CN106459940B - Novel catalase signal sequence and catalase expression method using same - Google Patents
Novel catalase signal sequence and catalase expression method using same Download PDFInfo
- Publication number
- CN106459940B CN106459940B CN201580028272.5A CN201580028272A CN106459940B CN 106459940 B CN106459940 B CN 106459940B CN 201580028272 A CN201580028272 A CN 201580028272A CN 106459940 B CN106459940 B CN 106459940B
- Authority
- CN
- China
- Prior art keywords
- catalase
- signal sequence
- ala
- leu
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
- C12N9/20—Triglyceride splitting, e.g. by means of lipase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01003—Triacylglycerol lipase (3.1.1.3)
Abstract
The present invention relates to a novel signal sequence for expressing catalase in a large amount and use thereof, and more particularly, to a novel lipase signal sequence, an expression vector comprising the signal sequence and a catalase gene, a recombinant microorganism introduced with the expression vector, and a method for mass production of catalase by culturing the recombinant microorganism. According to the expression vector comprising the novel signal sequence of the present invention, not only can a large amount of expression and secretion of a specific catalase be induced, but also a large amount of expression and secretion of other target proteins can be induced, thereby being very advantageous for stable mass production of the specific catalase and other target proteins.
Description
Technical Field
The present invention relates to a novel signal sequence for expressing catalase in a large amount and use thereof, and more particularly, to a novel lipase signal sequence, an expression vector comprising the signal sequence and a catalase gene, a recombinant microorganism introduced with the expression vector, and a method for mass production of catalase by culturing the recombinant microorganism.
Background
Catalase is a promoter of hydrogen peroxide (H)2O2) Conversion to oxygen (O)2) And water (H)2O). Most catalase enzymes comprise 4 polypeptide subunits, each having a molecular weight of 50000 to 60000, with one Heme (Heme) per subunit (Wasserman and Hultin (1981) Arch. biochem. Biophys.212: 385-.
Conventionally, various proteins for industrial use have been prepared by using yeast (Saccharomyces), Aspergillus niger (Aspergillus niger), Aspergillus oryzae (Aspergillus oryzae), and Trichoderma reesei (Trichoderma reesei), the stability of which has been widely known, and expression secretion plasmid vectors formed of a promoter (promoter) as a transcription activation sequence, DNA (deoxyribonucleic acid) encoding a secretion signal sequence, a structural gene of a target protein, and a transcription terminator (transcription terminator) have been used in order to express and secrete the target protein.
Currently, there are a signal sequence of a gene to be expressed and a signal sequence of aspergillus niger glucoamylase as secretion signal sequences used for secretion of a target protein from aspergillus niger, and a glucoamylase (glaA) promoter as a potent promoter.
However, the desired protein cannot be expressed in large amounts at present only by the currently known signal sequence. Therefore, there is a strong demand for a signal sequence that enables the efficient mass production of catalase, an industrially important enzyme, and the demand for such a signal sequence is continuously increasing.
To overcome the limitations of expression, the present inventors have intensively studied and developed a method capable of mass production of catalase using a genetic engineering method, and as a result, have developed a novel signal sequence for expression of catalase, and have confirmed that catalase can be expressed in a large amount using the signal sequence, thereby completing the present invention.
The above information described in the background section is only for improving understanding of the background of the present invention, and therefore, it may not contain information constituting a known prior art to those skilled in the art to which the present invention pertains.
Disclosure of Invention
The present invention aims to provide a novel lipase signal sequence for expressing catalase in a large amount, an expression vector comprising the signal sequence and a catalase gene, and a recombinant microorganism into which the expression vector is introduced.
Another object of the present invention is to provide a method for mass-producing catalase by culturing the recombinant microorganism.
To achieve the above object, the present invention provides An07g00440 lipase signal sequence represented by the amino acid sequence of SEQ ID NO. 1 and a modified lipase signal sequence represented by the amino acid sequence of SEQ ID NO. 2.
Also, the present invention provides an expression vector comprising a nucleic acid encoding the signal sequence and a target protein gene, and a recombinant microorganism into which the expression vector is introduced.
The present invention also provides a method for producing a target protein, comprising: a step (a) of culturing the recombinant microorganism to produce a target protein; and (b) recovering the target protein produced.
Drawings
FIG. 1 is a schematic diagram of an expression vector of the present invention. Part A is a schematic diagram showing in detail the respective parts of a promoter, a signal sequence, a foreign gene and the former stop codon when a cDNA (complementary deoxyribonucleic acid) of the foreign gene is cloned and inserted, part B is a schematic diagram when An07g00440 lipase signal sequence is further included, and part C is a schematic diagram when An07g00440 lipase modified signal sequence is further included.
FIG. 2 is a diagram showing expression vectors of examples 1 to 2. Part A shows a vector (pASP503) using a glaA promoter and a pdcA terminator and into which cDNA containing a self signal sequence can be cloned, part B shows a vector (pASPW504) using a glaA promoter and a pdcA terminator and containing An07g00440 lipase signal sequence, and part C shows a vector (pASPV505) using a glaA promoter and a pdcA terminator and containing An07g00440 lipase variant signal sequence.
