CN107556373A

CN107556373A - Incise gene order and its application of the main fat drips albumen of edge green alga

Info

Publication number: CN107556373A
Application number: CN201710997275.0A
Authority: CN
Inventors: 周志刚; 许奇慧
Original assignee: Shanghai Maritime University
Current assignee: Shanghai Maritime University
Priority date: 2017-10-24
Filing date: 2017-10-24
Publication date: 2018-01-09
Anticipated expiration: 2037-10-24
Also published as: CN107556373B

Abstract

The present invention relates to the gene order for incising the main fat drips albumen of edge green alga and its application.The present invention obtains a kind of gene order of main fat drips albumen from incising in edge green alga, tested by gene overexpression and find that the gene coded protein is positively located in the fat drips of yeast cells, so as to confirm that the gene participates in the function that fat drips are formed, further confirm that it has the ability for improving Accu-mulation by Yeast Cells or storing triacylglycerol further through thin-layer chromatographic analysis.Therefore, it is of the invention to incise the main fat drips albumen of edge green alga and its gene order and be applied to Biological Energy Industry, to increase grease yield.

Description

Incise gene order and its application of the main fat drips albumen of edge green alga

Technical field

The present invention relates to bioenergy and plant biotechnology field, specifically, is related to and incises the main fat drips of edge green alga The gene order of albumen (major lipid droplet protein, MLDP) and its application.

Background technology

The energy is the basis of human social development.The whole world is faced with energy crisis at present, and petroleum resources are in short supply, and Recyclability makes the exploitation of bioenergy increasingly be paid close attention to by society.Microalgae biodiesel do not striven with it with people grain, not with The unique advantage that grain strives ground, does not strive material with poultry has attracted the concerns of more and more researchers.Make to improve various oil plants The oil production of thing, fat drips and fat drips associated proteins (protein associated lipid droplet) are increasingly becoming plant The goal in research of biotechnology.The ability of different types of microalgae accumulation fat drips is different, the eucaryon microalgae such as its green algae, diatom Fat content is higher, promises to be the production algae kind of biodiesel.Edge green alga (Myrmecia is incised in this laboratory research Incisa Reisigl H4301) it is a kind of unicellular microalgae of fresh water, it is subordinate to Chlorophyta (Chlorophyta).The algae can be a large amount of Triacylglycerol (TAG) is accumulated, especially under the conditions of nitrogen stress, these TAG are wrapped in half elementary membrane to be existed in the form of fat drips It is potential microalgae biodiesel algae kind in cell.

The fat drips (lipid droplet, LD) of cell be also referred to as oil body (oil body, OB) or liposome (lipid body, LB), they will provide the carbon source stored and energy by the following growth of cell.Fat drips are the main of intracellular neutral fats storage Place, it is made up of polarity list phospholipid layer parcel hydrophobic core.Proteomics research in recent years shows that fat drips surface is also present Many functional proteins, the metabolism and transhipment of intracellular matter may be participated in by further disclosing fat drips, and cell signal passes The process such as lead, be the vigorous multi-functional organelle of an activity.

Patent document CN103965306A, publication date 2014.08.06, disclose a kind of oleaginous yeast fat drips albumen and its Encoding gene and application.Inventor identifies oleaginous yeast rhodotorula glutinis by fat drips proteomics research A kind of novel all fat element sample albumen high abundances expression during (Rhodotorula glutinis) oil and fat accumulation, and find the egg White abundance is directly proportional to fat content, be named as RgLDP1 (R.glutinis lipid droplet protein 1, Rhodotorula glutinis fat drips albumen 1), green fluorescent protein common location and the oil fermentation analytical proof gene and oleaginous microorganism grease Accumulation, storing are closely related with metabolic regulation, can significantly improve cell grease accumulation and storage capacity.

However, it yet there are no the related report for incising the main fat drips albumen of edge green alga that can significantly improve synthesis TAG functions Road.

The content of the invention

The purpose of the present invention is to be directed to deficiency of the prior art, there is provided a kind of base for incising the main fat drips albumen of edge green alga Because of sequence and its application.

In a first aspect, the invention provides a kind of polypeptide, the amino acid sequence such as SEQ ID NO.11 institutes of described polypeptide Show.

Second aspect, the invention provides a kind of nucleotide sequence of separation, described nucleotide sequence includes：

A) nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.10；Or

B) the complementary nucleotide sequence of nucleotide sequence described in and a).

The third aspect, the invention provides a kind of recombinant expression carrier, described recombinant expression carrier is by as described above Nucleotide sequence and plasmid or virus constructed by recombinant expression carrier.

As a preference, described plasmid is pYES2 plasmids.

Fourth aspect, the invention provides a kind of genetically engineered host cell, described host cell is selected from down One kind in row：

A) host cell for being converted or being transduceed with nucleotide sequence as described above；

B) host cell for being converted or being transduceed with recombinant expression carrier as described above.

As a preference, described host cell is bacterial cell or fungal cell.

As a preference, described host cell is yeast cells.

5th aspect, the invention provides polypeptide as described above, nucleotide sequence as described above, weight as described above Group expression vector and purposes of the host cell in grease yield is increased as described above.

As a preference, described increase grease yield refers to increase triacylglycerol yield.

