CN111269923B

CN111269923B - Chlorella anaplastic CDP-ethanolamine: gene sequence and application of diacylglycerol ethanolamine phosphotransferase

Info

Publication number: CN111269923B
Application number: CN202010098613.9A
Authority: CN
Inventors: 周志刚; 焦建璐; 毕燕会
Original assignee: Shanghai Ocean University
Current assignee: Shanghai Ocean University
Priority date: 2020-02-18
Filing date: 2020-02-18
Publication date: 2023-05-02
Anticipated expiration: 2040-02-18
Also published as: CN111269923A

Abstract

The invention belongs to the field of genetic engineering, and discloses a gene sequence of a chlorella protothecoides CDP-ethanolamine (diacylglycerol ethanolamine) phosphotransferase and application thereof, wherein a MiEPT gene comprises a nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 3 or complementary thereto, the amino acid sequence of a coded protein is shown in SEQ ID NO. 2, the amino acid sequence of a recombinant protein is shown in SEQ ID NO. 4, a recombinant expression vector is constructed by the nucleotide sequence and a plasmid, and genetically engineered host cells comprise host cells transformed or transduced by the nucleotide sequence or the recombinant expression vector and progeny cells thereof. The nucleotide sequence, the coded protein, the recombinant expression vector or the host cell can be used for catalyzing diacylglycerol and CDP-ethanolamine to synthesize phosphatidylethanolamine in a CDP-ethanolamine pathway.

Description

Gene sequence of chlorella protothecoides CDP-ethanolamine diacylglycerol ethanolamine phosphotransferase and application

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a gene sequence of chlorella protothecoides CDP-ethanolamine diacylglycerol ethanolamine phosphotransferase (MiEPT) and application thereof.

Background

The essential component of the biological membrane is membrane lipid, and the membrane lipid mainly comprises 3 types of phospholipids, glycolipids, cholesterol and the like, wherein the phospholipids account for more than about 50% of the whole membrane lipid, so that the phospholipids can be said to be the essential component of the membrane lipid. Phospholipids can be further classified into 2 classes: glycerophospholipids and sphingomyelins; among these glycerophospholipids, the first major class of phospholipids, including Phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidylinositol (PI), and the like, are derived from sn-glycerol-3-phosphoric acid, i.e., products formed by esterification of fatty acids at the sn-1 and sn-2 positions of the glycero-carbon skeleton. PE and PC are the most abundant lipids in cell membranes, and PE biosynthesis generally proceeds via 2 pathways: one is the decarboxylation of PS in mitochondria and the other is the CDP-ethanolamine pathway. Among the CDP-ethanolamine pathways, PE synthetases that have been found to date are ethanolamine kinase phospho (EK), CTP: phosphoethanolamine cytidylyltransferase (ET), and CDP-ethanolamine: 1, 2-diacylglycerol Ethanolamine Phosphotransferase (EPT), where EPT is the last step in the PE de novo synthesis pathway to catalyze. EPT is therefore a key enzyme for PE synthesis.

Disclosure of Invention

A first object of the present invention is to provide an isolated nucleotide sequence comprising: a) A nucleotide sequence as set forth in SEQ ID NO. 1 or SEQ ID NO. 3; or b) a nucleotide sequence complementary to the nucleotide sequence of a).

The second object of the present invention is to provide a coded protein, the amino acid sequence of which is shown in SEQ ID NO. 2.

The third object of the invention is to provide a recombinant protein rMiEPT, and the amino acid sequence of the recombinant protein rMiEPT is shown as SEQ ID NO. 4.

The fourth object of the present invention is to provide a recombinant expression vector comprising any one of the nucleotide sequences and constructed from the same and a plasmid; in a preferred embodiment, the plasmid is a pET23a plasmid.

It is a fifth object of the present invention to provide a genetically engineered host cell selected from the group consisting of: a host cell transformed or transduced with any one of the nucleotide sequences described herein and its progeny; or ii) a host cell transformed or transduced with any one of the recombinant expression vectors and its progeny cells. In some embodiments, the host cell is a bacterial cell, a fungal cell, a plant cell, or an animal cell, or a progeny of any of the foregoing.

A sixth object of the present invention is to provide the use of any one of the above nucleotide sequences, encoded proteins, recombinant expression vectors or host cells for the catalytic synthesis of phosphatidylethanolamine, further for the catalytic synthesis of diacylglycerol and CDP-ethanolamine to phosphatidylethanolamine in the CDP-ethanolamine pathway.

In order to achieve the above purpose, the technical scheme of the invention is as follows:

(1) at a temperature of 25 ℃, the illumination intensity is 115 mu mol of photons/(m) ² S) under the condition of a light-dark ratio of 12H/12H, culturing chlorella protothecoides (Myrmecia incisa Reisigl) H4301 in a BG-11 culture medium, collecting algae cells, and extracting genome DNA and total RNA.

(2) Screening from sequencing data of a genome of the green alga, obtaining a Contig17194_8 sequence which has 51.48% homology with a Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) EPT gene (GenBank accession number: XP_ 001692856.1) and is 720bp long, designing a primer on the basis, obtaining cDNA sequences of 5 '-and 3' -ends of the gene by using RACE technology, and obtaining the cDNA full-length sequence of the gene as shown in SEQ ID NO. 1 and the amino acid sequence of the encoded protein as shown in SEQ ID NO. 2 through splicing and redesigning the primer for verification. By sequence alignment, it was found to have 61% homology with the protein encoded by EPT (GenBank accession number: XP_ 005646944) reported in Coccomyxa subellipsoidea C-169, and was therefore designated MiEPT.

(3) Designing a primer according to the full-length cDNA sequence of MiEPT, and performing PCR amplification by using the genome DNA of the Chlorella ananatis as a template to obtain the DNA sequence of MiEPT, wherein the DNA sequence is shown as SEQ ID NO. 3.

(4) Designing primers with enzyme cutting sites according to the ORF sequence of MiEPT and the multi-cloning site sequences of cloning plasmid pEASYR and expression plasmid pET23a, cloning the ORF region of MiEPT by using a PCR amplification technology with cDNA as a template as shown in SEQ ID NO. 5 and SEQ ID NO. 6, and constructing the cloning plasmid pEASYR/MiEPT.

(5) And (3) carrying out double digestion on the cloning plasmid pEASYR/MiEPT and the expression plasmid pET23a by utilizing endonucleases EcoRI and NotI respectively, recovering a target fragment, and connecting the target fragment with T4 ligase to obtain the recombinant expression plasmid pET/MiEPT containing the target fragment.

(6) And (3) converting the recombinant expression plasmid pET/MiEPT with correct sequence into competent cells of escherichia coli BL21 by a heat shock method, and screening a transgenic strain ET/MiEPT containing a target gene. Isopropyl- β -D-thiogalactoside (IPTG, final concentration to 0.1 mM) and chloramphenicol (35. Mu.g/mL) were added, and after induction culture at 25℃for 4 hours, the bacterial liquid was collected, frozen at-20℃and stored.