FIG. 3 is a graph showing the results of the analysis of the culture solution of the recombinant microorganism in example 5, wherein part A shows the results of the analysis of the culture solution of the recombinant microorganism pASPF503PMC, part B shows the results of the analysis of the culture solution of the recombinant microorganism pASPW504PMC, and part C shows the results of the analysis of the culture solution of the recombinant microorganism pASPV505 PMC.
Detailed Description
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used in this specification is that conventionally used in the art.
In the present invention, An07g00440 lipase signal sequence, which can express a specific catalase and other target proteins in a large amount, and a modified lipase signal sequence were prepared; an expression vector comprising the signal sequence and a target protein gene; and a recombinant microorganism into which the expression vector has been introduced. As a result, it was confirmed that a large amount of catalase could be produced by culturing the recombinant microorganism prepared.
In one embodiment of the present invention, it was confirmed that a large amount of catalase can be produced by using the penicillium marneffei catalase gene of SEQ ID No. 6 as a nucleic acid encoding a target protein and using the novel signal sequence of the present invention. However, the examples are merely illustrative examples, and the present invention is applicable not only to a specific catalase but also to other target proteins.
Accordingly, one embodiment of the present invention relates to An07g00440 lipase signal sequence represented by the amino acid sequence of SEQ ID NO. 1 and a nucleic acid encoding the signal sequence.
The present invention is characterized in that the An07g00440 lipase signal sequence is derived from aspergillus niger (aspergillus niger), but is not limited thereto.
The present invention is characterized in that the nucleic acid encoding the signal sequence is represented by the base sequence of SEQ ID NO. 3, but is not limited thereto.
Another embodiment of the present invention relates to a modified lipase signal sequence represented by the amino acid sequence of SEQ ID NO. 2, wherein tyrosine (T) as the second amino acid of the An07g00440 lipase signal sequence is substituted with arginine (R) having positive charge, and isoleucine (isoleucine; I) as the third amino acid is substituted with tryptophan (T), and a nucleic acid encoding the modified lipase signal sequence.
The present invention is characterized in that the nucleic acid encoding the above-mentioned modified lipase signal sequence is represented by the base sequence of SEQ ID NO. 4, but is not limited thereto.
In another embodiment, the present invention relates to an expression vector comprising a nucleic acid encoding the lipase signal sequence and a target protein gene.
In the present invention, "vector" refers to a DNA product comprising a DNA (deoxyribonucleic acid) sequence operably linked to suitable regulatory sequences capable of expressing the DNA in a suitable host. The vector may be a plasmid, a phage particle or a simple latent genomic insert. If transformed into an appropriate host, the vector may be made to replicate and function independently of the host genome, or in some cases may be integrated into the genome itself. Since a plasmid is the most commonly used form of a vector at present, in the description of the present invention, "plasmid" and "vector" may be used interchangeably.
For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose have sequences that include: (a) an origin of replication, effective to achieve replication in such a way that each host cell contains hundreds of plasmid vectors; (b) antibiotic resistance genes, so that host cells transformed into plasmid vectors are screened; and (c) a restriction enzyme cleavage site to allow insertion of a foreign DNA fragment; the structure of (1). Even if there is no suitable restriction enzyme cleavage site, the vector and foreign DNA can be easily ligated (ligation) by using a synthetic oligonucleotide linker (oligonucleotide adapter) or a linker (linker) of a conventional method.
Furthermore, "operable linkage" can be realized when the gene and the other nucleic acid sequence are arranged in a functional relationship. This may be a gene and regulatory sequence(s) linked in such a way that they can be expressed when an appropriate molecule (e.g., a transcriptional activator protein) is associated with the regulatory sequence(s). For example, in the case where a DNA for a pre-sequence (pre-sequence) or a secretion leader (leader) is expressed as a whole protein involved in the secretion of a polypeptide, it is operably linked to the DNA for the polypeptide; when the transcription of a sequence is affected, a promoter or enhancer is operably linked to the coding sequence; the ribosome binding site is operably linked to the coding sequence when it affects the transcription of the sequence; alternatively, the ribosome binding site is operably linked to the coding sequence when it is configured in a manner that facilitates translation.
Generally, "operably linked" means that the DNA sequences being linked are in contact, and, in the case of a secretory leader, that the contact is complete and is present in the reading frame. However, enhancers (enhancers) need not be contiguous. Ligation of these sequences is achieved by ligation at convenient restriction enzyme sites. When such a site is not present, a synthetic oligonucleotide linker (oligonucleotide adapter) or a crosslinking agent (linker) according to a conventional method is used.
The target protein is a catalase, and the catalase is a Penicillium marneffei (Penicillium marneffei) catalase protein of sequence No. 5, but the target protein is not limited thereto.
The present invention is characterized in that the expression vector further comprises a glucoamylase promoter, but is not limited thereto.
The expression vector of the present invention is pASPW504PMC or pASPV505PMC, but is not limited thereto.