The invention has the advantages that：

1st, the present invention has screened one and known main fat in the high-throughout sequencing data of edge green alga transcript profile is incised Drop albumen has the long 1508bp of certain similitude fragment.Primer is designed based on the fragment sequence and quickly expanded using cDNA ends Increase the full length cDNA sequence that (RACE) technology is cloned into the gene, determine that the gene is main fat drips albumen base by homologous compare Because of family, this is named as MiMLDP.By in eucaryon model organism yeast BY4741 bacterial strains with enhanced yellow fluorescence egg (eYFP) amalgamation and expression gene in vain, i.e. gene overexpression are tested, it is found that the gene coded protein is positively located in yeast cells Fat drips on, so as to confirm gene chemical synthesis TAG function.Further through thin-layer chromatographic analysis, it was demonstrated that it, which has, improves yeast Cellular Accumulation or the ability for storing TAG.Based on this, the invention provides one kind to incise the main fat drips albumen of edge green alga, its gene Sequence and their purposes, the gene or albumen are overexpressed in grain and oil crop can increase the stability of fat drips, can cause fat drips Formation to increase grease yield.

2nd, the ability for incising the main fat drips albumen raising TAG synthesis of edge green alga of the invention is very prominent, is significantly better than this Invent other albumen of seminar's synchronized detection.

To sum up, the present invention has broad application prospects in Biological Energy Industry.

Brief description of the drawings

Fig. 1 incise edge green alga MiMLDP gene structure display.Grey lines are non-translational regions, and black line is introne, Black box is extron.

The fluorescence picture of Fig. 2 yeast cells.Yeast strain BY4741 is followed successively by from top to bottom, turns to carry eYFP carriers (pY-eYFP) BY4741 bacterial strains, turn to carry the eYFP fusion expression vectors (pY-MiMLDP-eYFP) of target gene BY4741 bacterial strains.Bright is light field figure, and Yellow is the yellow fluorescence protein signal graph of eYFP transmittings, and Red is Nile Red The red fluorescent figure launched after dyeing, Merged are the stacking chart of above three width figures.

Fig. 3 analyze yeast lipid with thin layer chromatography (TLC).Swimming lane from left to right is respectively to turn to carry purpose base The BY4741 bacterial strains of the eYFP fusion expression vectors (pY-MiMLDP-eYFP) of cause, turn to carry eYFP carriers (pY-eYFP) BY4741 bacterial strains, yeast strain BY4741, TAG standard (Avanti, the U.S.).

Embodiment

Embodiment provided by the invention is elaborated below in conjunction with the accompanying drawings.

Embodiment 1

Used primary operational route includes：

1) temperature be 25 DEG C, intensity of illumination be 115 μm of ol photonsm^-2·s^-1Under conditions of, cultivated in BG-11 Edge green alga is incised in culture in base.Frustule is collected, and extracts genomic DNA and RNA.

2) screening in edge green alga transcript profile sequencing data is incised certainly obtains one and main fat drips albumen (major lipid Droplet protein, MLDP) gene have the high similitude of comparison long 1508bp fragment, based on the fragment sequence, utilize RACE technologies obtain the cDNA sequence total length of MLDP genes, and we are named as MiMLDP.Then, using incising edge green alga The cDNA of RNA reverse transcriptions is that template carries out sequence verification to MiMLDP cDNA full length sequences.

3) primer is designed according to the cDNA sequence of MiMLDP total lengths, enters performing PCR expansion as template by the use of edge green alga DNA is incised Increase, obtain MiMLDP DNA full length sequences.

4) according to MiMLDP cDNA full length sequences and eYFP primers, pMD19T/ is built using PCR MiMLDP and pMD19T/eYFP plasmids.

5) double digestion (EcoRI/XbaI) is carried out to pYES2 carriers and pMD19T/eYFP plasmids, reclaims purpose fragment, then Connected to obtain the recombinant expression carrier pY-eYFP for carrying eYFP with T4 ligases.

6) double digestion (HindIII/EcoRI), recovery then are carried out to pY-eYFP carriers and pMD19T/MiMLDP plasmids Purpose fragment, then connect to obtain the recombinant vector pY-MiMLDP- for carrying target gene and eYFP amalgamation and expressions with T4 ligases eYFP。

7) recombinant vector pY-eYFP and pY-MiMLDP-eYFP is distinguished into transformed yeast with electroporation apparatus electric shocking method BY4741, transformant is screened using the synthetic media (SC-U) of uracil-deficient, screening obtains carrying pY-eYFP and pY- MiMLDP-eYFP transgenic yeast.

8) the yeast BY4741 for turning target gene, turning empty carrier (pY-eYFP) and non-transgenosis is inoculated in SC culture mediums, Yeast is collected after culture 72h.

9) yeast strain and transgenic yeast are carried out using fat drips specific fluorescence dye Nile red (Nile Red) thin Born of the same parents dye, and are found using confocal laser scanning microscope：Yellow fluorescence is in the transgenic yeast cell for carrying pY-eYFP Disperse shape；And in yeast cells of the target gene MiMLDP with eYFP fusion expression vectors (pY-MiMLDP-eYFP) is turned, it is yellow Color fluorescence is completely superposed with contaminating the red fluorescence of fat drips.The albumen that the result demonstrates coded by MiMLDP is positioned in fat drips, With the function of stablizing fat drips structure.

10) 50mg yeast freeze-dried powders are taken, add 1mL chloroform:Methanol (2:1) then solution uses N to extract its total fat₂ After drying, add 30 μ L chloroforms and sample is resuspended, draw a certain amount of sample and point sample to 60F254 silica gel thin-layer chromatography plates In (Merck, Germany), while add TAG standard specimens (Avanti, the U.S.).Deployed and developed the color with solvent again, to compare containing for TAG Amount.