(7) After the frozen bacterial liquid is dissolved and then subjected to ultrasonic treatment, cell debris is removed by centrifugation (15000 Xg, 10 min), the supernatant is subjected to ultracentrifugation for 60min at 100000 Xg, the supernatant is left, the expression of recombinant protein rMiEPT is detected by a Sodium Dodecyl Sulfate (SDS) -polyacrylamide gel electrophoresis (PAGE) technology, and the purified recombinant protein is subjected to Western blotting detection by using an anti-polyhistidine-tag antibody, and the supernatant is used as enzyme activity detection.

(8) Adding purified recombinant protein rMiEPT into a reaction system with CDP-ethanolamine and DAG, reacting for a certain time, detecting the generation condition of PE in the reaction system by using a Thin Layer Chromatography (TLC) method, and verifying that the protein encoded by MiEPT gene cloned from Chlorella vulgaris can synthesize CDP-ethanolamine and DAG into PE in vitro, thereby identifying the function of the gene.

The invention discloses a gene sequence of a chlorella protothecoides CDP-ethanolamine, namely diacylglycerol ethanolamine phosphotransferase for the first time, a gene MiEPT of the chlorella protothecoides EPT is cloned by a cDNA end Rapid Amplification (RACE) technology, the full-length sequence of cDNA of the gene is 1914bp (without poly (A) tail), a5 '-untranslated region (UTR) is 217bp, a 3' -untranslated region (UTR) is 533bp, an Open Reading Frame (ORF) is 1164bp, the ORF sequence totally codes 387 amino acids, the coding protein has no signal peptide and transport peptide, but has 8 transmembrane regions, and has 61 percent homology with EPT (GenBank accession number: XP-005646944) of Coccomyxa subellipsoidea C-169. In addition, the invention also constructs a prokaryotic expression vector of MiEPT, converts Escherichia coli (Escherichia coli) BL21, carries out induction culture, purifies to obtain recombinant expressed protein rMiEPT, and uses thin-layer chromatography to carry out in-vitro enzyme activity verification on rMiEPT to synthesize CDP-ethanolamine and DAG into PE, thereby realizing function identification of MiEPT genes.

Drawings

FIG. 1 is an agarose gel electrophoresis of the amplification product of the MiEPT gene 5'-/3' -RACE of Chlorella ananatis. M: DL2000 DNA molecular weight standard (radicle biochemistry); lane 1:17194F/R primer PCR amplified product; lane 2:3' -RACE second round nested primer PCR amplification products; lane 3:5' -RACE second round nested primer PCR amplification products; lane 4: PCR amplified product of DNA1F/R primer; lane 5: PCR amplified products of the DNA2F/R primer; lane 6: PCR amplified products of the DNA3F/R primer; lane 7: DNA4F/R primer PCR amplified product; lane 8: DNA5F/R primer PCR amplified product.

FIG. 2 is a schematic diagram of the gene structure of Chlorella anaplastic MiEPT. Grey lines are untranslated regions (UTRs), black lines are introns and black boxes are exons.

FIG. 3 shows the pET23a plasmid map (upper) and the sequence of the region of the multiple cloning site (lower).

FIG. 4 is an electrophoretogram of cloning and double cleavage products of the recombinant expression plasmid pET/MiEPT construction process. M1: d2000 molecular weight standard; m2: marker IV molecular weight standard; lane 1: PCR amplified products with restriction site primers; lane 2: the dual cleavage products of pEASYR/MiEPT; lane 3: double cleavage products of pET23 a; lane 4: double cleavage products of pET/MiEPT.

FIG. 5 is an SDS-PAGE electropherogram of recombinant protein rMiEPT induced expression products. M: pre-stained protein molecular weight standard (Thermo Scientific); lane 1: soluble protein of E.coli harboring empty plasmid pET23 a; lanes 2 to 5: inducing the whole mycoprotein expressed in 0h, 4h, 6h and 8h respectively by using the escherichia coli which is subjected to the MiEPT gene transfer by IPTG; lane 6: protein purified in self-rotation MiEPT gene escherichia coli; lane 7: coli purified protein from empty plasmid pET23 a.

FIG. 6 is an electrophoretogram of recombinant protein rMiEPT purified product and Western blot using anti-polyhistidine tag antibody. M: pre-stained protein molecular weight standard (Thermo Scientific); lane 1: inducing the whole mycoprotein expressed for 4 hours by using the escherichia coli which is transformed with the MiEPT gene by IPTG; lanes 2 and 3: respectively supernatant and sediment after the first centrifugation; lanes 4 and 5: supernatant and pellet after the second ultracentrifugation; lane 6: western blot of protein purified from E.coli from the autorotation MiEPT gene using anti-polyhistidine-tagged antibodies.

FIG. 7 is a Thin Layer Chromatography (TLC) pattern of the enzyme-catalyzed reaction product of recombinant expressed protein rMiEPT. PE: standard for phosphatidylethanolamine (company Avanti Polar Lipids, usa); lane 1: adding purified rMiEPT into a reaction system; lane 2: adding the purified protein of the autorotation empty vector pET23a strain into a reaction system; lane 3: a blank control of the heavy suspension protein buffer is added into the reaction system.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

1. Material

1) The Chlorella ananatis (Myrmecia incisa Reisigl) H4301 was from the university of Czochralski Cha Lisi algae culture Center (CAUP). At a temperature of 25 ℃, the illumination intensity is 115 mu mol of photons/(m) ² S) and culturing under the condition that the light/dark ratio is 12h/12h, wherein the culture medium is BG-11.

2) E.coli (Escherichia coli) cloning vector pEASYR, E.coli Trans1-T1 competent cells, E.coli BL21 (DE 3) pLysS were purchased from full gold organism Co., ltd. (Beijing); t4 DNA ligase, restriction enzymes (EcoRI and NotI) were purchased from Daida TaKaRa; the pET23a vector is purchased from Novagen. CDP-ethanolamine was purchased from Sigma, diacylglycerol (DAG) and Phosphatidylethanolamine (PE) were purchased from Avanti Polar Lipids, and the other reagents were all from bioengineering, inc.

2. Method of

1) After centrifugation, 100mg of fresh green alga cells with notch edge are weighed and placed in a precooled mortar, and are fully ground by adding liquid nitrogen.

2) Extracting genome DNA of Chlorella incisa by CTAB method, preserving at-20deg.C for standby, extracting total RNA by TRIzol reagent method, preserving at-80deg.C for standby.

3) cDNA was synthesized by Reverse Transcription (RT) PCR using reverse transcription kit. The PCR reaction system comprises: 14. Mu.L RNase-free deionized H ₂ O, 4. Mu.L of 5X HiScript II Select qRT SuperMix II, 1. Mu.L of Oligo (dT) ₂₃ VN (14. Mu.M) and 1. Mu.L total RNA; the PCR reaction conditions are that the temperature is kept at 50 ℃ for 15min, the temperature is kept at 85 ℃ for 5s, and the cDNA synthesis reaction is completed after cooling to 4 ℃ for preservation.