In another embodiment of the present invention, the present invention relates to a recombinant microorganism introduced with a nucleic acid encoding the lipase signal sequence and a target protein gene, or a recombinant microorganism introduced with the expression vector.
The present invention is characterized in that the recombinant microorganism is Aspergillus niger, but is not limited thereto.
The recombinant microorganism is generally a host cell having high efficiency of introducing DNA and high expression efficiency of the introduced DNA, and includes all microorganisms including prokaryotic cells and eukaryotic cells, and bacteria, yeast, mold, and the like can be used.
While not all vectors perform the same function in expressing the DNA sequences of the present invention, all hosts do not perform the same function in the same expression system. However, those skilled in the art to which the present invention pertains can appropriately select and use various other vectors, expression regulatory sequences, and hosts without any creative effort without departing from the scope of the present invention. For example, the host is considered in selecting the vector because it is desired to achieve replication of the vector within the host, and therefore the amount of replication of the vector, the ability to modulate the amount of replication, and the expression of other proteins encoded by the vector, such as antibiotic markers, are also considered.
The above-described transformed recombinant microorganism can be prepared according to any known transformation method. The "transformation" of the present invention means: introduction of DNA into a host so that the DNA can be replicated as a chromosomal factor or by chromosomal integration is a phenomenon in which an external DNA is introduced into a cell to artificially cause genetic changes.
In the present invention, a known gene manipulation method can be used as a method for inserting the gene into the chromosome of the host cell, and examples thereof include a method using a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a herpes simplex virus vector, a poxvirus vector, a lentivirus vector, or a non-virus vector.
In addition to the method using an expression vector, the transformation method may also use a method of direct insertion into the chromosome of the host cell.
In general, electroporation (electr) can be usedorganization), Lipofection (Lipofection), ballistic methods, viral particles, liposomes, immunoliposomes, multivalent cations or lipids: nucleic acid conjugates, naked DNA, artificial viruses (viron), chemical-facilitated DNA introduction, calcium phosphate (CaPO)4) Precipitate, calcium chloride (CaCl)2) Precipitation, microinjection (microinjection), lithium acetate-Dimethylsulfoxide (DMSO), and the like.
Methods utilizing the sonoporation (e.g., methods utilizing the Sonitron2000 system (Rich-Mar) can also be adapted for use in nucleic acid delivery, with other representative nucleic acid delivery systems including the methods of AmaxaBiosystems (Cologne, Germany), MaxCyte, Inc. (Rockville, Maryland), and BTX Molesularladem (Holliston, MA). Lipofectation methods are described in U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787 and U.S. Pat. No. 4,897,355, and lipofectin reagents are commercially available, for example, TRANSFECTAMTM and LIPOFECTINTM. Useful receptors for polynucleotides recognize cationic or neutral lipids for lipofection, including Felgner lipids (WO91/17424 and WO91/16024), which can be delivered to cells by in vitro introduction or to target tissues by in vivo introduction. Lipid containing target liposome such as immunoliposome complex: methods for preparing nucleic acid complexes are well known in the art (Crystal, science, 270: 404-.
In another embodiment, the present invention relates to a method for producing a target protein, comprising: a step (a) of culturing the recombinant microorganism to produce a target protein; and (b) recovering the target protein thus produced.
Examples
The present invention will be described in more detail below with reference to examples. These examples are merely illustrative of the present invention, and it should be understood by those skilled in the art that the scope of the present invention is not limited to these examples.
Example 1: preparation of expression vectors pASPW504 and pASPW505
1-1: chemical synthesis of An07g00440 lipase signal sequence and An07g00440 lipase modified signal sequence
In order to secrete catalase to the outside of A.niger, An07g00440 lipase signal sequence and An07g00440 lipase mutation signal sequence represented by SEQ ID NO. 3 or SEQ ID NO. 4 were chemically synthesized. The amino acid sequence of the protein encoded by the An07g00440 lipase signal sequence and the An07g00440 lipase mutation signal sequence of SEQ ID NO. 3 or SEQ ID NO. 4 (enciphentification) is SEQ ID NO. 1 or SEQ ID NO. 2, respectively.
The An07g00440 lipase signal sequence of SEQ ID NO. 1 consists of 2 amino acids in the N-domain (domain), 12 amino acids in the H-domain, and 5 amino acids in the C-domain (19 amino acids in total). The An07g00440 lipase mutation signal sequence of SEQ ID NO. 2 is a signal sequence in which tyrosine, which is the second amino acid, is converted into An arginine amino acid having a positive charge, and isoleucine, which is the third amino acid, is converted into tryptophan.
