa gagaagagga cctaatagaa gtaagcggtt cgagtaaggg 960

ccattcagga aaatttgccg caaaaatatc aaccatacaa aagattgatg ggcccgtaga 1020

agcgaatgca tcaccaaatc aagaggatgc agaatgttct gttccgagat tcaacaggtt 1080

agctgagagt gatgcttgct tacaacaaga gtctagatct gggtcacagc caaacgttac 1140

tggacaaggt gatggtcttg ttgagtcttc aagggatgta gagaagggaa ctctttccca 1200

ggaaaaaagt gtttcttgtt ctggggcgga tcctaccagt cccaatgacc ctgataatga 1260

cagcgaatac cgtggagaca gaaagtgtat ttcacttcaa atgggacatg tagacaaaag 1320

tgatgatgtc tcagagacct ccatggtgga ttctatatcc ggcatggaca tctctcctga 1380

tgatgttgta ggaataatag gccagaaaca tttctggaag gcaagaaaag caattgtcaa 1440

gtaagtctct attttctcca gtagttcatt tcagttgtta ctttgcgctt tagaattttg 1500

aagttcactt ttttcccagt atgcagtata tgaagcattt ggtctcataa tatcttcgtg 1560

ttgttgagta tttcttcact tatgttttgt gattattttt tttctgtttc ttttttaatt 1620

cttccgtatg gctgtcttag actgttattt atataacaat taggaatata gatataattt 1680

gaagggaggt gagatttcat agtacagagt cccgggattc cttctaaagt ggaattattt 1740

tgtgttataa ggccctcgat aacattttaa cagtggatat ggatcgtctt acagcaggga 1800

taaatacatc ttaatagagt taccttgtgc aacgtgacct ccgagacggc atatcatctc 1860

gttattcatt gcctttttgt atctgcctgt tgggtttatt cctgtctcgg tttggtaatg 1920

cttgggggtt tccctgttca ctatcaaaag atttcccttc atggcacttg agggctggga 1980

gcaagaaggg gaacaagtaa tgaaggatta tccttgggac tacattgtgt ggatcttgga 2040

ctatatttga gaatatagtt gacatggtgg tgaggaggat tacatctctt atgtagtatt 2100

ttgatgtggt gtattggaag ttggaagatt ttattaggtc ggggtttgtg ttgtctttct 2160

tatacgcttt atagaatatg agagtatccc ctatatatgg gttcttctaa tcattacacc 2220

ttttttattt ttcattatga aatgtgaatc atttacatgt gaatcagaaa gctttagttt 2280

gtacatttct tttatgattt taattgaata ttacaaattt taagctgttt ttgtgttaaa 2340

gaaaggagat ttgcagacat ctaaatgatt tatgtcgcag atatttgcca tgtttcagaa 2400

tctgttgtag catttagctt tcgtttttat tgctctgaag atttatgtcg cagatatttg 2460

ctatgttttg gatctgttgt agcatttagc tatcgtttta tagttttgaa gtggtttttg 2520

tatccattat taattttatt gctctgaatt acctcgttgt gttaactgtt ttctgatgag 2580

caatttgctg catccatcct taagctgttt ccttcccatg tttggtaaat gtcatatttg 2640

tctacaatcc tgatcaatat cacgcctaag cagatatttt gtgactaaag cacttagtca 2700

tttttctgtt atctcttaaa taacatgagt ttctattttc tgttccgatg catgtaatcc 2760

aataatccat agtggggatt tgtttggtac aaatgattgt caactgccca atttttcatt 2820

tttttgtcca gtttattgtt ttgttttctc gtattggttt tgtttttgtg atttaccaag 2880

cttcatatgg tttggtgtgt attgtgcaac tatgtttttg acatgactcc ttgtactttc 2940

tacagtcagc aaagattgtt tgcggttcaa gtatttgagt tgcatagact cattaaggta 3000