4) The contig sequence was verified. A pair of primers 17194F (ATGCCTTACCTATCGGCTAGG shown in SEQ ID NO: 7) and 17194R (CGTAAGCACGCGCCACAA shown in SEQ ID NO: 8) were designed based on a sequence of contig17194_8 which was 51.48% homologous to the Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) EPT gene (GenBank accession number XP_ 001692856.1) and was 720bp long, and PCR amplification was performed using the thus-synthesized cDNA as a template.

The PCR product is connected to a cloning vector pEASYR according to the specification provided by the full-scale golden organism Co., ltd (Beijing) by using a glue recovery kit produced by Tiangen Biochemical technology (Beijing) Co., ltd.) and recovering the PCR product according to the specification, and TA cloning is completed, wherein the connection system is as follows: 4. Mu.L of the gel recovered product and 1. Mu.L of pEASYR vector. Then, the pEASYR vector carrying the target fragment is transformed into competent cells of escherichia coli Trans1-T1 by a heat shock method, and the transformation process is as follows: adding the connection reaction solution into 50 mu L of escherichia coli Trans1-T1 competent cells, and gently swirling and vibrating the content of the centrifuge tube; completely burying the centrifuge tube in ice for 30min; placing on ice for 3min after heat shock at 42 ℃ for 45 s; adding 500 mu L of LB liquid medium (without antibiotics) into each centrifuge tube, shake culturing for 1h at a speed of 200rpm at 37 ℃, sucking 50-100 mu L of transformed competent cells into LB (ampicillin sodium containing (Amp) and 100 mu g/mL) agar medium, uniformly smearing the cells onto the liquid to be absorbed, inverting the plate, and culturing overnight at 37 ℃ to form single colonies; 3-5 single colonies are picked up, and shake-cultured in LB (2-3 mL) liquid medium containing Amp at 37 ℃ and a rotating speed of 200rpm for 10-16 h. Then, colony PCR amplification reaction is utilized to detect whether the positive clone thalli contains target genes, and the reaction system is as follows: 2 xRT Primer Mix 12.5. Mu.L, RNase-free deionized water 9.5. Mu.L, 1. Mu.L each of the upstream and downstream primers identical to the cloning of the target gene fragment, and 1. Mu.L each of the bacterial liquid template. The colony PCR reaction program is as follows: pre-denaturation at 94℃for 3min; denaturation at 94℃for 50s, annealing at 64℃for 45s, extension at 72℃for 2min,30 cycles; finally, the extension is carried out for 10min at 72 ℃. Split charging 1mL of the verified positive clone bacterial liquid, sending to Shanghai biological engineering Co., ltd for sequencing, and verifying the contig sequence.

5) Cloning of the full-length cDNA sequence of MiEPT gene. Designing a gene specific primer according to the verified contig sequence, and respectively obtaining cDNA sequences of 3'/5' -ends of the gene by using RACE technology, wherein the method specifically comprises the following steps:

(1) using Smart ^TM The RACE cDNA amplification kit synthesizes first cDNA strand of 5'-RACE and 3' -RACE.

First strand cDNA Synthesis of 5' -RACE. The PCR synthesis system contained 1.75. Mu.L of RNase-free deionized H ₂ O, 1. Mu.L total RNA, 1. Mu.L 5' -RACE CDS Primer A. The PCR reaction conditions were 72℃for 3min, cooled to 4℃for storage, removed and briefly centrifuged, and then 2. Mu.L of 5 Xfirst strand buffer, 1. Mu.L of Dithiothreitol (DTT) (20 mM), 1. Mu.L of dNTP (10 mM), 1. Mu.L of Smart Scribe reverse transcriptase, 1. Mu.L of SMART IIA, 0.25. Mu.L of RNase inhibitor were added, and the PCR reaction conditions were: maintaining at 42deg.C for 3min, maintaining at 72deg.C for 10min, cooling to 4deg.C, and preserving; after taking out, 100. Mu.L Tricine-EDTA solution (10 mM Tricine-NaOH,0.1mM EDTA,pH 8.1) was added for dilution, and the mixture was stored in a refrigerator at-20℃for use.

First strand cDNA Synthesis of 3' -RACE. The PCR synthesis system contained 2.75. Mu.L of RNase-free deionized H ₂ O and 1. Mu.L of 3'-RACE CDS Primer A, other reaction compositions and reaction conditions are consistent with the first strand cDNA synthesis reaction of 5' -RACE, and the reaction mixture is diluted and stored for later use.

(2) PCR reaction of 5'-RACE with 3' -RACE.

5' -RACE used a nested PCR reaction. First round PCR reactionComprises 12.5. Mu.L of 2 (Taq PCR Master Mix, 9.5. Mu.L of RNase-free deionized H) ₂ O, 1. Mu.L of 5'-RACE cDNA first strand reaction solution as a template, 1. Mu.L of primer 5' RACE (1) (GCCACCAGGCTTGTACTGATACTGCTTC, SEQ ID NO: 9), 1. Mu.L of primer UPM (kit self-contained), the reaction conditions were: denaturation at 94℃for 30s, annealing at 71℃for 45s and extension at 72℃for 2min,20 cycles; finally, the extension is carried out for 10min at 72 ℃. The second round of PCR reaction contained 2. Mu.L of the first round PCR product as template, primers 5' RACE (2) (CGTCACTGCCCAGTTCCAGAAGG, shown as SEQ ID NO: 10) and NUP in the kit, and the other components reacted with the first round under the following conditions: denaturation at 94℃for 30s, annealing at 70℃for 45s and extension at 72℃for 2min for 30 cycles; finally, the extension is carried out for 10min at 72 ℃.

3' -RACE also used a nested PCR reaction. The first round PCR reaction system is basically the same as the first round PCR reaction system of 5' -RACE, except that the first strand cDNA reaction solution with 3' -RACE as the template, the gene specific primer is 3' RACE (1) (AGCCAACTATGCGCTCGTCATCCT, shown as SEQ ID NO: 11), and the reaction conditions are as follows: denaturation at 94℃for 30s, annealing at 70℃for 30s and extension at 72℃for 2min,20 cycles; finally, the extension is carried out for 10min at 72 ℃. The second round PCR reaction system contained 2. Mu.L of the first round PCR product as template, 3' RACE (2) (CCGCACTTTTGGGGCACACACCT as shown in SEQ ID NO: 12) as primers and NUP in the kit, and the other components reacted with the first round. The reaction conditions are denaturation at 94 ℃ for 30s, annealing at 72 ℃ for 1min and extension at 72 ℃ for 2min, and 30 cycles are total; finally, the extension is carried out for 10min at 72 ℃. The products after the second round of PCR reaction are subjected to the procedures of gel recovery, connection, transformation, blue-white spot screening, sequencing and the like according to the method of 4), so that cDNA sequences of the 5 '-end and the 3' -end of MiEPT are obtained.