An07g00440 lipase signal sequence amino acid sequence (SEQ ID NO: 1):
myipsvlllaaslfhgata
an amino acid sequence of An07g00440 lipase modified signal sequence (SEQ ID NO: 2):
mrwpsvlllaaslfhgata
an07g00440 lipase signal sequence base sequence (SEQ ID NO: 3):
atgtatatcccctcggtgctgcttctggccgcgagcctgttccatggcgcaacg
a base sequence of An07g00440 lipase modified signal sequence (SEQ ID NO: 4):
atgcgctggccctcggtgctgcttctggccgcgagcctgttccatggcgcaacggcc
1-2: preparation of expression vectors pASPW504 and pASPV505
A69 bp single-stranded oligonucleotide (oligonucleotide) was chemically synthesized at each of both ends of the signal sequence base sequence to have recognition sites for restriction enzymes ClaI and NaeI, and annealing (annealing) reaction was performed to prepare a double-stranded oligonucleotide from the single-stranded oligonucleotide. Fragments of 69bp in size were recovered separately. The recovered fragments were cut with restriction enzymes ClaI and NaeI in the pASPF503 vector, and cloned, and then named pASPW504 and pASPV505 (FIGS. 1 and 2), respectively.
The pASPF503 vector contains glaA promoter and pdcA terminator, contains hygromycin resistance gene, hygromycin B phosphotransferase (FIGS. 1 and 2). Hygromycin B inserts into the peptidyl-tRNA in the ribosome (transfer ribonucleic acid), thereby hindering translation of the peptidyl-tRNA. Since hygromycin B phosphotransferase inactivates hygromycin B, recombinant microorganisms can be selected.
Example 2: preparation of Catalase expression vectors pASP503PMC, pASPW504PMC and pASPV505PMC
The catalase protein from penicillium marneffei of sequence No. 5 encodes 734 amino acids in total and contains 19 signal sequences (mrglslgtlaglvvaasa) and 23 prosequence (acpmlpagsgvanphhgkr) amino acids. A catalase gene derived from Penicillium marneffei having the size of 2205bp, sequence No. 6, was chemically synthesized by providing PMC (Penicillium marneffei catalase) with recognition sites for restriction enzymes ClaI and NotI at both ends of the base sequence, and cloned into pGEM-B1 vector.
The PMC DNA containing the signal sequence was cleaved with ClaI and NotI and cloned in the pASPF503 vector of example 1-1 and designated pASP503 PMC.
The 2145bp fragment was obtained by chemically synthesizing a PMC DNA not containing a signal sequence in SEQ ID NO. 6 using PMCVF1 primer (gcctgcccaatgctgacaggcg) of SEQ ID NO. 7 having no restriction enzyme recognition site at the 5 'end of the sequence and PMCNotR1 primer (gcggccgcctatttatccacagcaaagc) of SEQ ID NO. 8 having a single restriction enzyme NotI recognition site at the 3' end of the sequence, and performing Polymerase Chain Reaction (PCR) using both primers. The obtained fragments were cloned between the pASPW504, pASPV505 vectors NaeI and NotI restriction enzymes of example 1-1 and named pASPW504PMC, pASPV505PMC, respectively.
Example 3: preparation of recombinant microorganism introduced with expression vector and screening method of recombinant microorganism
The expression vectors pASP503PMC, pASPW504PMC and pASPV505PMC of example 2 were introduced into A.niger and transformed (Tilburn et al, Gene, 26: 205-221, 1983). For transformation, pASP600s DNA was inserted into the genome after cell wall degrading enzymes were treated with liquid cultured mycelia to prepare protoplasts. In order to select the recombinant microorganism, selection was performed in an agar medium supplemented with hygromycin, and subculture was performed.
Example 4: flask culture of recombinant microorganisms
The recombinant microorganism resistant to hygromycin B among the recombinant microorganisms of example 3 was spotted on the same agar medium for the first passage. After 4 days, spores of the recombinant microorganism are uniformly dispersed in an agar complete medium, and then cultured at a temperature of 30 ℃ for 5-6 days until the spores are uniformly formed.
1X 10 from 5-day culture dishes by 0.1% Tween806Asexual spores were harvested in cells/mL, and the dilution was inoculated into 1mL of liquid complete medium. The cells were cultured at 200rpm for 4 days at 28 ℃ in a shaking incubator. The culture broth was centrifuged at 10000g for 10 minutes to remove the cells, and the activity was confirmed in the collected culture supernatant.
Example 5: detection of enzymatic Activity of Catalase
1U is the amount of enzyme decomposing 1mole of hydrogen peroxide per minute. A substrate was prepared by adding 0.1mL of 30% Hydrogen Peroxide (Hydrogen Peroxide) to 49.9mL of 50mM Potassium phosphate buffer (Potassium phosphate buffer) at pH 7.0. 30ul of the fermentation broth was added, and the absorbance was measured at 255 nm.
As a result, all of the recombinant microorganisms comprising pASP503PMC, pASPW504PMC and pASPV505PMC exhibited peroxidase activity, and the titer was 2300unit/mL in the case of the pASP503PMC recombinant microorganism, 26000unit/mL in the case of the pASPW504PMC recombinant microorganism and 53000unit/mL in the case of the pASPV505PMC recombinant microorganism. Compared with the self signal sequence, the expression level in the An07g00440 lipase signal sequence is 11.3 times higher, and the expression level in the An07g00440 lipase deformation signal sequence is 2.03 times higher.