Specific operation process is as follows：

1st, material

1) incise edge green alga (Myrmecia incisa Reisigl H4301) and be purchased from Prague, CZE Charles university algae Class Culture Center.Temperature be 25 DEG C, intensity of illumination be 115 μm of ol photonsm^-2·s^-1, light dark is than for 12h/12h's Under the conditions of cultivate, culture medium BG-11.

2) pYES2 carriers are purchased from Invitrogen companies.Yeast defect strain BY4741 (Mata his3 Δ leu2 Δs met15 Δ ura3 Δs) it is purchased from German EUROSCARF.By yeast-inoculated in SC culture mediums, with 200 turns of minutes at 30 DEG C^-1(rpm) turn Fast shaken cultivation.

2nd, method

1) the edge chlorella cell of incising for taking 100mg fresh is placed in the mortar of precooling, is added liquid nitrogen and is fully ground.

2) genomic DNA and total serum IgE of CTAB methods and TRIzol methods extraction frustule are utilized respectively, -20 DEG C save backup.

3) one and Dunaliella salina are screened in edge green alga transcript profile high-flux sequence database is incised (Dunaliella salina) MLDP (AEW43285.1) code sequence shows the long 1508bp fragments of 24% similitude (Contig21779), according to its primers, the SMART of Clontech companies is utilized^TMRACE cDNA amplification kits Enter performing PCR amplification.5 '-RACE use nest-type PRC.

The PCR reaction conditions of the first round are：94 DEG C denaturation 30s, 75 DEG C annealing 45s and 72 DEG C extension 2min, last 72 DEG C Extend 10min, 20 circulations；Primer is 5GSP1 (5 '-CTCCATGGCACGCACGCAGGTGTGTCCAA-3 ', SEQ ID NO: 1) and kit in UPM.Second wheel PCR reactions take 1.5 μ L first round PCR primers to take turns reaction template directly as second, instead Answering condition, last 72 DEG C extend 10min, totally 30 circulations for 45s and 72 DEG C of 94 DEG C of denaturation 30s, 73 DEG C of annealing extension 2min；Draw Thing is 5GSP2 (5 '-GCCATAAGTCCGCAGAAACTCCAGCCG-3 ', SEQ ID NO:2) and kit in NUPM.3’- RACE also uses nest-type PRC.The PCR reaction conditions of the first round are：30s and 72 DEG C of 94 DEG C of denaturation 30s, 73 DEG C of annealing extension 2min, last 72 DEG C of extensions 10min, 20 circulations；Primer be 3GSP1 (5 '-CCCAGACGAAACGGCATGTCAGGAGC-3 ', SEQ ID NO:And UPM 3).Second wheel PCR reactions take 1.5 μ L first round PCR primers to take turns reaction template directly as second, instead Answering condition, last 72 DEG C extend 10min, totally 30 circulations for 1min and 72 DEG C of 94 DEG C of denaturation 30s, 71 DEG C of annealing extension 2min； Primer is 3GSP2 (5 '-GCCATAAGTCCGCAGAAACTCCAGCCG-3 ', SEQ ID NO:4) and kit in NUPM.Will PCR primer is connected to pMD19T carriers after carrying out glue reclaim, converts Escherichia coli (Escherichia coli) DH5 α competence Cell, blue hickie screening, picking positive colony, bacterium colony PCR checkings, bacterium solution are sent to the survey of Shanghai Sheng Gong bioengineering Co., Ltd Sequence.5 '-and 3 '-terminal fragment sequence that sequencing obtains is spliced with known sequence fragment, obtains MiMLDP total length CDNA sequence.

4) MiMLDP cDNA full length sequences, design primer (sense primer CDF are obtained according to RACE technologies：5’- ATGGGGATAAGAAGGGGAGG-3 ', SEQ ID NO:5, anti-sense primer CDR：5 '-AACCAGCCGGGACTAGTAACTC-3 ', SEQ ID NO:6) performing PCR amplification is entered.PCR response procedures are 94 DEG C of pre-degeneration 5min, 35 circulations comprising 94 DEG C of denaturation 30s, 64 DEG C of annealing 45s, 72 DEG C of extensions 70s, last 72 DEG C of extensions 10min.Glue reclaim, TA clones, bacterium colony are carried out according to the method described above After PCR checkings, bacterium solution is sent to the sequencing of Shanghai Sheng Gong bioengineering Co., Ltd, it was demonstrated that incises edge green alga MiMLDP cDNA total lengths Sequence (SEQ ID NO:7).

5) primer (sense primer DF is designed according to MiMLDP cDNA full length sequences：5’- GGTCCGGCTAATGCGACTTCAA-3 ', SEQ ID NO:8, anti-sense primer DR：5 '-TGACACAGATCACGCTCGCT-3 ', SEQ ID NO:9), performing PCR amplification is entered as template to incise edge green alga DNA.Amplification condition is 94 DEG C of pre-degeneration 5min, and 35 are followed Ring includes 94 DEG C of denaturation 45s, 67 DEG C of annealing 45s, 72 DEG C of extensions 80s, last 72 DEG C of extensions 10min.PCR primer is as stated above After glue reclaim, TA clones and bacterium colony PCR checkings, the sequencing of Hai Sheng works bio-engineering corporation is served, obtains incising edge green alga MiMLDP DNA full length sequences (SEQ ID NO:10).