6) Cloning of the DNA sequence of the MiEPT gene. The cDNA of the 5 '-end and the cDNA of the 3' -end obtained in the above were spliced with the verified contig sequence to obtain the full-length cDNA sequence of MiEPT. Five pairs of primers are designed according to the method, and are shown as SEQ ID NO. 13 to SEQ ID NO. 22, namely D1F (CAACTTGATCACGCTCAC) and D1R (GCTTGCCATCCAGGCAGT), D2F (GGGTGCCATCCTCATGCTGG) and D2R (TCAGCGGCCAGCCACG), D3F (ATGCCTTACCTATCGGCTAG) and D3R (GTGAGCGTGATCAAGTTG), D4F (ACTGCCTGGATGGCAAGC) and D4R (AGGTCTAGCGACGCAGCG), D5F (ATGCCTTACCTATCGGCTAG) and D5R (TCAGCGGCCAGCCACG) respectively, and PCR amplification is carried out by taking the genomic DNA of the chlorella abscissae as a template, wherein the amplification conditions are as follows: pre-denaturation at 94℃for 5min; denaturation at 94℃for 45s, annealing at 65℃for 45s and extension at 72℃for 2min,35 cycles; finally, the mixture is extended for 10min at 72 ℃ and stored at 10 ℃. And (3) carrying out glue recovery and TA cloning on the PCR product according to the method of the 4), and sending the PCR product to Shanghai biological engineering company for sequencing to obtain the DNA sequence of the Chlorella anaplastic MiEPT.

7) Construction and transformation of recombinant expression plasmid pET/MiEPT.

(1) Construction of recombinant cloning plasmid pEASYR/MiEPT. Primers eEcoRI (F) with restriction sites (gaattcATGCCTTACCTATCGGCTAG, lower case EcoRI restriction site shown in SEQ ID NO: 5) and eNotI (R) (gcggccgcTCAGCGGCCAGCCACGC, lower case NotI restriction site shown in SEQ ID NO: 6) were designed based on the sequence of the ORF of MiEPT, cloning plasmid pEASYR and expression plasmid pET23a multiple cloning site, and amplified to the ORF fragment with restriction sites of MiEPT using PCR amplification technique. 25. Mu.L of the amplification system included 1. Mu.L of cDNA, 12.5. Mu.L of 2X Taq PCR Master Mix, 9.5. Mu.L of deionized H ₂ O, 1. Mu.L of upstream primer and 1. Mu.L of downstream primer; the PCR reaction conditions were: pre-denaturation at 94℃for 4min; denaturation at 94℃for 30s, annealing at 65.5℃for 30s, extension at 72℃for 2min, run for 35 cycles; extending at 72deg.C for 10min, and preserving at 10deg.C. The PCR product is subjected to glue recovery and TA cloning according to the method of the 4), a cloning plasmid pEASYR/MiEPT carrying the target fragment is constructed, and then the cloning plasmid pEASYR/MiEPT is sent to Shanghai biological engineering company for sequencing to ensure the accuracy of the sequence of the target fragment.

(2) Construction of recombinant expression plasmid pET/MiEPT. Extracting plasmid pEASYR/MiEPT from bacterial liquid with correct sequence, and respectively carrying out double enzyme digestion reaction on the plasmid pEASYR/MiEPT and expression plasmid pET23a by using restriction enzymes EcoRI and NotI, wherein the reaction is carried out for 4 hours at 37 ℃; the enzyme digestion reaction system comprises: mu.L of 10 XK buffer, 6. Mu.L of pEASYR/MiEPT or pET23a, 1. Mu.L of NotI, 1. Mu.L of EcoRI and 10. Mu.L of deionized H ₂ O. Recovering the target fragment and the large pET23a fragment after enzyme cutting by using the glue, and connecting the target fragment and the large pET23a fragment by using a T4 DNA ligase to obtain a recombinant expression vector pET/MiEPT; the connection reaction system is as follows: mu.L of the target gene fragment, 7. Mu.L of pET23a fragment, 1. Mu.L of T4 ligase and 2.5. Mu.L of 10 XK buffer were added, followed by the removal of ion H ₂ O to 25Mu L. The ligated product was transformed into E.coli Trans1-T1 competent cells according to the method of 4) above, and subjected to cloning, colony PCR verification and sequencing.

(3) Transformation of recombinant expression plasmid pET/MiEPT. And (3) extracting recombinant expression plasmid pET/MiEPT from a bacterial liquid with correct sequencing by using a plasmid extraction kit, and converting the pET/MiEPT into competent cells of escherichia coli BL21 (DE 3) according to the method of the 4) after the verification of double enzyme digestion reaction. Culturing and absorbing the converted bacterial liquid for PCR verification, and sending the bacterial liquid carrying the target genes after verification to Shanghai engineering and bioengineering company for sequencing.

8) And (3) inducible expression and purification of the recombinant protein rMiEPT. Bacterial liquid carrying recombinant plasmid pET/MiEPT with correct sequencing is inoculated in LB liquid culture medium according to the proportion of 1:1000 (bacterial liquid: LB liquid culture medium), and is subjected to shaking activation culture for 10-12 h at 37 ℃ at the rotating speed of 200 rpm. Then the activated bacterial liquid is cultured in LB culture medium containing 100 mug/mL Amp at 37 ℃ according to the ratio of 1:100 (activated bacterial liquid: LB liquid culture medium) in an oscillating way until the OD of the bacterial liquid is reached ₆₀₀ The value was 0.6 to 0.8, and 35. Mu.g/mL of chloramphenicol and IPTG (final concentration: 0.1 mM) were added thereto, and the culture was performed at 25℃with shaking at 200rpm to induce the expression of the target protein.

Bacterial liquid induced for 4h was centrifuged at 7000rpm for 5min at 4℃and the precipitated cells were resuspended in buffer (50 mM Tris-HCl buffer (pH=8.0), leupeptin (5. Mu.g/mL) and 1mM phenylmethylsulfonyl fluoride). 50. Mu.L of the resuspended whole bacteria were mixed with 2 Xprotein loading buffer (100 mM Tris-HCl (pH=6.8), 200mM DTT,4% SDS,20% glycerol, 0.2% bromophenol blue) at a ratio of 1:1, boiled in boiling water for 10min, and kept as a sample. Detecting the induced expression condition of recombinant protein by utilizing Sodium Dodecyl Sulfate (SDS) -polyacrylamide gel electrophoresis (PAGE), freezing the resuspended whole bacteria at-20 ℃, dissolving at normal temperature, performing ultrasonic disruption until the solution is transparent, removing cell fragments by centrifugation (15000 Xg, 10 min), and performing ultracentrifugation on the supernatant at the speed of 100000 Xg for 60min to obtain the supernatant, namely purified recombinant protein rMiEPT, which is used for detecting the enzyme protein and the activity thereof.