As a result of analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS PAGE), it was confirmed that PMC catalase had a molecular weight of 75.9kD, but it was glycosylated (Glycosylation), and thus the actual size was 100 kD. From this, it was confirmed that the recombinant gene was secreted to the outside of Aspergillus niger by the An07g00440 lipase signal sequence and the An07g00440 lipase modified signal sequence of the present invention (FIG. 3).
Although specific portions of the present invention have been described in detail, it should be understood that those skilled in the art to which the present invention pertains are merely preferred embodiments and that the scope of the present invention is not limited to the preferred embodiments. Accordingly, the substantial scope of the present invention is defined by the appended claims and their equivalents.
Industrial applicability
According to the expression vector comprising the novel signal sequence of the present invention, it is possible to induce not only a large amount of expression and secretion of a specific catalase but also a large amount of expression and secretion of other target proteins, and therefore, it is very advantageous for stable mass production of a specific catalase and other target proteins.
Sequence Listing Free Text
An electronic file is attached.
<110> JenoFox Co
<120> novel Catalase signal sequence and Catalase expression method Using the same
<130>PP-B1571
<150>KR 10-2014-0063977
<151>2014-05-27
<160>8
<170>KopatentIn 2.0
<210>1
<211>19
<212>PRT
<213> Aspergillus niger
<400>1
Met Tyr Ile Pro Ser Val Leu Leu Leu Ala Ala Ser Leu Phe His Gly
1 5 10 15
Ala Thr Ala
<210>2
<211>19
<212>PRT
<213> Aspergillus niger
<400>2
Met Arg Trp Pro Ser Val Leu Leu Leu Ala Ala Ser Leu Phe His Gly
1 5 10 15
Ala Thr Ala
<210>3
<211>54
<212>DNA
<213> Aspergillus niger
<400>3
atgtatatcc cctcggtgct gcttctggcc gcgagcctgt tccatggcgc aacg 54
<210>4
<211>57
<212>DNA
<213> Aspergillus niger
<400>4
atgcgctggc cctcggtgct gcttctggcc gcgagcctgt tccatggcgc aacggcc 57
<210>5
<211>734
<212>PRT
<213> Penicillium marneffei
<220>
<221>SIGNAL
<222>(1)..(19)
<400>5
Met Arg Gly Leu Tyr Ser Leu Gly Thr Leu Ala Gly Leu Val Val Ala
1 5 10 15
Ala Ser Ala Ala Cys Pro Met Leu Thr Gly Glu Leu Pro Ala Gly Ser
20 25 30
Val Ala Asn Pro His His His Gly Lys Arg Asp Asp Ser Lys Ala Ser
35 40 45
Ser Glu Thr Glu Thr Phe Leu Ser Glu Phe Tyr Leu Asn Asp Asn Asp
50 55 60
Ser Phe Leu Thr Ser Asp Val Gly Gly Pro Ile Glu Asp Gln His Ser
65 70 75 80
Leu Lys Ala Gly Ile Arg Gly Ser Thr Leu Leu Glu Asp Phe Ile Phe
85 90 95
Arg Gln Lys Ile Gln His Phe Asp His Glu Arg Ile Pro Glu Arg Ala
100 105 110
Val His Ala Arg Gly Ala Gly Ala His Gly Val Phe Thr Ser Tyr Ala
115 120 125
Asp Trp Ser Asn Ile Thr Ala Ala Ser Phe Leu Gly Ala Ala Gly Lys
130 135 140
Glu Thr Pro Thr Phe Val Arg Phe Ser Thr Val Ala Gly Ser Arg Gly
145 150 155 160
Ser Ala Asp Thr Ala Arg Asp Val His Gly Phe Ala Thr Arg Phe Tyr
165 170 175
Thr Glu Glu Gly Asn Tyr Asp Ile Val Gly Asn Asn Ile Pro Val Phe
180 185 190
Phe Ile Gln Asp Ala Ile Leu Phe Pro Asp Leu Ile His Ala Val Lys
195 200 205
Pro Gln Pro Ala Asn Glu Ile Pro Gln Ala Ala Thr Ala His Asp Thr
210 215 220
Ala Tyr Asp Phe Phe Gly Gln Gln Pro Ser Thr Leu His Thr Leu Phe
225 230 235 240