6) primer (SEQ ID NO are separately designed according to MiMLDP cDNA total lengths and eYFP sequences:11-SEQ ID NO: 14), their restriction enzyme sites respectively containing HindIII/EcoRI and EcoRI/XbaI, PCR reaction structures pMD19T/ is utilized MiMLDP and pMD19T/eYFP plasmids.25 μ L pcr amplification reaction system includes 2.5 μ L Ex Taq buffer solutions, 2 μ L DNTPs, 2 μ L Mg²⁺, 2 μ L cDNA templates, 1 μ L primer, 0.25 μ L Ex Taq enzymes and 14.5 μ L sterilized waters.Expand bar Part is 94 DEG C of pre-degeneration 5min, and 35 circulations include 94 DEG C of denaturation 45s, 64 DEG C of (eYFP annealing temperatures are 60 DEG C) annealing 45s, 72 DEG C extension 2min, it is last 72 DEG C extension 10min.PCR primer is cloned through glue reclaim, TA as stated above, serves the raw work biology in sea Engineering company is sequenced to ensure the accuracy of sequence.

7) pMD19T/MiMLDP and pMD19T/eYFP plasmids are extracted from bacillus coli DH 5 alpha.Use restriction enzyme EcoRI and XbaI carries out double digested reaction to pMD19T/eYFP, while using identical restriction endonuclease to pYES2 plasmids Carry out double digested reaction.Reaction system be 4 μ L 10 × M buffer solutions, 4 μ L 0.1%BSA, DNA about 2 μ g, XbaI and Each 1 μ L of EcoRI, add no RNase water to 20 μ L.37 DEG C of digestion reaction 4h.Purpose fragment after rubber tapping recovery digestion, and use T₄ EYFP fragments after digestion are connected to obtain recombinant vector pY-eYFP by DNA ligase with pYES2 fragments.Coupled reaction system is 2.5 μ L buffer solution, eYFP DNA about 0.3pmol, carrier pYES2 DNA about 0.03pmol, 1 μ L T₄DNA ligase, add Without RNase water to 25 μ L.16 DEG C of connections are overnight.Bacillus coli DH 5 alpha competent cell is converted after connection, is entered according to the method described above Row clone, bacterium colony PCR checkings and sequencing.PY-eYFP plasmids are extracted from bacillus coli DH 5 alpha, -20 DEG C save backup.Then use Restriction enzyme HindIII and EcoRI carries out double digested reaction respectively to pMD19T/MiMLDP and pY-eYFP plasmids, Recombinant vector pY-MiMLDP-eYFP is obtained using method same as described above.

8) prepared by competent yeast cells.By yeast-inoculated in SC culture mediums, 30 DEG C of recovery overnight incubations, then by 1: 100 amplification cultures, are about 1 × 10 with 200rpm speed oscillations culture to cell density⁸Cell mL^-1(about 4~5h).It is cold on ice But 15min makes cell stop growing, and yeast cells, precooling sterilized water are collected with 5 000rpm rotating speeds centrifugation 5min under the conditions of 4 DEG C Wash cell 3 times, be collected by centrifugation under similarity condition.The 1M sorbitol washes cell of 20mL precoolings 1 time, it is pre- to be then dissolved in 0.5mL Cold 1M sorbierites, the concentration of cell is adjusted 1 × 10¹⁰Cell mL^-1.Cell is preserved on ice, is easy to electric shock to use.

9) shocked by electricity using electroporation apparatus (Bio-Rad), recombinant vector pY-MiMLDP-eYFP transformed yeasts BY4741 is felt By state cell.Take μ L (5~200ng) of DNA about 5~10 in the recombinant vector pY-MiMLDP-eYFP to be transformed of precooling on ice with Competent yeast cells mix, and the precooling on ice together with 0.2cm electric shock cup, are then transferred to DNA and cell mixture The electric shock cup of precooling gently mixes, and after ice bath 5min, option program Sc2 shocks by electricity once, removes electric shock cup, it is pre- to be added immediately 1mL Cold 1M sorbierites, gently it is transferred in new YPD culture mediums, 30 DEG C of slight oscillatory 5h, bacterium solution is coated on containing 1M sorbs On the uracil-deficient synthetic media (SC-U) of alcohol, 30 DEG C of inversion quiescent culture 48-72h, picking colony is trained in liquid SC-U Support and cultivated in base.After bacterium colony PCR checkings, strain is preserved with the SC-U culture mediums containing 2% glucose.In addition, press above-mentioned same sample prescription Method goes to unloaded pY-eYFP electricity on BY4741.

10) viable yeast is contaminated with fat drips specific fluorescent dye Nile Red (Genmed Scientifics Inc., the U.S.) Color, with laser confocal microscope (Carl Zeiss LSM 710, Germany) observation, take pictures.Wherein Nile Red fluorescent dyes Excitation wavelength used is 543nm, and launch wavelength 598nm, yellow fluorescence protein excitation wavelength is 514nm, and launch wavelength is 527nm。

11) 50mg yeast freeze-dried powders are taken, add 1mL chloroform:Methanol (2:1) solution and 200~300 μ L bead After (0.4~0.6mm of diameter) (Sigma, the U.S.), 1h is acutely vibrated.Microscopy, after clasmatosis, centrifuged with 5500rpm 15min.Supernatant is taken into new centrifuge tube, is separately added into 400 μ L 50mmol/L citric acids and 600 μ L chloroforms, then with 5500rpm centrifuges 15min.It is careful to draw lower floor's organic phase, use N₂- 20 DEG C save backup after drying.Add in the sample of drying Enter the resuspension of 30 μ L chloroforms, draw 15 μ L samples with pipettor and put 60F254 silica gel thin-layer chromatographies plate (Merck, Germany) On, while add TAG standard specimens (Avanti, the U.S.).Solvent (n-hexane is used again:Ether:Glacial acetic acid, 80:20:1, v/v/v) open up Open, finally by the developer (CuSO of phosphoric acid and 10% (w/v) containing 8% (v/v)₄·5H₂O) it is sprayed on silica gel column chromatography plate, 10min colour developings are dried in 140 DEG C to compare TAG content.