9) And (5) detecting recombinant protein rMiEPT. Purified recombinant eggs were subjected to SDS-PAGEThe white rMiEPT is subjected to gel electrophoresis and Western immunoblotting is carried out by utilizing an anti-polyhistidine tag antibody, and the expression condition of target proteins in the strain carrying the recombinant expression plasmid pET/MiEPT is analyzed. Western immunoblotting method is as follows: immersing filter paper, sponge and nitrocellulose membrane (NC membrane) for membrane transfer and electrophoresis protein gel in membrane transfer buffer solution (3.03 g Tris, 14.4g glycine, 200mL methanol, constant volume of water to 1000 mL), electrophoresis for 45min under 100V voltage and 200mA current, and transferring protein from gel to NC membrane; firstly, dyeing the NC membrane subjected to electric conversion with ponceau, and judging whether the protein is successfully transferred to the NC membrane; then the membrane is washed by deionized water for 5min to wash away the dye liquor on the surface of the membrane; then washed 3 times with TBST (0.137M NaCl, 2.7mM KCl, 0.025M Tris,pH 7.4, with 0.05% Tween 20) solution, 5min each time; blocking the washed NC membrane with blocking solution (5% skimmed milk powder prepared by TBST) for 1h, and then washing with TBST solution for 3 times each for 5min; adding His-resistant diluted with blocking solution (dilution multiple 1/2000) ₆ The tag antibody is gently shaken by a shaker for 1h at normal temperature, and then washed by TBST solution for 3 times for 10min each time; adding HRP-labeled goat anti-rabbit secondary antibody diluted with blocking solution (dilution multiple 1/4000), and anti-His ₆ Incubation for 1h as tag antibody, washing 3 times with TBST solution for 10min each time; finally, the color development is carried out in a darkroom by using an enhanced HRP-DAB substrate color development kit (Tiangen Biochemical technology Co.), the strips on the NC film are observed to infer the expression condition of the target protein, and the target protein is photographed and stored.

10 Enzyme activity detection of recombinant protein rmept. The purified protein was subjected to enzymatic activity assay using Thin Layer Chromatography (TLC) method, the reaction mixture comprising: 50mM Tris-HCl buffer (pH=8), 5mM MnCl ₂ After incubation at 37℃for 10min, 600. Mu.L of chloroform-methanol (1:1, v/v) and 300. Mu.L of 0.9% KCl were added to terminate the reaction, and the reaction product was extracted into the organic phase after centrifugation at 8000 Xg for 5min, 1mM EGTA,0.5mM DAG,0.002% Tween 20 (w/v), 5. Mu.g of enzyme solution and 20. Mu.M CDP-ethanolamine. Then spotting onto silica gel 60F254 plate (Merck) with capillary, developing with developing agent composed of chloroform-methanol-water (65:35:8, v/v/v), taking out TLC thin plate, developing with copper sulfate solution, and placing inBaking at 180deg.C for 5min, checking PE generation condition in reaction against PE standard sample.

3. Results

1) Gene cloning of MiEPT. Primers 17194 (F) and 17194 (R) were designed according to a Contig17194_8 sequence which was selected to be 720bp long, and a product band (lane 1 of FIG. 1) with the size of 720bp was amplified by using the cDNA of Chlorella ananatis as a template, and the sequence of the target band was determined by cloning, sequencing and comparison. Amplifying and sequencing by using RACE technology to obtain 5'-RACE and 3' -RACE products (

lanes

3 and 2 in FIG. 1) with the sizes of 217bp and 1200bp respectively, splicing the products with the verified contig sequence, and carrying out PCR amplification verification by redesigning primers to obtain the full-length cDNA sequence (SEQ ID NO: 1) of the chlorella protothecoides MiEPT with the length of 1914bp, wherein the 5 '-untranslated region (UTR) is longer than 217bp, the 3' -UTR is longer than 533bp, the Open Reading Frame (ORF) is longer than 1164bp, and the protein (SEQ ID NO: 2) consisting of 387 amino acid residues is encoded. The gene had 61% homology with the amino acid sequence of the protein encoded by EPT (GenBank accession number: XP_ 005646944) of Coccomyxa subellipsoidea C-169, and thus the gene cloned from Chlorella incisa was designated MiEPT.

5 pairs of primers D1F and D1R, D F and D2R, D F and D3R, D4F and D4R and D5F and D5R are designed according to the full-length sequence of cDNA of MiEPT, the genome DNA of the green alga abscissas is used as a template for amplification and sequencing to obtain products with the sizes of 248bp, 479bp, 410bp, 224bp and 2103bp (lanes 4 to 8 in FIG. 1), and the DNA sequence with the length of 2853bp (SEQ ID NO: 3) is obtained by splicing and redesigning the primers for PCR amplification verification. Comparing the cDNA with the DNA sequence, and the result shows that the initiation codon and the termination codon of MiEPT are respectively positioned at 218-220bp and 2318-2320bp of the DNA sequence; contains 6 introns located at positions 322-576bp, 687-773bp, 908-1004bp, 1132-1217bp, 1431-1708bp and 1929-2064bp of DNA sequence, respectively, which are 255bp, 87bp, 97bp, 86bp, 278bp and 136bp from the 5' end, respectively, so as to divide the ORF region into 7 exons (FIG. 2). Bioinformatics analysis of the protein encoded by the ORF of MiEPT revealed that it had a relative molecular mass of 42.2kDa, an isoelectric point of 8.15, and no signal peptide or transit peptide, but 8 transmembrane regions.

2) Construction and transformation of MiEPT prokaryotic recombinant expression plasmid. Designing primers eEcoRI (F) (SEQ ID NO: 5) and eNotI (R) (SEQ ID NO: 6) with enzyme cutting sites based on the ORF sequence of MiEPT, cloning plasmid pEASYR and the sequence of expression plasmid pET23a multiple cloning site (figure 3), amplifying to obtain the ORF region sequence of MiEPT with enzyme cutting sites by taking cDNA of the Chlorella ananatis as a template, and connecting to cloning plasmid pEASYR to construct recombinant cloning plasmid pEASYR/MiEPT; then, the desired fragment was ligated to construct a recombinant expression plasmid pET/MiEPT by double digestion of pEASYR/MiEPT (FIG. 4, lane 2) and expression plasmid pET23a (FIG. 4, lane 3) with EcoRI and NotI. The expression plasmid was extracted and subjected to double digestion reaction by EcoRI and NotI, and the product thereof was detected by electrophoresis (FIG. 4, lane 4) and only fragments of the size of the target gene (1164 bp) and the size of the vector sequence (3666 bp) appeared, indicating that the recombinant expression plasmid pET/MiEPT had been successfully constructed. The pET/MiEPT is transformed into competent cells of escherichia coli BL21 (DE 3), and a transgenic cell line ET/MiEPT/BL is screened.

3) And (3) inducible expression and purification of the recombinant protein rMiEPT. The transgenic cell line ET/MiEPT/BL is subjected to expansion culture, IPTG and chloramphenicol are added for induction culture, thalli are collected, and cells are crushed after freeze thawing, so that the protein is obtained. On the constructed recombinant expression plasmid pET/MiEPT, there is an N-T7 at the upstream of the inserted target fragment, a base sequence for encoding 6 His at the downstream, and a sequence suitable for other enzyme cutting sites carried on the plasmid (figure 3), so that 26 amino acids (SEQ ID NO: 4) are added on the basis of the original 387 amino acids, and the predicted molecular weight of the recombinant expression protein is 45.1kDa. Bands of the total protein (lanes 3 to 5 of FIG. 5) were found by SDS-PAGE.