Trp Ala Met Ser Gly His Gly Ile Pro Arg Ser Phe Arg His Val Asp
245 250 255
Gly Phe Gly Val His Thr Tyr Arg Phe Val Thr Asp Asn Gly Ser Ser
260 265 270
Lys Leu Val Lys Phe His Trp Thr Ser Leu Gln Gly Arg Ala Ser Leu
275 280 285
Val Trp Glu Glu Ala Gln Ala Thr Ala Gly Lys Asn Ala Asp Tyr Met
290 295 300
Arg Gln Asp Leu Tyr Asp Ser Ile Lys Ala Gly Arg Tyr Pro Glu Trp
305 310 315 320
Glu Leu Gly Val Gln Ile Ile Asn Glu Ser Asp Val Leu Ser Tyr Gly
325 330 335
Phe Asp Leu Leu Asp Pro Thr Lys Ile Leu Pro Val Glu Glu Val Pro
340 345 350
Ile Thr Pro Leu Gly Lys Met Gln Leu Asn Arg Asn Pro Leu Asn Tyr
355 360 365
Phe Ala Glu Thr Glu Gln Val Met Phe Gln Pro Gly His Ile Val Arg
370 375 380
Gly Ile Asp Phe Thr Glu Asp Pro Leu Leu Gln Gly Arg Leu Phe Ser
385 390 395 400
Tyr Leu Asp Thr Gln Leu Asn Arg Asn Gly Gly Pro Asn Phe Glu Gln
405 410 415
Ile Pro Ile Asn Arg Pro Arg Val Pro Ile His Asn Asn Asn Arg Asp
420 425 430
Gly Phe Gly Gln Met Phe Ile Pro Leu Asn Gln Ala Ala Tyr Ser Pro
435 440 445
Asn Thr Leu Asn Ser Gly Ser Pro Lys Gln Ala Asn Glu Thr Val Gly
450 455 460
Asn Gly Phe Phe Thr Thr Pro Gly Arg Ser Ala Asp Gly His Leu Val
465 470 475 480
Arg Ala Thr Ser Pro Thr Phe Ala Asp Val Trp Ser Gln Pro Gly Leu
485 490 495
Phe Tyr Asn Ser Leu Thr Ala Thr Glu Gln Gln Phe Val Ile Asn Gly
500 505 510
Leu Arg Phe Glu Leu Ser Asn Val Gly Ser Glu Asp Val Lys Arg Asn
515 520 525
Phe Ile Thr Gln Val Asn Arg Val Asn Asn Thr Leu Ala Thr Leu Val
530 535 540
Ala Thr Ala Ile Gly Val Pro Ala Pro Lys Pro Glu Pro Thr Tyr Tyr
545 550 555 560
His Lys Asn Lys Thr Ser Asn Val Gly Thr Phe Gly Thr Pro Leu Lys
565 570 575
Lys Leu Asp Gly Leu Arg Val Ala Val Leu Ala Ser Val Asn Asp Glu
580 585 590
Arg Ser Ile Ala Glu Gly Gln Ala Leu Ala Lys Arg Leu Ala Asn Ser
595 600 605
Asn Val Asp Val Val Ile Val Ala Glu Lys Leu Ala Ser Asn Val Thr
610 615 620
Ala Thr Tyr Ser Glu Ser Asp Ala Thr Asn Phe Asp Ala Val Ile Val
625 630 635 640
Thr Ser Gly Ala Asp Gly Leu Phe Gly Leu Gln Thr Phe Thr Ser Thr
645 650 655
Ser Asn Ile Thr Leu Tyr Pro Ala Gly Arg Pro Thr Gln Ile Met Val
660 665 670
Asp Ala Phe Arg Phe Gly Lys Pro Val Gly Ala Val Gly Ser Ala Arg
675 680 685
Ser Ala Leu Ser Ala Val Asp Ile Ser Thr Asn Arg Thr Gly Val Val
690 695 700
Ile Gly Asp Ser Val Asn Asp Asp Phe Val Asn Gln Leu Thr Lys Asp
705 710 715 720
Leu Ala Thr Phe Lys Phe Leu Asp Arg Phe Ala Val Asp Lys
725 730
<210>6
<211>2205
<212>DNA
<213> Penicillium marneffei
<220>
<221>sig_peptide
<222>(1)..(49)
<223> Signal sequence
<400>6
atgcgaggat tatactccct cggaactttg gccggtctcg ttgtagctgc ttcggctgcc 60
tgcccaatgc tgacaggcga gctcccagcg ggcagtgttg cgaaccctca tcaccacgga 120
aagcgtgacg actccaaggc ttcctctgaa acagaaacgt ttctatccga gttttacctc 180
aacgacaatg attccttcct tacctccgat gtaggcggtc caattgagga tcaacacagc 240
ttgaaggctg gcatccgtgg gtcaacactc ttggaagatt tcatcttccg tcagaagatc 300
cagcattttg atcatgagcg tataccggaa cgcgccgtgc atgctcgagg tgcaggcgct 360
catggtgtat tcacctcata tgccgactgg tccaacatca ctgctgcctc attcttagga 420
gctgccggaa aggaaacgcc cacttttgtt cgcttctcga ctgttgcagg cagccgcgga 480
agtgctgata ccgctcgcga cgttcacggt ttcgctactc ggttctatac tgaggaagga 540
aattacgaca tcgttggaaa caacatcccc gtcttcttca tccaagatgc catcttattc 600
ccagatctca tccatgctgt caagccacag ccagccaatg aaatcccaca ggctgctact 660
gcacacgaca ctgcatatga cttctttggc caacagccga gcaccttgca tacccttttc 720