3rd, result

1) verified according to RACE technologies and by PCR amplifications, obtain incising edge green alga MiMLDP cDNA full length sequences (SEQ ID NO:7)；Its long 780bp of 5 '-non-translational region (UTR) long 217bp, 3 '-UTR, opens frame frame (ORF) long 918bp, compiles One albumen being made up of 305 amino acid of code, the amino acid sequence such as SEQ ID NO of the albumen:Shown in 11.Using incising edge Green alga genomic DNA is that template carries out pcr amplification reaction, and MiMLDP DNA full length sequences (SEQ ID are understood after sequence analysis NO:10), there are 4 intrones in overall length 2353bp, the length of these intrones is distinguished successively from 5 '-end to 3 '-end in ORF For 87bp, 79bp, 164bp and 86bp, so as to which the ORF of the gene is separated into 5 extrons (Fig. 1).

2) yeast and transgenic yeast utilize fat drips specific fluorescent dye Nile Red couple after galactolipin Fiber differentiation Its cell is dyed, and is observed by laser confocal microscope under different excitation wavelengths.Turning unloaded (pY-eYFP) In yeast cells, it is found that yellow fluorescence diffuses whole cell spaces other than the cores；Melt turning target gene MiMLDP and eYFP Close expression vector (pY-MiMLDP-eYFP) yeast in, yellow fluorescence be concentrated mainly on specifically launched by Nile Red it is red The region of color fluorescence is (Fig. 2) in fat drips.Illustrate amalgamation and expression MiMLDP can be by eYFP from other intracellular positions fluorescence Signal is concentrated in fat drips, it was demonstrated that the albumen of MiMLDP coded by said gene can be anchored in fat drips exactly, had and stablized fat Drip the function of structure.

3) yeast lipid is analyzed by TLC technique, it is known that yeast BY4741 bacterial strains, carry unloaded (pY-eYFP) The transgenic yeast of transgenic yeast and carrying target gene (pY-MiMLDP-eYFP) can synthesize TAG.Compared to BY4741 bacterial strains and the transgenic strain for carrying pY-eYFP, carry the transgenic yeast of target gene (pY-MiMLDP-eYFP) Contained TAG amounts are higher (Fig. 3), estimated using ImageJ softwares according to area, are respectively BY4741 bacterial strains and carry sky Carry 3.20 and 2.48 times of (pY-eYFP) transgenic yeast TAG amounts.Illustrate to be overexpressed in yeast and incise edge green alga MiMLDP, because MiMLDP is anchored to increase the stability of fat drips in fat drips, so as to improve yeast cells storage or accumulate TAG's Ability.

It is the special instruction on some sequences below：

SEQ ID NO:7 --- MiMLDP cDNA full length sequences (underscore for starting or terminator codon)：

GATTAAGCAGTGGTATCAACGCAGAGTACATGGGGATAAGAAGGGGAGGCCCTGGGGGCAAGAGGAGCG GCACAGCGTCTTGTAAGACTCAGTGATTACAGGTCCGGCTAATGCGACTTCAACTGGATAACAAGCCGCTGTGCAAA GCAGAGGTTCGTGTACCGCCCCGAGGTCTCGTTGCAACAGCAGCCCCGGAGAAAGCCTGCAGGAGGCAAGCATGGGC AAGTCCTCCAAAGCCCGCCATTACCATCACCCTGGTAAATACCCATACTGCCCAGTCAGGGCACCGGCCAACGTGCT GGTGATGCGCTCACCTCTGCGACAGCAGGAAAATGGTCAAGTGGCCGGCGTGGCAGGGCAGGGCGCGTCCCCCTTCT GGCCTGCTGAGCCTGCTGGCAAGGCTCACGACCTCAAACGGCTGGAGTTTCTGCGGACTTATGGCGAGTACTACTGG AGCAAGGCTAACCAGCTGGCTTCCACAGTTTACTCCACGGGTCGCGCCTACACGCCTGCAACCTTGGACACACACCT GCGTGCCATGGAGGAGCGGGTGTCGTCCTTCAGCCTGCCCATTGTGTGTGCTGTGACGCAGCAGACTGAGAGCGTCC TGCGTTCCTTGGACGGCAAGGTGGATGGCGTGTTCCATGCAGCGTCAGAGCTGTTTGCTCACAATAGCTTCGTGGGT GACGCATTTGAGCGGCAGCGGGGCTACCACTCCCCCTCACTCAAGGCAGCCGGGGAGGAGTACCTGCACAAGCTGGA AGAGGCCTGGTGCAAGCTCATAGCGCTGCCCCCAGTCAACAAGCTCCTGGAGAGCACTGCGCCGTCCGTCGATTTCA CCCGCCGCAAGTACCTGGCCGCACACGATGTGGTGGTGGGGTCCACCTCCTACAATAAGGCCTTGGCAACGGCCGCC AGCATGCTGGATCAGGTCAAGGATACTTTTGTGTACAAGGCCGCTGCTAGCAAGCTGTACCCAGTCATCTCGCCGCT GGCGGACCCAGCCCTCAGCAAGATCACACATTCAGCCTGCTACAGCGCTGTTGTTGACCACCTGAAGCCAACTGGCC CCTCAAGCGACAGCGTGCACCACGCCGACCAGGCGTGGCGAGTCCTGTCTTGTGCCCAGTGCTAAGCCAGGCGGGCG TGTAGCCGTCTACTGCCTTTGTTGCCGACAGCGGCAGCTGGACTAGGCGGTAGTTGACCGTCTTATGCCTTGGGCTC ATGCGCTGGGGTCCCAAGTGGCGTCATTGTGCAAAACAACCCAGACGAAACGGCATGTCAGGAGCTCCGAGATGAGA GAGGGAATGCGGGTGACAGCTGGCAGGGCCAGCTTGGATCTCGTCATCCCAGCGGTGTGCTTCTGAAACCGGGTGCT GGCAAGTGCAAGCGGGTCTGCAGAACTGTAGTGGATAGCTGTGCCCCTTGCCATTCCACCTTGCAGCCAACGCTACT ACGCATGCGGGCATCAACGATGTGGGCAGTGTGAAAGGTGCTGCCTATCAAGTGAGAGAGCGAGCGTGATCTGTGTG TCAGCGGCGGGCCTCTGCGCAGCAGCCGGAATGAGCCCTCGCGTGGGCAGGGGGCAGTTGGCAAGATAAAGTGCCGG CACGAAGGGCAGGATGGACGCGCTGGTTGCAGGTCCTTCTCAAGTTTTGCAATGAGAGCGCACAAGGAGGACCATGT GCACATAACCCATGACCTAGCCGCTGAGCCTGCGGTTGTTACGGGGGAACGCTGTATGATCTGTCGTGTGCAAGCCA GGAGTTGTTTGCTCTGCATGTATGACATCACGTATCAAAGAAGCCCGCATGTGTTTTCAGTCGCTGTTGTTGCTCGA GTTACTAGTCCCGGCTGGTTGGGAGTTGTAGATGATCCTGCTTTCATCAAAAGATTGCAATCACTTGATTGTATC

SEQ ID NO:10 --- MiMLDP DNA full length sequences (underscore for starting or terminator codon, runic portion It is divided into intron sequences)：

SEQ ID NO:11 and SEQ ID NO:12 --- according to MiMLDP cDNA full length sequences design band HindIII and The primer of EcoRI restriction enzyme sites：

Sense primer MOF：5 '-aagcttATGGGCAAGTCCTCCAAAGCC-3 ', SEQ ID NO:11 (lowercase is HindIII restriction enzyme sites)；

Anti-sense primer MOR：5 '-gaattcTTAGCACTGGGCACAAGACAGGA-3 ', SEQ ID NO:12 (lowercases For EcoRI restriction enzyme sites).

SEQ ID NO:13 and SEQ ID NO:14 --- according to eYFP sequences Designs with EcoRI and XbaI enzyme cutting site Primer：

Sense primer YF：5 '-gaattcATGGTGAGCAAGGG-3 ', SEQ ID NO:13 (lowercase is EcoRI enzymes Enzyme site)；

Anti-sense primer YR：5 '-tctagaTTTACTTGTACAGCTCG-3 ', SEQ ID NO:14 (lowercase XbaI Restriction enzyme site).

Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art Member, on the premise of the inventive method is not departed from, can also make some improvement and supplement, and these are improved and supplement also should be regarded as Protection scope of the present invention.

SEQUENCE LISTING

<110>Shanghai Ocean University

<120>Incise gene order and its application of the main fat drips albumen of edge green alga

<130> /

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 29

<212> DNA

<213>Artificial sequence

<400> 1

ctccatggca cgcacgcagg tgtgtccaa 29

<210> 2

<211> 27

<212> DNA

<213>Artificial sequence

<400> 2

gccataagtc cgcagaaact ccagccg 27

<210> 3

<211> 26

<212> DNA

<213>Artificial sequence

<400> 3

cccagacgaa acggcatgtc aggagc 26

<210> 4

<211> 27

<212> DNA

<213>Artificial sequence

<400> 4

gccataagtc cgcagaaact ccagccg 27

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<400> 5

atggggataa gaaggggagg 20

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence

<400> 6

aaccagccgg gactagtaac tc 22

<210> 7

<211> 1915

<212> DNA

<213> Myrmecia incisa

<400> 7

gattaagcag tggtatcaac gcagagtaca tggggataag aaggggaggc cctgggggca 60

agaggagcgg cacagcgtct tgtaagactc agtgattaca ggtccggcta atgcgacttc 120

aactggataa caagccgctg tgcaaagcag aggttcgtgt accgccccga ggtctcgttg 180

caacagcagc cccggagaaa gcctgcagga ggcaagcatg ggcaagtcct ccaaagcccg 240

ccattaccat caccctggta aatacccata ctgcccagtc agggcaccgg ccaacgtgct 300

ggtgatgcgc tcacctctgc gacagcagga aaatggtcaa gtggccggcg tggcagggca 360

gggcgcgtcc cccttctggc ctgctgagcc tgctggcaag gctcacgacc tcaaacggct 420

ggagtttctg cggacttatg gcgagtacta ctggagcaag gctaaccagc tggcttccac 480

agtttactcc acgggtcgcg cctacacgcc tgcaaccttg gacacacacc tgcgtgccat 540

ggaggagcgg gtgtcgtcct tcagcctgcc cattgtgtgt gctgtgacgc agcagactga 600

gagcgtcctg cgttccttgg acggcaaggt ggatggcgtg ttccatgcag cgtcagagct 660

gtttgctcac aatagcttcg tgggtgacgc atttgagcgg cagcggggct accactcccc 720

ctcactcaag gcagccgggg aggagtacct gcacaagctg gaagaggcct ggtgcaagct 780

catagcgctg cccccagtca acaagctcct ggagagcact gcgccgtccg tcgatttcac 840

ccgccgcaag tacctggccg cacacgatgt ggtggtgggg tccacctcct acaataaggc 900

cttggcaacg gccgccagca tgctggatca ggtcaaggat acttttgtgt acaaggccgc 960

tgctagcaag ctgtacccag tcatctcgcc gctggcggac ccagccctca gcaagatcac 1020

acattcagcc tgctacagcg ctgttgttga ccacctgaag ccaactggcc cctcaagcga 1080

cagcgtgcac cacgccgacc aggcgtggcg agtcctgtct tgtgcccagt gctaagccag 1140

gcgggcgtgt agccgtctac tgcctttgtt gccgacagcg gcagctggac taggcggtag 1200

ttgaccgtct tatgccttgg gctcatgcgc tggggtccca agtggcgtca ttgtgcaaaa 1260

caacccagac gaaacggcat gtcaggagct ccgagatgag agagggaatg cgggtgacag 1320

ctggcagggc cagcttggat ctcgtcatcc cagcggtgtg cttctgaaac cgggtgctgg 1380

caagtgcaag cgggtctgca gaactgtagt ggatagctgt gccccttgcc attccacctt 1440

gcagccaacg ctactacgca tgcgggcatc aacgatgtgg gcagtgtgaa aggtgctgcc 1500

tatcaagtga gagagcgagc gtgatctgtg tgtcagcggc gggcctctgc gcagcagccg 1560

gaatgagccc tcgcgtgggc agggggcagt tggcaagata aagtgccggc acgaagggca 1620

ggatggacgc gctggttgca ggtccttctc aagttttgca atgagagcgc acaaggagga 1680

ccatgtgcac ataacccatg acctagccgc tgagcctgcg gttgttacgg gggaacgctg 1740

tatgatctgt cgtgtgcaag ccaggagttg tttgctctgc atgtatgaca tcacgtatca 1800

aagaagcccg catgtgtttt cagtcgctgt tgttgctcga gttactagtc ccggctggtt 1860

gggagttgta gatgatcctg ctttcatcaa aagattgcaa tcacttgatt gtatc 1915

<210> 8

<211> 22

<212> DNA

<213>Artificial sequence

<400> 8

ggtccggcta atgcgacttc aa 22

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence

<400> 9

tgacacagat cacgctcgct 20

<210> 10

<211> 2331

<212> DNA

<213> Myrmecia incisa

<400> 10

gattaagcag tggtatcaac gcagagtaca tggggataag aaggggaggc cctgggggca 60

agaggagcgg cacagcgtct tgtaagactc agtgattaca ggtccggcta atgcgacttc 120

aactggataa caagccgctg tgcaaagcag aggttcgtgt accgccccga ggtctcgttg 180

caacagcagc cccggagaaa gcctgcagga ggcaagcatg ggcaagtcct ccaaagcccg 240

ccattaccat caccctggta aatacccata ctgcccagtc agggcaccgg ccaacgtgct 300

ggtgatgcgc tcacctctgc gacagcagga aaatggtcaa gtggccggtg agtacagaca 360

cggctgccac gggtgctgag gtactgcggg tcgctgcctg ctggcgcttg acgtgccctg 420

tgcgcctcgg acaggcgtgg cagggcaggg cgcgtccccc ttctggcctg ctgagcctgc 480

tggcaaggct cacgacctca aacggctgga gtttctgcgg acttatggcg agtactactg 540

gagcaaggct aaccagctgg cttccacagt ttactccacg ggtcgcgcct acacgcctgc 600

aaccttggac acacacctgc gtgccatgga ggagcgggtg tcgtccttca gcctgcccat 660

tgtgtgtgct gtgacgcagc agactgagag cgtcctgcgt tccttggacg gcaaggtaag 720

aacttgtttg gctgccagct attctgtcca tggacactac agactggtct gctgacagtg 780

tggctgccct ctaggtggat ggcgtgttcc atgcagcgtc agagctgttt gctcacaata 840

gcttcgtggg tgacgcattt gagcggcagc ggggctacca ctccccctca ctcaaggcag 900

ccggggagga gtacctgcac aagctggaag aggcctggtg caagctcata gcgctgcccc 960

caggtgtgcc ccgtccatgc ctggttttca gccgcagcgc ggctgccgat gtacctgacc 1020

cttcgcgtcg ttgccaactt gctatcattg caggcagtgt cagcttgctg catcttttgg 1080

cttgtgcgca accggtgatg gtgacttgag gccggcatgt gtcgcagtca acaagctcct 1140