After induced culture for 4 hours, the transgenic cell line ET/MiEPT/BL is used for collecting thalli, and cells are broken by ultrasound after freeze thawing. Electrophoresis after high-speed centrifugation found that the target protein was mainly present in the supernatant (FIG. 6, lane 2), whereas the protein band was very weak in the pellet (FIG. 6, lane 3). The supernatant was taken and ultracentrifuged, and the band of the target protein was found to exist in the supernatant by electrophoresis (FIG. 6, lane 4), while the band of this size was lacking in the pellet (FIG. 6, lane 5). Collecting the supernatant after ultracentrifugation to obtain a fractionPurified recombinant protein rMiEPT. By means of commercial His ₆ Western blot analysis of purified recombinant protein rMiEPT by Tag universal antibody showed only a single signal on the immunoblot (FIG. 6, lane 6), which was located exactly in line with the predicted molecular weight size of His Tag fusion expressed protein (about 45.1 kD), and also in line with the electrophoresis results of fusion expressed protein of interest (FIG. 5, lanes 3 to 5), whereas no band of this size was present on the lane containing only the soluble protein of empty plasmid pET23a E.coli (as negative control) (FIG. 5, lanes 1 and 7). The results showed that the partially purified protein obtained after ultracentrifugation contained the recombinant protein of interest, rmept, and that this band was the darkest of all bands (fig. 6, lane 4), which was approximately 44% of the total protein as analyzed by ImageJ software, indicating that rmept was the major part of the total protein after purification.

4) An in vitro enzyme reaction system is constructed to identify the function of the recombinant protein rMiEPT. The purified recombinant protein rMiEPT is added into a reaction system containing CDP-ethanolamine and DAG, the reaction is stopped after 10min, and the reaction product is extracted and subjected to thin layer chromatography. The results of thin layer chromatography (FIG. 7) showed that PE production was detected in the reaction system with purified rMiEPT added (FIG. 7, lane 1), but not in the reaction system with purified protein and the blank control added from the autorotation empty plasmid pET23a strain (FIG. 7, lanes 2 and 3), indicating that the prokaryotic recombinant rMiEPT was able to synthesize CDP-ethanolamine and DAG as PE in vitro, thus identifying the function of EPT from the cloned MiEPT encoded protein from Chlorella incisa.

The previous description of the embodiments is provided to facilitate a person of ordinary skill in the art in order to make and use the present invention. It will be apparent to those having ordinary skill in the art that various modifications to these embodiments can be readily made and the generic principles described herein may be applied to other embodiments without the use of inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art will appreciate that, in light of the principles of the present invention, improvements and modifications can be made without departing from the scope of the invention.

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

Sequence listing

<110> Shanghai university of ocean

<120> Gene sequence of Chlorella protothecoides CDP-ethanolamine diacylglycerol ethanolamine phosphotransferase and use thereof

<141> 2020-02-18

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1914

<212> DNA

<213> Unknown (Unknown)

<400> 1

acatggggag agagtctgcc tgtgtccagc aacagccgcc cgcccggtct tcaccctttt 60

gcctgcttgt gattgcgcac caaccttgac tggtgcccag ttgcagcttt cgttccaagc 120

agccgttgtg ggtcaagccg ttggtgggta gtcagagggg ttacccggaa gctggttgtt 180

ccttggatac cggcaactct cttcgaatct gcacaccatg ccttacctat cggctagggc 240

cctgaagggc ctgaagcagt atcagtacaa gcctggtggc tacaccaagc tagacgactt 300

gcatcagccc ttctggaact gggcagtgac gctgttcccc atgtgggttg cgcccaactt 360

gatcacgctc actggcatag gcggcctagt agtggcttac ctgctgacgg cggtgtactc 420

gcccgagctc tcaggcgaga tgccgcgctg ggtgtacttc ctgaacggct ttgcctgcct 480

ggcctacatg cacctcgact gcctggatgg caagcaggcg cggcgaacca agacgtcctc 540

cccgctgggc cagctctttg atcacggctg tgacgccctt tcggtgcagc tcatcgtgac 600

ggccatcgct gcgtcgctag acctgggtgt cagtaagatc gccgttggcg gtgcaatggc 660

catcctagtg ccctggattc tggcccactg ggaggagtac catacaggca acatgctgta 720

tggcaatggc tactggggcc tgacggaagc caactatgcg ctcgtcatcc tgcactttgc 780

gaccgccgcc tttgggccgc acttttgggg cacacacctg tccagcctgg tgcacatgaa 840

gctgcccatc gacgtgacgg tcaaggagag cctgctgctg gcggtcagca tctttgcgag 900

catgcaggtg gccgggcagt tgtggcgcgt gcttacgagg cggcaccccc cgctgccggc 960

gccggagcgc gggcacaagc agctgggctc cggacatgcg gcctcccacc ttgcgcaggt 1020

ggtcctcatc ctgggcctgg gtgccatcct catgctggag cctgcctcgg cgcatggcca 1080

ggcgcgcgta gtcgtcgcca cctatgggct tgtgtatgct ctggaggcca ccaagctgat 1140

tatggaccac atggcgaagg agccctttga gatcacctgg tggccagtgg ccctgcttgt 1200

cgtctacatc atcaacaacc gcctgttgct ggtgccagcc gcgccgctcg cctggatcat 1260

cctggccatc actatggccg gctacgtcca gtatgtgact gccgtgtgcg gggagatctg 1320

tgcatacctg ggcatcaact gcctcaccat tcgcaaggcc gacggcgtgg ctggccgctg 1380

acacacgcac ctgtaacagc caatcttcgt gactgccatg gtgctgttcg aagtgacttt 1440

ttgatgagta gcagagcgct gtgatcggaa tgttcaagtg ctgggcgtgc gatgcagcaa 1500

gtgggcatca ttgctgacag cttgaggcaa aaagcagcac tgctgtgctg caagcaggag 1560

taatcagagc gatcaggagc acttcttacc ctgtagctag ctgatcaggg acagggtgtc 1620

atagaccatc acatcgagct gtggtgccgt tgatgctacg tagtcagcgc cctggtattt 1680

cttccttttt gtcattagtc atacaggtag gagcagtggc tttactgcag cctcatgcct 1740

agcgaagttt aacccagtgt ttctgaacgt gaggccaccg ggcaggacac ctcagtgttg 1800

gcgcatcttg tggtagtttg ccatgcaacc aggctgtcag atgtcacatg ctcaagcatg 1860

gacatgcatg cagctcatca tgtgatgcag catcaatctg taactgatgc atgt 1914

<210> 2

<211> 387

<212> PRT

<213> Unknown (Unknown)