agactaaatg gatggattgt gtttgatttc tttttgttga gaatgtacac acacgcgcgc 3060

atatcagttg acttagattg gaaaaattag ctgaataaaa ttcttttttg aacaggtcca 3120

acgactgatt gctggatctc cacatctttt gcttgaagat actgcttttc tgggcacatc 3180

tactttaagg ggatccccgg caacaaaact ctcatcagag tatgttgtaa agccactact 3240

acatgttgta aagcgcaaac acgaacctga gaaaccaaac aacaaaatgg aatgttctgc 3300

ggaaaatgca gtagggaaaa gccagtcctt ggtgtttcca tatttaggaa atccacagcc 3360

aactcctatg gcttctgata aagccagtcc ttggtgtttc catcagtctc ctggacatca 3420

attgttaatt ccagtaatgt cgccttctga aggacttgtg tacaagccgt ataatggacc 3480

aggatttatg ggagggccag tttgtggagg atgtggacct tacggctcaa ctccgatgat 3540

gggcaacttt gttaagccat cttacggggt tccatctcat catcttcaag gaatgggggt 3600

tcttcctgtc cctccatcac tcaatggtca tacttacttt cctccatatg gcatgtctgt 3660

tatgaatcct gccatgccga gctcagcagt tgaacaaatg cattggtttg ctggacccgt 3720

ttcccatggt cacaccgatc agtcatcggg agggggtgca aactccaatt tgcagcacca 3780

aagctcatgc aacatgcccc agaaaaatgt caccattcct aacgccaaaa ggcttcagcc 3840

atctaatgac agtgggttac aaggaagtac agcaaataat acaggcgaca gagccccaat 3900

gaggacggat caaaatcctg aaggaagcga tgcgctccaa cttttcccca tggctccagt 3960

gattccagac ggagttcccc aatctcacga cataggccag ccaatgcgag ctataaaagt 4020

tgtgcctcac aatccaagaa ctgcaactgc gtcggctgct cgaattttcc agtccataca 4080

agcagagaga aaacagcagg attcaaccta g 4111

<210> 3

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gattaccttg gggttggtca ggtggagtta atgggctatg gtgtttttca cgggtaag 58

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcgttgtgtt aactgttttc tg 22

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccaaacaaat ccccactatg 20

<210> 6

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gagaacacgg gggactctag aatgaggagg gggaacgag 39

<210> 7

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcccttgctc accatggatc cggttgaatc ctgctgtttt ctc 43

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgtcgtcctt gaagaagatg 20

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

agtatctgct taggcgtgat attgatcagg a 31

<210> 10

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgcctaagca gatactttgt gactaaagca cttag 35

<210> 11

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agcccattaa ctccacctga ccaaccccaa ggtaatcctt aggcgtgata ttgatcagga 60

t 61

<210> 12

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gtggagttaa tgggctatgg tgtttttcac gggtaagcag atactttgtg actaaagcac 60

ttagtc 66

<210> 13

<211> 4111

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atgaggaggg ggaacgagga gaaggttatg ggacctatgt tcccaaggct ccatgtgaat 60