tgggcaatgt caggtcacgg tatcccacgg tctttccgtc acgttgatgg gttcggtgtt 780
cacacctatc ggtttgtgac tgacaatggt tcctccaagc tggtcaaatt ccactggaca 840
tctctacagg gccgagccag tcttgtctgg gaggaggctc aagctactgc cggcaagaat 900
gccgactata tgagacagga tttgtacgat agtatcaaag ctggccgtta tccggagtgg 960
gagctcggtg tgcaaattat caatgagtcg gatgttctaa gctacggatt cgacctcttg 1020
gatccaacca agattcttcc agtcgaagaa gttccaatca ctccgctggg aaaaatgcaa 1080
ctcaaccgta atcctttgaa ttattttgcc gagaccgagc aagtcatgtt ccaacccggt 1140
cacattgttc gtggtatcga tttcactgag gatcctctcc tccaaggtcg tctattttca 1200
tacctcgaca ctcaattgaa tcgcaatggt ggtcccaact ttgaacaaat tccgatcaac 1260
cgtccccgtg ttcctattca caataataac cgcgacggat ttggccaaat gtttatccca 1320
ctaaaccaag cagcatactc ccccaacacc ttaaacagcg gctctccaaa acaggcaaac 1380
gaaactgtcg gaaatggctt tttcacaacc ccggggcgtt cggcagatgg acaccttgtt 1440
cgtgccacta gcccaacatt tgcagacgtg tggtctcagc ctggtttgtt ctataattca 1500
ttgacagcca ccgagcagca gttcgtgatc aatggtttgc ggttcgagtt gtccaatgta 1560
ggaagtgagg acgttaaaag aaacttcatt actcaggtca accgtgtgaa caacacgctg 1620
gcgacgcttg tggctacagc aattggagtc cccgctccaa aacctgagcc aacatactac 1680
cacaagaaca agacgtctaa tgttggaaca tttggtaccc cattgaagaa gcttgacggt 1740
ctcagagtcg ctgtccttgc ttcagtgaac gatgaacgca gtattgccga gggacaagca 1800
ttagcaaaac gtctggcaaa ttctaacgtg gacgtcgtca ttgtcgccga gaaacttgcg 1860
tcaaatgtga cggctaccta ctccgagtca gacgcaacaa actttgacgc ggttatcgtg 1920
acttcgggag ctgatggtct cttcggactt cagactttca caagcacatc taacataact 1980
ctttaccccg caggccgtcc tactcagatt atggtcgatg cttttcgatt cggcaagcca 2040
gtaggagcgg tgggcagcgc caggtcagcc ttgtcagcgg tggatatcag cactaatcgc 2100
actggtgtgg ttattggcga ttccgtcaat gacgactttg tcaaccagct aacgaaggac 2160
ctagcaacat tcaagttcct ggatcgcttt gctgtggata aatag 2205
<210>7
<211>22
<212>DNA
<213> Artificial sequence
<220>
<223> PMCFV 1 primer
<400>7
gcctgcccaa tgctgacagg cg 22
<210>8
<211>28
<212>DNA
<213> Artificial sequence
<220>
<223> PMCNTR 1 primer
<400>8
gcggccgcct atttatccac agcaaagc 28
Claims (6)
1. A modified lipase signal sequence polypeptide represented by the amino acid sequence of SEQ ID NO. 2, characterized in that tyrosine at the second amino acid is substituted with positively charged arginine and isoleucine at the third amino acid is substituted with tryptophan on the basis of the lipase signal sequence represented by SEQ ID NO. 1.
2. A nucleic acid encoding the modified lipase signal sequence polypeptide of claim 1.
3. The nucleic acid according to claim 2, wherein the nucleic acid is represented by the base sequence of SEQ ID NO. 4.
4. An expression vector comprising a nucleic acid encoding a lipase signal sequence polypeptide represented by the amino acid sequence of seq id No. 1 or a nucleic acid encoding the modified lipase signal sequence polypeptide of claim 1, a gene for catalase, a glaA promoter, and a pdcA terminator, wherein the catalase is penicillium marneffei catalase protein of seq id No. 5.
5. A recombinant Aspergillus niger into which a nucleic acid encoding a lipase signal sequence polypeptide represented by the amino acid sequence of SEQ ID NO. 1 or the mutant lipase signal sequence polypeptide of claim 1, a catalase gene, a glaA promoter, and a pdcA terminator have been introduced, wherein the catalase is the Penicillium marneffei catalase protein of SEQ ID NO. 5.