<400> 2

Met Pro Tyr Leu Ser Ala Arg Ala Leu Lys Gly Leu Lys Gln Tyr Gln

1 5 10 15

Tyr Lys Pro Gly Gly Tyr Thr Lys Leu Asp Asp Leu His Gln Pro Phe

20 25 30

Trp Asn Trp Ala Val Thr Leu Phe Pro Met Trp Val Ala Pro Asn Leu

35 40 45

Ile Thr Leu Thr Gly Ile Gly Gly Leu Val Val Ala Tyr Leu Leu Thr

50 55 60

Ala Val Tyr Ser Pro Glu Leu Ser Gly Glu Met Pro Arg Trp Val Tyr

65 70 75 80

Phe Leu Asn Gly Phe Ala Cys Leu Ala Tyr Met His Leu Asp Cys Leu

85 90 95

Asp Gly Lys Gln Ala Arg Arg Thr Lys Thr Ser Ser Pro Leu Gly Gln

100 105 110

Leu Phe Asp His Gly Cys Asp Ala Leu Ser Val Gln Leu Ile Val Thr

115 120 125

Ala Ile Ala Ala Ser Leu Asp Leu Gly Val Ser Lys Ile Ala Val Gly

130 135 140

Gly Ala Met Ala Ile Leu Val Pro Trp Ile Leu Ala His Trp Glu Glu

145 150 155 160

Tyr His Thr Gly Asn Met Leu Tyr Gly Asn Gly Tyr Trp Gly Leu Thr

165 170 175

Glu Ala Asn Tyr Ala Leu Val Ile Leu His Phe Ala Thr Ala Ala Phe

180 185 190

Gly Pro His Phe Trp Gly Thr His Leu Ser Ser Leu Val His Met Lys

195 200 205

Leu Pro Ile Asp Val Thr Val Lys Glu Ser Leu Leu Leu Ala Val Ser

210 215 220

Ile Phe Ala Ser Met Gln Val Ala Gly Gln Leu Trp Arg Val Leu Thr

225 230 235 240

Gly Arg His Pro Pro Leu Pro Ala Pro Glu Arg Gly His Lys Gln Leu

245 250 255

Gly Ser Gly His Ala Ala Ser His Leu Ala Gln Val Val Leu Ile Leu

260 265 270

Gly Leu Gly Ala Ile Leu Met Leu Glu Pro Ala Ser Ala His Gly Gln

275 280 285

Ala Arg Val Val Val Ala Thr Tyr Gly Leu Val Tyr Ala Leu Glu Ala

290 295 300

Thr Lys Leu Ile Met Asp His Met Ala Lys Glu Pro Phe Glu Ile Thr

305 310 315 320

Trp Trp Pro Val Ala Leu Leu Val Val Tyr Ile Ile Asn Asn Arg Leu

325 330 335

Leu Leu Val Pro Ala Ala Pro Leu Ala Trp Ile Ile Leu Ala Ile Thr

340 345 350

Met Ala Gly Tyr Val Gln Tyr Val Thr Ala Val Cys Gly Glu Ile Cys

355 360 365

Ala Tyr Leu Gly Ile Asn Cys Leu Thr Ile Arg Lys Ala Asp Gly Val

370 375 380

Ala Gly Arg

385

<210> 3

<211> 2853

<212> DNA

<213> Unknown (Unknown)

<400> 3

acatggggag agagtctgcc tgtgtccagc aacagccgcc cgcccggtct tcaccctttt 60

gcctgcttgt gattgcgcac caaccttgac tggtgcccag ttgcagcttt cgttccaagc 120

agccgttgtg ggtcaagccg ttggtgggta gtcagagggg ttacccggaa gctggttgtt 180

ccttggatac cggcaactct cttcgaatct gcacaccatg ccttacctat cggctagggc 240

cctgaagggc ctgaagcagt atcagtacaa gcctggtggc tacaccaagc tagacgactt 300

gcatcagccc ttctggaact ggtagtcatt tgacggttga tcagactact aacgacagta 360

tagcatggtg gcgttacctt ctggaagcct tctcagcccc tggcgacttc atcctgtgca 420

cagtggcttg cagcgttgct gcagtgttcc tccaagcacc tttactgttc tggaagctga 480

caggctactc atgccgttac tctgtccgga gcattgacag ccgccaagcc gccagaccac 540

tgccagcgcc ttacacctct tcctgctgtg atgcagggca gtgacgctgt tccccatgtg 600

ggttgcgccc aacttgatca cgctcactgg cataggcggc ctagtagtgg cttacctgct 660

gacggcggtg tactcgcccg agctctgtca ggtatgtgct gttgtcaacc gtgttgcttg 720

gggagtgctg ttgccctggg tgctgagctt tactcgcctg ggttggatgt cagcaggcga 780

gatgccgcgc tgggtgtact tcctgaacgg ctttgcctgc ctggcctaca tgcacctcga 840

ctgcctggat ggcaagcagg cgcggcgaac caagacgtcc tccccgctgg gccagctctt 900

tgatcacgtg gtgggcattc ctatgcttgc tctcactttc aatcccaacc gagtacgcaa 960

cggcctaagc cacagctcag cgctggtctg cattcttccc gcagggctgt gacgcccttt 1020

cggtgcagct catcgtgacg gccatcgctg cgtcgctaga cctgggtgtc agtaagatcg 1080

ccgttggcgg tgcaatggcc atcctagtgc cctggattct ggcccactgg ggtaggtaaa 1140

cacatgcgct tgaaacggag ctgcagttgc tcatcgagcg caagcacttg atggtcaagt 1200

agtgtgtttg gctgcagagg agtaccatac aggcaacatg ctgtatggca atggctactg 1260

gggcctgacg gaagccaact atgcgctcgt catcctgcac tttgcgaccg ccgcctttgg 1320

gccgcacttt tggggcacac acctgtccag cctggtgcac atgaagctgc ccatcgacgt 1380

gacggtcaag gagagcctgc tgctggcggt cagcatcttt gcgagcatgc gtaggcaagc 1440

agcaggcact acgattttga gccctgcata ccagcgttgc tcggcggcat gttgatgtgt 1500

gaatcttggc ctgttcttgt gactctccac catgctcagc ctcccctgct ttcaggattg 1560

cctgcacgtc tcatcaacct ggcaaggcaa ggcagcgttg agtttaccca tgggtcagat 1620

ggccctcaag actgccacat cccctgagct tggacctatt tggggactac atacatccgg 1680

gtgcgacagt tgctgccggc atgcgtagag gtggccgggc agttgtggcg cgtgcttacg 1740

aggcggcacc ccccgctgcc ggcgccggag cgcgggcaca agcagctggg ctccggacat 1800

gcggcctccc accttgcgca ggtggtcctc atcctgggcc tgggtgccat cctcatgctg 1860

gagcctgcct cggcgcatgg ccaggcgcgc gtagtcgtcg ccacctatgg gcttgtgtat 1920

gctctggagt agggccggct gcatgcaaag ttgtcccgtt tggcacgctg ctcgatgccc 1980

tgcgctacac atatggcagc agcacagcct gaggtccttg caatgaggca cgtggagtta 2040

taagcatgta gctgttcgct gtagggccac caagctgatt atggaccaca tggcgaagga 2100

gccctttgag atcacctggt ggccagtggc cctgcttgtc gtctacatca tcaacaaccg 2160

cctgttgctg gtgccagccg cgccgctcgc ctggatcatc ctggccatca ctatggccgg 2220

ctacgtccag tatgtgactg ccgtgtgcgg ggagatctgt gcatacctgg gcatcaactg 2280

cctcaccatt cgcaaggccg acggcgtggc tggccgctga cacacgcacc tgtaacagcc 2340

aatcttcgtg actgccatgg tgctgttcga agtgactttt tgatgagtag cagagcgctg 2400

tgatcggaat gttcaagtgc tgggcgtgcg atgcagcaag tgggcatcat tgctgacagc 2460

ttgaggcaaa aagcagcact gctgtgctgc aagcaggagt aatcagagcg atcaggagca 2520

cttcttaccc tgtagctagc tgatcaggga cagggtgtca tagaccatca catcgagctg 2580

tggtgccgtt gatgctacgt agtcagcgcc ctggtatttc ttcctttttg tcattagtca 2640

tacaggtagg agcagtggct ttactgcagc ctcatgccta gcgaagttta acccagtgtt 2700

tctgaacgtg aggccaccgg gcaggacacc tcagtgttgg cgcatcttgt ggtagtttgc 2760

catgcaacca ggctgtcaga tgtcacatgc tcaagcatgg acatgcatgc agctcatcat 2820

gtgatgcagc atcaatctgt aactgatgca tgt 2853

<210> 4

<211> 413

<212> PRT

<213> Unknown (Unknown)