ggagagcact gcgccgtccg tcgatttcac ccgccgcaag tacctggccg cgcacgatgt 1200

ggtggtgggg tccacctcct acaataaggc cttggcaacg gccgccagca tgctggatca 1260

ggtcagcagc tgtgtggcag ctggctccgt tgctcttgcg tcctgctacc tcttgcagcc 1320

ttgcaagctg tcgtgggctg tccgcaggtc aaggatactt ttgtgtacaa ggccgctgct 1380

agcaagctgt acccagtcat ctcgccgctg gcggacccag ccctcagcaa gatcacacat 1440

tcagcctgct acagcgctgt tgttgaccac ctgaagccaa ctggcccctc aagcgacagc 1500

gtgcaccacg ccgaccaggc gtggcgagtc ctgtcttgtg cccagtgcta agccaggcgg 1560

gcgtgtagcc gtctactgcc tttgttgccg acagcggcag ctggactagg cggtagttga 1620

ccgtcttatg ccttgggctc atgcgctggg gtcccaagtg gcgtcattgt gcaaaacaac 1680

ccagacgaaa cggcatgtca ggagctccga gatgagagag ggaatgcggg tgacagctgg 1740

cagggccagc ttggatctcg tcatcccagc ggtgtgcttc tgaaaccggg tgctggcaag 1800

tgcaagcggg tctgcagaac tgtagtggat agctgtgccc cttgccattc caccttgcag 1860

ccaacgctac tacgcatgcg ggcatcaacg atgtgggcag tgtgaaaggt gctgcctatc 1920

aagtgagaga gcgagcgtga tctgtgtgtc agcggcgggc ctctgcgcag cagccggaat 1980

gagccctcgc gtgggcaggg ggcagttggc aagataaagt gccggcacga agggcaggat 2040

ggacgcgctg gttgcaggtc cttctcaagt tttgcaatga gagcgcacaa ggaggaccat 2100

gtgcacataa cccatgacct agccgctgag cctgcggttg ttacggggga acgctgtatg 2160

atctgtcgtg tgcaagccag gagttgtttg ctctgcatgt atgacatcac gtatcaaaga 2220

agcccgcatg tgttttcagt cgctgttgtt gctcgagtta ctagtcccgg ctggttggga 2280

gttgtagatg atcctgcttt catcaaaaga ttgcaatcac ttgattgtat c 2331

<210> 11

<211> 305

<212> PRT

<213> Myrmecia incisa

<400> 11

Met Gly Lys Ser Ser Lys Ala Arg His Tyr His His Pro Gly Lys Tyr

1 5 10 15

Pro Tyr Cys Pro Val Arg Ala Pro Ala Asn Val Leu Val Met Arg Ser

20 25 30

Pro Leu Arg Gln Gln Glu Asn Gly Gln Val Ala Gly Val Ala Gly Gln

35 40 45

Gly Ala Ser Pro Phe Trp Pro Ala Glu Pro Ala Gly Lys Ala His Asp

50 55 60

Leu Lys Arg Leu Glu Phe Leu Arg Thr Tyr Gly Glu Tyr Tyr Trp Ser

65 70 75 80

Lys Ala Asn Gln Leu Ala Ser Thr Val Tyr Ser Thr Gly Arg Ala Tyr

85 90 95

Thr Pro Ala Thr Leu Asp Thr His Leu Arg Ala Met Glu Glu Arg Val

100 105 110

Ser Ser Phe Ser Leu Pro Ile Val Cys Ala Val Thr Gln Gln Thr Glu

115 120 125

Ser Val Leu Arg Ser Leu Asp Gly Lys Val Asp Gly Val Phe His Ala

130 135 140

Ala Ser Glu Leu Phe Ala His Asn Ser Phe Val Gly Asp Ala Phe Glu

145 150 155 160

Arg Gln Arg Gly Tyr His Ser Pro Ser Leu Lys Ala Ala Gly Glu Glu

165 170 175

Tyr Leu His Lys Leu Glu Glu Ala Trp Cys Lys Leu Ile Ala Leu Pro

180 185 190

Pro Val Asn Lys Leu Leu Glu Ser Thr Ala Pro Ser Val Asp Phe Thr

195 200 205

Arg Arg Lys Tyr Leu Ala Ala His Asp Val Val Val Gly Ser Thr Ser

210 215 220

Tyr Asn Lys Ala Leu Ala Thr Ala Ala Ser Met Leu Asp Gln Val Lys

225 230 235 240

Asp Thr Phe Val Tyr Lys Ala Ala Ala Ser Lys Leu Tyr Pro Val Ile

245 250 255

Ser Pro Leu Ala Asp Pro Ala Leu Ser Lys Ile Thr His Ser Ala Cys

260 265 270

Tyr Ser Ala Val Val Asp His Leu Lys Pro Thr Gly Pro Ser Ser Asp

275 280 285

Ser Val His His Ala Asp Gln Ala Trp Arg Val Leu Ser Cys Ala Gln

290 295 300

Cys

305

Claims

1. a kind of polypeptide, it is characterised in that the amino acid sequence of described polypeptide is as shown in SEQ ID NO.11.

2. a kind of nucleotide sequence of separation, it is characterised in that described nucleotide sequence includes：

A) nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.10；Or

3. a kind of recombinant expression carrier, it is characterised in that described recombinant expression carrier is as the nucleotides described in claim 2 Recombinant expression carrier of the sequence constructed by with plasmid or virus.

4. recombinant expression carrier according to claim 3, it is characterised in that described plasmid is pYES2 plasmids.

5. a kind of genetically engineered host cell, it is characterised in that described host cell is selected from one of the following：

A) with the nucleotide sequence conversion described in claim 2 or the host cell of transduction；

B) with the recombinant expression carrier conversion described in claim 3 or the host cell of transduction.

6. host cell according to claim 5, it is characterised in that described host cell is that bacterial cell or fungi are thin Born of the same parents.

7. host cell according to claim 6, it is characterised in that described host cell is yeast cells.

8. the nucleotide sequence described in polypeptide, claim 2 described in claim 1, the restructuring table described in claim 3 or 4 Up to purposes of any described host cell of carrier or claim 5-7 in grease yield is increased.

9. purposes according to claim 8, it is characterised in that described increase grease yield refers to increase triacylglycerol production Amount.