gatgcagata aaggagggcc gagagctcct ccaagaaaca agatggccct ctatgagcag 120

ctgagcatcc catctcagag gttcaatcct ggggtgctgc ctttgaattc aaataaccag 180

gtaatttaat cataatttgt gcttactctt ttcttaatta tttgtttgga ttattttgaa 240

atgttattgc tttaaacttg tagttaggta atggattttc tcaggctttt tggttttttg 300

tttttgtagt agttaactgt aagtgttgtt ttatgctata ttgagtaatg ttgcatatga 360

ctatgtctat atgtcgtgtt ttaatggcta ttaattgtaa aaaaagaagt taaaatatgc 420

caagatagct actatttgca gcatgctgca attaagaggg aaaaaacaac ggtgtgttga 480

taaatagtgt tgcaagcttg tttagtatgg acggaaaatg attatcgcgt atctgaattt 540

tgggagcaat ttatgttttc aggggagtcg ttcagatgga aatttggctt ttccacttcg 600

tggtcgtaca tctacaccta ctcatcaggc tgtgatgttt catggtcgcc agtctgacag 660

agcaaatgta aacgtgccat ttgaacacac cgacctaaga aggaagatcg gagatgaaga 720

tgattttagt gttcctgtat ttgttcaatc aaggatgggt cttggtcaca gtaaaactcc 780

aattggtagt gaggaaaaac ttacttccat cagctcgcct cattctgacc atttagtaaa 840

agtaagaaac gtggggaaga aggatccaaa acaaataagc tccccaactc tgaatttaac 900

acgagaattg agaagtgaaa gagaagagga cctaatagaa gtaagcggtt cgagtaaggg 960

ccattcagga aaatttgccg caaaaatatc aaccatacaa aagattgatg ggcccgtaga 1020

agcgaatgca tcaccaaatc aagaggatgc agaatgttct gttccgagat tcaacaggtt 1080

agctgagagt gatgcttgct tacaacaaga gtctagatct gggtcacagc caaacgttac 1140

tggacaaggt gatggtcttg ttgagtcttc aagggatgta gagaagggaa ctctttccca 1200

ggaaaaaagt gtttcttgtt ctggggcgga tcctaccagt cccaatgacc ctgataatga 1260

cagcgaatac cgtggagaca gaaagtgtat ttcacttcaa atgggacatg tagacaaaag 1320

tgatgatgtc tcagagacct ccatggtgga ttctatatcc ggcatggaca tctctcctga 1380

tgatgttgta ggaataatag gccagaaaca tttctggaag gcaagaaaag caattgtcaa 1440

gtaagtctct attttctcca gtagttcatt tcagttgtta ctttgcgctt tagaattttg 1500

aagttcactt ttttcccagt atgcagtata tgaagcattt ggtctcataa tatcttcgtg 1560

ttgttgagta tttcttcact tatgttttgt gattattttt tttctgtttc ttttttaatt 1620

cttccgtatg gctgtcttag actgttattt atataacaat taggaatata gatataattt 1680

gaagggaggt gagatttcat agtacagagt cccgggattc cttctaaagt ggaattattt 1740

tgtgttataa ggccctcgat aacattttaa cagtggatat ggatcgtctt acagcaggga 1800

taaatacatc ttaatagagt taccttgtgc aacgtgacct ccgagacggc atatcatctc 1860

gttattcatt gcctttttgt atctgcctgt tgggtttatt cctgtctcgg tttggtaatg 1920

cttgggggtt tccctgttca ctatcaaaag atttcccttc atggcacttg agggctggga 1980

gcaagaaggg gaacaagtaa tgaaggatta tccttgggac tacattgtgt ggatcttgga 2040

ctatatttga gaatatagtt gacatggtgg tgaggaggat tacatctctt atgtagtatt 2100

ttgatgtggt gtattggaag ttggaagatt ttattaggtc ggggtttgtg ttgtctttct 2160

tatacgcttt atagaatatg agagtatccc ctatatatgg gttcttctaa tcattacacc 2220

ttttttattt ttcattatga aatgtgaatc atttacatgt gaatcagaaa gctttagttt 2280

gtacatttct tttatgattt taattgaata ttacaaattt taagctgttt ttgtgttaaa 2340

gaaaggagat ttgcagacat ctaaatgatt tatgtcgcag atatttgcca tgtttcagaa 2400

tctgttgtag catttagctt tcgtttttat tgctctgaag atttatgtcg cagatatttg 2460

ctatgttttg gatctgttgt agcatttagc tatcgtttta tagttttgaa gtggtttttg 2520

tatccattat taattttatt gctctgaatt acctcgttgt gttaactgtt ttctgatgag 2580

caatttgctg catccatcct taagctgttt ccttcccatg tttggtaaat gtcatatttg 2640

tctacaatcc tgatcaatat cacgcctaag cagatacttt gtgactaaag cacttagtca 2700

tttttctgtt atctcttaaa taacatgagt ttctattttc tgttccgatg catgtaatcc 2760

aataatccat agtggggatt tgtttggtac aaatgattgt caactgccca atttttcatt 2820

tttttgtcca gtttattgtt ttgttttctc gtattggttt tgtttttgtg atttaccaag 2880

cttcatatgg tttggtgtgt attgtgcaac tatgtttttg acatgactcc ttgtactttc 2940

tacagtcagc aaagattgtt tgcggttcaa gtatttgagt tgcatagact cattaaggta 3000

agactaaatg gatggattgt gtttgatttc tttttgttga gaatgtacac acacgcgcgc 3060

atatcagttg acttagattg gaaaaattag ctgaataaaa ttcttttttg aacaggtcca 3120

acgactgatt gctggatctc cacatctttt gcttgaagat actgcttttc tgggcacatc 3180

tactttaagg ggatccccgg caacaaaact ctcatcagag tatgttgtaa agccactact 3240

acatgttgta aagcgcaaac acgaacctga gaagccaaac aacaaaatgg aatgttctgc 3300

ggaaaatgca gtagggaaaa gccagtcctt ggtgtttcca tatttaggaa atccacagcc 3360

aactcctatg gcttctgata aagccagtcc ttggtgtttc catcagtctc ctggacatca 3420

attgttaatt ccagtaatgt cgccttctga aggacttgtg tacaagccgt ataatggacc 3480

aggatttatg ggagggccag tttgtggagg atgtggaccc tacggctcaa ctccgatgat 3540

gggcaacttt gttaagccat cttacggggt tccatctcat catcttcaag gaatgggggt 3600

tcttcctgtc cctccatcac tcaatggtca tacttacttt cctccatatg gcatgtccgt 3660

tatgaatcct gccatgccga gctcagcagt tgaacaaatg cattggtttg ctggacccgt 3720

ttcccatggt cacaccgatc agtcatcggg agggggtgca aactccaatt tgcagcacca 3780

aagctcatgc aacatgcccc agaaaaatgt caccattcct aacgccaaaa ggcttcagcc 3840

atctaatgac agtgggttac aaggaagtac agcaaataat acaggcgaca gagccccaat 3900

gaggacggat caaaatcctg aaggaagcga tgcgctccaa cttttcccca tggctccagt 3960

gattccagac ggagttcccc aatctcacga cataggccag ccaatgcgag ctataaaagt 4020

tgtgcctcac aatccaagaa ctgcaactgc gtcggctgct cgaattttcc agtccataca 4080

agcagagaga aaacagcagg attcaaccta g 4111

<210> 14

<211> 4169

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

atgaggaggg ggaacgagga gaaggttatg ggacctatgt tcccaaggct ccatgtgaat 60

gatgcagata aaggagggcc gagagctcct ccaagaaaca agatggccct ctatgagcag 120

ctgagcatcc catctcagag gttcaatcct ggggtgctgc ctttgaattc aaataaccag 180

gtaatttaat cataatttgt gcttactctt ttcttaatta tttgtttgga ttattttgaa 240

atgttattgc tttaaacttg tagttaggta atggattttc tcaggctttt tggttttttg 300

tttttgtagt agttaactgt aagtgttgtt ttatgctata ttgagtaatg ttgcatatga 360

ctatgtctat atgtcgtgtt ttaatggcta ttaattgtaa aaaaagaagt taaaatatgc 420

caagatagct actatttgca gcatgctgca attaagaggg aaaaaacaac ggtgtgttga 480

taaatagtgt tgcaagcttg tttagtatgg acggaaaatg attatcgcat atctgaattt 540

tgggagcaat ttatgttttc aggggagtcg ttcagatgga aatttggctt ttccacttcg 600

tggtcgtaca tctacaccta ctcatcaggc tgtgatgttt catggtcgcc agtctgacag 660

agcaaatgta aacgtgccat ttgaacacac cgacctaaga aggaagatcg gagatgaaga 720

tgattttagt gttcctgtat ttgttcaatc aaggatgggt cttggtcaca gtaaaactcc 780

aattggtagt gaggaaaaac ttacttccat cagctcgcct cattctgacc atttagtaaa 840

agtaagaaac gtggggaaga aggatccaaa acaaataagc tccccaactc tgaatttaac 900

acgagaattg agaagtgaaa gagaagagga cctaatagaa gtaagcggtt cgagtaaggg 960

ccattcagga aaatttgccg caaaaatatc aaccatacaa aagattgatg ggcccgtaga 1020

agcgaatgca tcaccaaatc aagaggatgc agaatgttct gttccgagat tcaacaggtt 1080

agctgagagt gatgcttgct tacaacaaga gtctagatct gggtcacagc caaacgttac 1140

tggacaaggt gatggtcttg ttgagtcttc aagggatgta gagaagggaa ctctttccca 1200

ggaaaaaagt gtttcttgtt ctggggcgga tcctaccagt cccaatgacc ctgataatga 1260

cagcgaatac cgtggagaca gaaagtgtat ttcacttcaa atgggacatg tagacaaaag 1320

tgatgatgtc tcagagacct ccatggtgga ttctatatcc ggcatggaca tctctcctga 1380

tgatgttgta ggaataatag gccagaaaca tttctggaag gcaagaaaag caattgtcaa 1440

gtaagtctct attttctcca gtagttcatt tcagttgtta ctttgcgctt tagaattttg 1500

aagttcactt ttttcccagt atgcagtata tgaagcattt ggtctcataa tatcttcgtg 1560

ttgttgagta tttcttcact tatgttttgt gattattttt tttctgtttc ttttttaatt 1620

cttccgtatg gctgtcttag actgttattt atataacaat taggaatata gatataattt 1680

gaagggaggt gagatttcat agtacagagt cccgggattc cttctaaagt ggaattattt 1740

tgtgttataa ggccctcgat aacattttaa cagtggatat ggatcgtctt acagcaggga 1800

taaatacatc ttaatagagt taccttgtgc aacgtgacct ccgagacggc atatcatctc 1860

gttattcatt gcctttttgt atctgcctgt tgggtttatt cctgtctcgg tttggtaatg 1920

cttgggggtt tccctgttca ctatcaaaag atttcccttc atggcacttg agggctggga 1980

gcaagaaggg gaacaagtaa tgaaggatta tccttgggac tacattgtgt ggatcttgga 2040

ctatatttga gaatatagtt gacatggtgg tgaggaggat tacatctctt atgtagtatt 2100

ttgatgtggt gtattggaag ttggaagatt ttattaggtc ggggtttgtg ttgtctttct 2160

tatacgcttt atagaatatg agagtatccc ctatatatgg gttcttctaa tcattacacc 2220

ttttttattt ttcattatga aatgtgaatc atttacatgt gaatcagaaa gctttagttt 2280

gtacatttct tttatgattt taattgaata ttacaaattt taagctgttt ttgtgttaaa 2340

gaaaggagat ttgcagacat ctaaatgatt tatgtcgcag atatttgcca tgtttcagaa 2400

tctgttgtag catttagctt tcgtttttat tgctctgaag atttatgtcg cagatatttg 2460

ctatgttttg gatctgttgt agcatttagc tatcgtttta tagttttgaa gtggtttttg 2520

tatccattat taattttatt gctctgaatt acctcgttgt gttaactgtt ttctgatgag 2580

caatttgctg catccatcct taagctgttt ccttcccatg tttggtaaat gtcatatttg 2640

tctacaatcc tgatcaatat cacgcctaag gattaccttg gggttggtca ggtggagtta 2700

atgggctatg gtgtttttca cgggtaagca gatattttgt gactaaagca cttagtcatt 2760

tttctgttat ctcttaaata acatgagttt ctattttctg ttccgatgca tgtaatccaa 2820

taatccatag tggggatttg tttggtacaa atgattgtca actgcccaat ttttcatttt 2880

tttgtccagt ttattgtttt gttttctcgt attggttttg tttttgtgat ttaccaagct 2940

tcatatggtt tggtgtgtat tgtgcaacta tgtttttgac atgactcctt gtactttcta 3000

cagtcagcaa agattgtttg cggttcaagt atttgagttg catagactca ttaaggtaag 3060

actaaatgga tggattgtgt ttgatttctt tttgttgaga atgtacacac acgcgcgcat 3120

atcagttgac ttagattgga aaaattagct gaataaaatt cttttttgaa caggtccaac 3180

gactgattgc tggatctcca catcttttgc ttgaagatac tgcttttctg ggcacatcta 3240

ctttaagggg atccccggca acaaaactct catcagagta tgttgtaaag ccactactac 3300

atgttgtaaa gcgcaaacac gaacctgaga aaccaaacaa caaaatggaa tgttctgcgg 3360

aaaatgcagt agggaaaagc cagtccttgg tgtttccata tttaggaaat ccacagccaa 3420

ctcctatggc ttctgataaa gccagtcctt ggtgtttcca tcagtctcct ggacatcaat 3480

tgttaattcc agtaatgtcg ccttctgaag gacttgtgta caagccgtat aatggaccag 3540

gatttatggg agggccagtt tgtggaggat gtggacctta cggctcaact ccgatgatgg 3600

gcaactttgt taagccatct tacggggttc catctcatca tcttcaagga atgggggttc 3660

ttcctgtccc tccatcactc aatggtcata cttactttcc tccatatggc atgtctgtta 3720

tgaatcctgc catgccgagc tcagcagttg aacaaatgca ttggtttgct ggacccgttt 3780

cccatggtca caccgatcag tcatcgggag ggggtgcaaa ctccaatttg cagcaccaaa 3840

gctcatgcaa catgccccag aaaaatgtca ccattcctaa cgccaaaagg cttcagccat 3900

ctaatgacag tgggttacaa ggaagtacag caaataatac aggcgacaga gccccaatga 3960

ggacggatca aaatcctgaa ggaagcgatg cgctccaact tttccccatg gctccagtga 4020

ttccagacgg agttccccaa tctcacgaca taggccagcc aatgcgagct ataaaagttg 4080

tgcctcacaa tccaagaact gcaactgcgt cggctgctcg aattttccag tccatacaag 4140

cagagagaaa acagcaggat tcaacctag 4169

Claims (12)

1. A functional gene PbELF3b (N type) with the character of delaying plant flowering, which is separated and cloned from Chinese pear, and the genome DNA sequence is shown in sequence table SEQ ID No. 1.

2. A functional gene PbELF3b (D type) with the character of delaying plant flowering, which is separated and cloned from Xinjiang pear, and the genome DNA sequence is shown in the sequence table SEQ ID No. 2.

3. Primer pair for amplifying the full-length sequence of the pear PbELF3b gene according to claim 1 or 2, wherein the DNA sequence of the primer pair is shown as SEQ ID No.6 and SEQ ID No. 7.

4. An InDel molecular marker related to pear flower bud differentiation and development is characterized in that the InDel molecular marker sequence is shown as SEQ ID No.3, and the flowering characters of plants can be influenced by the existence or deletion of the InDel molecular marker sequence on a pear PbELF3b genome intron.

5. The InDel molecular marker primer related to pear flower bud differentiation and development according to claim 4, wherein the sequence of the forward primer PbELF3b-InDel-F is tcgttgtgttaactgttttctg, and the sequence of the reverse primer PbELF3b-InDel-R is ccaaacaaatccccactatg.

6. The use of the molecular marker as claimed in claim 4 or the primer of the molecular marker as claimed in claim 5 for detecting the differentiation and development of pear flower buds or for assisting in breeding new pear varieties.

7. A PbELF3b (N-d type) gene modified by a pear PbELF3b (N type) functional gene has a nucleotide sequence shown in a sequence table SEQ ID No. 13.

8. A PbELF3b (D + D type) gene modified by using Xinjiang pear PbELF3b (D type) functional gene has a nucleotide sequence shown in a sequence table SEQ ID No. 14.

9. The primer pair for amplifying the full-length sequence of the PbELF3b gene of claim 7 or 8, wherein the primer pair for amplifying the N-d type PbELF3b gene in the modified Pyrus pyrifolia is shown as SEQ ID NO. 9 and SEQ ID NO. 10;

the primer pair for amplifying the D + D type PbELF3b gene in the modified Xinjiang pear is shown as SEQ ID NO. 11 and SEQ ID NO. 12.

10. An engineered bacterium containing a recombinant vector and a vector of the gene of claim 1, 2, 7 or 8.

11. Use of the gene of claim 1, 2, 7 or 8 for delaying flowering in a plant.

12. The use according to claim 11, wherein the engineered bacterium of claim 10 is infected into a plant to obtain a transgenic plant with delayed flowering.