<400> 4

Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Phe Asn Met

1 5 10 15

Pro Tyr Leu Ser Ala Arg Ala Leu Lys Gly Leu Lys Gln Tyr Gln Tyr

20 25 30

Lys Pro Gly Gly Tyr Thr Lys Leu Asp Asp Leu His Gln Pro Phe Trp

35 40 45

Asn Trp Ala Val Thr Leu Phe Pro Met Trp Val Ala Pro Asn Leu Ile

50 55 60

Thr Leu Thr Gly Ile Gly Gly Leu Val Val Ala Tyr Leu Leu Thr Ala

65 70 75 80

Val Tyr Ser Pro Glu Leu Ser Gly Glu Met Pro Arg Trp Val Tyr Phe

85 90 95

Leu Asn Gly Phe Ala Cys Leu Ala Tyr Met His Leu Asp Cys Leu Asp

100 105 110

Gly Lys Gln Ala Arg Arg Thr Lys Thr Ser Ser Pro Leu Gly Gln Leu

115 120 125

Phe Asp His Gly Cys Asp Ala Leu Ser Val Gln Leu Ile Val Thr Ala

130 135 140

Ile Ala Ala Ser Leu Asp Leu Gly Val Ser Lys Ile Ala Val Gly Gly

145 150 155 160

Ala Met Ala Ile Leu Val Pro Trp Ile Leu Ala His Trp Glu Glu Tyr

165 170 175

His Thr Gly Asn Met Leu Tyr Gly Asn Gly Tyr Trp Gly Leu Thr Glu

180 185 190

Ala Asn Tyr Ala Leu Val Ile Leu His Phe Ala Thr Ala Ala Phe Gly

195 200 205

Pro His Phe Trp Gly Thr His Leu Ser Ser Leu Val His Met Lys Leu

210 215 220

Pro Ile Asp Val Thr Val Lys Glu Ser Leu Leu Leu Ala Val Ser Ile

225 230 235 240

Phe Ala Ser Met Gln Val Ala Gly Gln Leu Trp Arg Val Leu Thr Gly

245 250 255

Arg His Pro Pro Leu Pro Ala Pro Glu Arg Gly His Lys Gln Leu Gly

260 265 270

Ser Gly His Ala Ala Ser His Leu Ala Gln Val Val Leu Ile Leu Gly

275 280 285

Leu Gly Ala Ile Leu Met Leu Glu Pro Ala Ser Ala His Gly Gln Ala

290 295 300

Arg Val Val Val Ala Thr Tyr Gly Leu Val Tyr Ala Leu Glu Ala Thr

305 310 315 320

Lys Leu Ile Met Asp His Met Ala Lys Glu Pro Phe Glu Ile Thr Trp

325 330 335

Trp Pro Val Ala Leu Leu Val Val Tyr Ile Ile Asn Asn Arg Leu Leu

340 345 350

Leu Val Pro Ala Ala Pro Leu Ala Trp Ile Ile Leu Ala Ile Thr Met

355 360 365

Ala Gly Tyr Val Gln Tyr Val Thr Ala Val Cys Gly Glu Ile Cys Ala

370 375 380

Tyr Leu Gly Ile Asn Cys Leu Thr Ile Arg Lys Ala Asp Gly Val Ala

385 390 395 400

Gly Arg Ala Ala Ala Leu Glu His His His His His His

405 410

<210> 5

<211> 26

<212> DNA

<213> Unknown (Unknown)

<400> 5

gaattcatgc cttacctatc ggctag 26

<210> 6

<211> 25

<212> DNA

<213> Unknown (Unknown)

<400> 6

gcggccgctc agcggccagc cacgc 25

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atgccttacc tatcggctag g 21

<210> 8

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

cgtaagcacg cgccacaa 18

<210> 9

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gccaccaggc ttgtactgat actgcttc 28

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

cgtcactgcc cagttccaga agg 23

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

agccaactat gcgctcgtca tcct 24

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

ccgcactttt ggggcacaca cct 23

<210> 13

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

caacttgatc acgctcac 18

<210> 14

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gcttgccatc caggcagt 18

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

gggtgccatc ctcatgctgg 20

<210> 16

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

tcagcggcca gccacg 16

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

atgccttacc tatcggctag 20

<210> 18

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

gtgagcgtga tcaagttg 18

<210> 19

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

actgcctgga tggcaagc 18

<210> 20

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

aggtctagcg acgcagcg 18

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

atgccttacc tatcggctag 20

<210> 22

<211> 16

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

tcagcggcca gccacg 16

Claims

1. An isolated nucleic acid molecule, wherein the nucleotide sequence of the nucleic acid molecule comprises:

a) A nucleotide sequence as set forth in SEQ ID NO. 1 or SEQ ID NO. 3; or (b)

b) A nucleotide sequence complementary to the nucleotide sequence set forth in a).

2. The coded protein is characterized in that the amino acid sequence of the coded protein is shown as SEQ ID NO. 2.

3. Recombinant protein rMiEPT，The recombinant protein rMiEPT is characterized in that the amino acid sequence of the recombinant protein rMiEPT is shown as SEQ ID NO. 4.

4. A recombinant expression vector comprising the nucleic acid molecule of claim 1, constructed from the nucleic acid molecule and a plasmid.

5. The recombinant expression vector of claim 4, wherein said plasmid is a pET23a plasmid.

6. A genetically engineered host cell, wherein said host cell is selected from the group consisting of:

a host cell transformed or transduced with the nucleic acid molecule of claim 1 and its progeny; or (b)

Ii) a host cell transformed or transduced with the recombinant expression vector of claim 4 or 5 and its progeny.

7. Use of the nucleic acid molecule of claim 1, the encoded protein of claim 2, the recombinant protein of claim 3, the recombinant expression vector of claim 4 or 5, or the host cell of claim 6 in the catalytic synthesis of phosphatidylethanolamine.

8. The use according to claim 7, wherein any of said nucleic acid molecules, encoded proteins, recombinant expression vectors or host cells catalyses the synthesis of diacylglycerol and CDP-ethanolamine to phosphatidylethanolamine in the CDP-ethanolamine pathway.