6. A method for producing catalase, comprising:
a step (a) of culturing the recombinant Aspergillus niger of claim 5 to produce catalase; and
a step (b) of recovering the catalase thus produced.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2014-0063977 | 2014-05-27 | ||
| KR1020140063977A KR101724614B1 (en) | 2014-05-27 | 2014-05-27 | New Catalase Signal Sequences and Expression Method Using The Same |
| PCT/KR2015/005223 WO2015182941A1 (en) | 2014-05-27 | 2015-05-26 | Novel catalase signal sequence and method for catalase expression using same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106459940A CN106459940A (en) | 2017-02-22 |
| CN106459940B true CN106459940B (en) | 2020-02-07 |
Family
ID=54699215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201580028272.5A Active CN106459940B (en) | 2014-05-27 | 2015-05-26 | Novel catalase signal sequence and catalase expression method using same |
Country Status (3)
| Country | Link |
|---|---|
| KR (1) | KR101724614B1 (en) |
| CN (1) | CN106459940B (en) |
| WO (1) | WO2015182941A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107384814B (en) * | 2017-08-28 | 2020-03-31 | 王艺璇 | Bacterial strain for recombinant expression of catalase and application thereof |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1675355A (en) * | 2002-08-19 | 2005-09-28 | 帝斯曼知识产权资产管理有限公司 | Novel lipases and uses thereof |
| CN101173270A (en) * | 2007-08-30 | 2008-05-07 | 北京济普霖生物技术有限公司 | Method for improving secernment efficiency of recombined protein |
| CN101960006A (en) * | 2008-03-07 | 2011-01-26 | 丹尼斯科美国公司 | Expression of catalase in trichoderma |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2637881A1 (en) * | 2006-01-31 | 2007-08-09 | Republic Of Korea (Republic Of National Fisheries Research And Developme Nt Institute) | Production of a soluble native form of recombinant protein by the signal sequence and secretional enhancer |
| KR101026526B1 (en) * | 2009-01-23 | 2011-04-01 | 한국과학기술연구원 | Method for the secretory production of heterologous protein in Escherichia coli |
-
2014
- 2014-05-27 KR KR1020140063977A patent/KR101724614B1/en active IP Right Grant
-
2015
- 2015-05-26 WO PCT/KR2015/005223 patent/WO2015182941A1/en active Application Filing
- 2015-05-26 CN CN201580028272.5A patent/CN106459940B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1675355A (en) * | 2002-08-19 | 2005-09-28 | 帝斯曼知识产权资产管理有限公司 | Novel lipases and uses thereof |
| CN101173270A (en) * | 2007-08-30 | 2008-05-07 | 北京济普霖生物技术有限公司 | Method for improving secernment efficiency of recombined protein |
| CN101960006A (en) * | 2008-03-07 | 2011-01-26 | 丹尼斯科美国公司 | Expression of catalase in trichoderma |
Non-Patent Citations (2)
| Title |
|---|
| A2QM14;无;《UniProt》;20140219;DR、FT、SQ部分 * |
| XM_002153565.1;无;《GenBank》;20081113;Features和Origin部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101724614B1 (en) | 2017-04-19 |
| CN106459940A (en) | 2017-02-22 |
| KR20150136729A (en) | 2015-12-08 |
| WO2015182941A9 (en) | 2016-04-28 |
| WO2015182941A1 (en) | 2015-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220162647A1 (en) | Method for inducing targeted meiotic recombinations | |
| US7608434B2 (en) | Mutated Tn5 transposase proteins and the use thereof | |
| CN107109422B (en) | Genome editing using split Cas9 expressed from two vectors | |
| CN110527697B (en) | RNA fixed-point editing technology based on CRISPR-Cas13a | |
| CN109777815B (en) | HMG-CoA synthetase gene RKHMGCS and application thereof | |
| EP2681308A1 (en) | Protein expression | |
| WO2015067161A1 (en) | Phospholipase c mutant and use thereof | |
| US8759028B2 (en) | Expression cassette, recombinant host cell and process for producing a target protein | |
| AU2020242724B2 (en) | Aminoacyl-tRNA synthetase for efficiently introducing lysine derivative in protein | |
| CN113667682B (en) | YH66-RS11190 gene mutant and application thereof in preparation of L-valine | |
| CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| CN113755468B (en) | Zearalenone hydrolase with improved resistance to trypsin | |
| CA3228222A1 (en) | Class ii, type v crispr systems | |
| CN106459940B (en) | Novel catalase signal sequence and catalase expression method using same | |
| US9803207B2 (en) | Expression vector for production of recombinant proteins in prokaryotic host cells | |
| US20240002453A1 (en) | Compositions and methods using methanotrophic s-layer proteins for expression of heterologous proteins | |
| DK2340306T3 (en) | EXPRESSION-AMPLIFIED NUCLEIC ACIDS | |
| KR101841264B1 (en) | Recombinant Vector Including Gene of Autopahgy Activation Protein and Crystallizing Method for Recombinant Protein Using Thereof | |
| KR101803013B1 (en) | New Lipase Signal Sequences and Expression Method Using The Same | |
| KR101781327B1 (en) | New Lipase Signal Sequences and Expression Method Using The Same | |
| KR101781328B1 (en) | New Lipase Signal Sequences and Expression Method Using The Same | |
| KR101747701B1 (en) | manufacturing method of panose using recombination dextransucrase | |
| JP2007517519A (en) | Ultrafast selection method of protein fusion factors for recombinant protein production and protein fusion factors selected thereby | |
| EP3676370B1 (en) | Compositions and methods using methanotrophic s-layer proteins for expression of heterologous proteins | |
| KR102302827B1 (en) | Compositon for inhibiting gene expression using CRISPRi |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |