KR101781327B1 - New Lipase Signal Sequences and Expression Method Using The Same - Google Patents

Abstract

The present invention relates to a novel signal sequence for mass-expressing lipase, and more particularly to a novel lipase signal sequence; An expression vector comprising the signal sequence and the lipase gene; A recombinant microorganism into which the expression vector is introduced; And a method for mass-producing lipase by culturing the recombinant microorganism. The use of an expression vector containing the novel signal sequence according to the present invention can induce the mass expression and secretion of not only a specific lipase but also other target proteins, which is very useful for stable mass production of specific lipase and other target proteins.

Description

New Lipase Signal Sequences and Expression Method Using The Same}

The present invention relates to a novel signal sequence for mass-expressing lipase, and its use, and more specifically, to a novel lipase signal sequence; An expression vector containing the signal sequence and a lipase gene; A recombinant microorganism into which the expression vector has been introduced; And it relates to a method for producing a large amount of lipase by culturing the recombinant microorganism.

Various kinds of proteins used for industrial purposes have been produced using Saccharomyces , Aspergillus Niger , Aspergillus orryzae, and Trichoderma reesei , which are widely known for their stability. In order to express and secrete a target protein, an expression secretion plasmid vector consisting of a promoter, which is a transcription promoting sequence, a DNA encoding a secretion signal sequence, a structural gene of the target protein, and a transcription terminator, has been used.

As the secretion signal sequence currently used to secrete the protein of interest in Aspergillus Niger, the signal sequence of the gene to be expressed and the Aspergillus Niger glucoamylase signal sequence have been used, and as a strong promoter, glucoamylase ( glaA) promoter is being used.

However, it is not possible to express a desired protein in large quantities using only the signal sequences known so far.

Aspergillus Niger can produce glucoamylase in high yields of 30 g/L or more through industrial process development. In addition, there are many commercially available lipases derived from Aspergillus Niger, which induce lipase with traditional mutagenesis and inducers, enabling the efficient production of lipase in Aspergillus Niger. Accordingly, there is a demand for a method capable of promoting the secretion of lipase protein from the outside of cells on the Aspergillus Niger genome. That is, it is important to search for a signal sequence that can more efficiently mass-produce a protein, which is a commercially important enzyme, and the development of recombinant microorganisms and recombinant microorganisms is required.

Accordingly, the present inventors have tried to develop a method for mass-producing lipase using genetic engineering methods in order to overcome the limitation of expression, and as a result, discover a novel signal sequence for expressing lipase, and use the signal sequence. The present invention was completed by confirming that the lipase was expressed in large quantities.

An object of the present invention is a novel lipase signal sequence for expressing lipase in large quantities; An expression vector containing the signal sequence and a lipase gene; And a recombinant microorganism into which the expression vector has been introduced.

Another object of the present invention is to provide a method for mass-producing lipase by culturing the recombinant microorganism.

In order to achieve the above object, the present invention is An03g06560 (SEQ ID NO: 1), An14g00860 (SEQ ID NO: 2), An07g00440 (SEQ ID NO: 3), An02g09690 (SEQ ID NO: 4), An16g08870 (SEQ ID NO: 5), An06g00350 (SEQ ID NO: 6 ), An16g01880 (SEQ ID NO: 7), An12g06560 (SEQ ID NO: 8), An09g02270 (SEQ ID NO: 9), An15g02210 (SEQ ID NO: 10), An13g02820 (SEQ ID NO: 11), and Anllg00100 (SEQ ID NO: 12). Lipase signal sequence; And An03g06560 (SEQ ID NO: 13), An14g00860 (SEQ ID NO: 14), An07g00440 (SEQ ID NO: 15), An02g09690 (SEQ ID NO: 16), An16g08870 (SEQ ID NO: 17), An06g00350 (SEQ ID NO: 18), An16g01880 (SEQ ID NO: 19), Nucleic acid encoding the lipase signal sequence selected from the group consisting of An12g06560 (SEQ ID NO: 20), An09g02270 (SEQ ID NO: 21), An15g02210 (SEQ ID NO: 22), An13g02820 (SEQ ID NO: 23), and Anllg00100 (SEQ ID NO: 24) Provides.

The present invention also provides an expression vector comprising a nucleic acid encoding the signal sequence and a gene of a protein of interest, and a recombinant microorganism into which the expression vector is introduced.

The present invention also includes the steps of (a) culturing the recombinant microorganism to produce a protein of interest; And (b) recovering the generated target protein.

The use of the expression vector containing the novel signal sequence according to the present invention can induce mass expression and secretion of not only specific lipases but also other target proteins, and is very useful in stable mass production of specific lipases and other target proteins.

1 is a schematic diagram of the expression vector of the present invention, showing that the glaA promoter and the pdcA terminator are used, and after the lipase signal sequence, the TLL gene can be cloned into Nae I/Not I.
Figure 2 is an image showing the pASP504 vector of Example 1, pASP504 vector contains a glaA promoter and pdcA terminator, hygromycin resistance gene and hygromycin B phosphotransferase, each lipase signal It is a vector capable of cloning a sequence.
Figure 3 is an image showing the pASP600s vector of Example 1, a representative of the vector cloned each lipase signal sequence.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

In the present invention, a lipase signal sequence capable of expressing a large amount of specific lipases and other proteins of interest; An expression vector containing the signal sequence and the gene of the protein of interest; And a recombinant microorganism into which the expression vector was introduced. As a result, it was confirmed that a large amount of lipase can be produced by culturing the prepared recombinant microorganism.

In one embodiment of the present invention, a large amount of lipase is produced when using the novel lipase signal sequence of the present invention by using a lipase (TLL) gene derived from Thermomyces lanuginosus as a nucleic acid encoding a protein of interest. Confirmed that it is. However, this is only an example, and it is obvious to those skilled in the art that the present invention can be applied not only to specific lipases but also to other target proteins.

Therefore, in one aspect, the present invention, An03g06560 (SEQ ID NO: 1), An14g00860 (SEQ ID NO: 2), An07g00440 (SEQ ID NO: 3), An02g09690 (SEQ ID NO: 4), An16g08870 (SEQ ID NO: 5), An06g00350 (SEQ ID NO: 6) , An16g01880 (SEQ ID NO: 7), An12g06560 (SEQ ID NO: 8), An09g02270 (SEQ ID NO: 9), An15g02210 (SEQ ID NO: 10), An13g02820 (SEQ ID NO: 11), and Anllg00100 (SEQ ID NO: 12) It relates to the signal sequence.

In the present invention, the signal sequence may be characterized in that it is derived from Aspergillus niger, but is not limited thereto.

In another aspect, the present invention, An03g06560 (SEQ ID NO: 13), An14g00860 (SEQ ID NO: 14), An07g00440 (SEQ ID NO: 15), An02g09690 (SEQ ID NO: 16), An16g08870 (SEQ ID NO: 17), An06g00350 (SEQ ID NO: 18), An16g01880 (SEQ ID NO: 19), An12g06560 (SEQ ID NO: 20), An09g02270 (SEQ ID NO: 21), An15g02210 (SEQ ID NO: 22), An13g02820 (SEQ ID NO: 23), and Anllg00100 (SEQ ID NO: 24) selected from the group consisting of, the lipase It relates to a nucleic acid encoding a signal sequence.

In another aspect, the present invention relates to an expression vector comprising a nucleic acid encoding the lipase signal sequence and a gene of a protein of interest.

In the present invention, “vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vectors, "plasmid" and "vector" are sometimes used interchangeably in the specification of the present invention.

For the purposes of the present invention, it is preferred to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) an initiation point for efficient replication to contain hundreds of plasmid vectors per host cell, and (b) a host cell transformed with a plasmid vector to be selected. It has a structure including an antibiotic resistance gene and (c) a restriction enzyme cleavage site that allows foreign DNA fragments to be inserted. Even if an appropriate restriction enzyme cleavage site does not exist, the vector and foreign DNA can be easily ligated by using a synthetic oligonucleotide adapter or linker according to a conventional method.

In addition, the gene is "operably linked" when placed in a functional relationship with another nucleic acid sequence. This may be a gene and regulatory sequence(s) linked in a manner that allows gene expression when an appropriate molecule (eg, a transcriptional activating protein) is bound to the regulatory sequence(s). For example, DNA for a pre-sequence or secretion leader is operably linked to the DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; The promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence when arranged to facilitate translation.

In general, "operably linked" means that the DNA sequence to which it is linked is in contact, and in the case of a secretory leader, is contacted and is present in the reading frame. However, the enhancer does not need to be in contact. The ligation of these sequences is carried out by ligation (linkage) at convenient restriction enzyme sites. If such a site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method is used.

In the present invention, the target protein may be characterized in that a lipase, and the lipase is Somemomyces renginosus ( Thermomyces lanuginosus ) derived lipase (TLL) may be characterized, but is not limited thereto.

In the present invention, the expression vector may be characterized in that it further comprises a glucoamylase promoter, and the glucoamylase promoter may be characterized in that the Aspergillus Niger glucoamylase (glaA) promoter, but limited thereto. It does not become.

In the present invention, the expression vector may be selected from the group consisting of pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP610TLL, pASP611TLL, and pASP612TLL. no.

In another aspect, the present invention is a recombinant microorganism into which the nucleic acid encoding the lipase signal sequence and the gene of the protein of interest are introduced; Or it relates to a recombinant microorganism into which the expression vector has been introduced.

In the present invention, the recombinant microorganism may be characterized in that Aspergillus niger (Aspergillus niger), but is not limited thereto.

As for the recombinant microorganism, host cells having high DNA introduction efficiency and high expression efficiency of the introduced DNA are commonly used. As all microorganisms including prokaryotic and eukaryotic cells, bacteria, yeast, fungi, etc. are available, and the present invention In the example of, Aspergillus Niger was used, but the present invention is not limited thereto, and any type of microorganism may be used as long as the lipase can be sufficiently expressed.

Of course, not all vectors function equally in expressing the DNA sequence of the present invention, and likewise, not all hosts function equally in the same expression system. However, those skilled in the art can appropriately select and apply from various vectors, expression control sequences, and hosts without departing from the scope of the present invention without undue experimental burden. For example, when selecting a vector, the host must be considered, since the vector must replicate in it, the number of copies of the vector, the ability to control the number of copies, and other proteins encoded by the vector, e.g. For example, the expression of antibiotic markers should also be considered.

The transformed recombinant microorganism can be prepared according to any transformation method. The "transformation" of the present invention is a phenomenon in which DNA is introduced into a host so that DNA can be replicated as a factor of chromosomes or by chromosomal integration completion. Means.

In addition, in the present invention, as a method of inserting the gene onto the chromosome of a host cell, a commonly known gene manipulation method may be used, for example, a retroviral vector, adenovirus vector, adeno-associated virus vector, herpes simplex A method using a viral vector, a poxvirus vector, a lentiviral vector, or a non-viral vector may be mentioned.

In addition, in addition to a method using an expression vector, a method of directly inserting onto a chromosome of a host cell may be used for the transformation method.

In general, electroporaton, lipofection, ballistic method, virosome, liposome, immunoliposome, polycation or lipid: nucleic acid conjugate, naked DNA, artificial viron, chemical promoting DNA inflow, calcium phosphate (CaPO4) precipitation , Calcium chloride (CaCl2) precipitation, microinjection, lithium acetate-DMSO, and the like may be used.

Sosonoporation, for example, a method using the Sonitron 2000 system (Rich-Mar) can also be used for the delivery of nucleic acids, and other representative nucleic acid delivery systems are Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland). And the method of BTX Molesular Syetem (Holliston, MA). The lipofection method is specified in U.S. Patent No. 5,049,386, U.S. Patent No. 4,946,787 and U.S. Patent No. 4,897,355, and the lipofection reagent is commercially available, for example, TRANSFECTAM ^TM And LIPOFECTIN ^™ . Cationic or neutral lipids suitable for effective receptor-recognition lipofection of polynucleotides include Felgner's lipids (WO91/17424 and WO91/16024) and can be delivered to cells through ex vivo introduction and into target tissues through in vivo introduction. have. Methods for preparing lipid:nucleic acid complexes including target liposomes such as immunolipid complexes are well known in the art (Crystal, Science., 270:404-410, 1995; Blaese et al., Cancer Gene Ther ., 2:291 -297, 1995; Behr et al., Bioconjugate Chem., 5:382389, 1994; Remy et al., Bioconjugate Chem ., 5:647-654, 1994; Gao et al., Gene Therapy., 2:710-722, 1995; Ahmad et al., Cancer Res., 52:4817-4820, 1992; US Patent No. 4,186,183; US Patent No. 4,217,344; US Patent No. 4,235,871; US Patent No. 4,261,975; US Patent No. 4,485,054; US Patent No. 4,501,728; US Patent No. 4,774,085; US Patent No. 4,837,028; U.S. Patent No. 4,946,787).

In another aspect, the present invention comprises the steps of: (a) culturing the recombinant microorganism to produce a protein of interest; And (b) separating the generated target protein.

[Example]

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

Example 1: expression vector pASP600s Produce

In order to secrete TLL to the outside of Aspergillus Niger, signal sequences of SEQ ID NOs: 13 to 24 (Table 2), encoding amino acid sequences of SEQ ID NOs: 1 to 12 (Table 1), were chemically synthesized. Single-stranded oligonucleotides were chemically synthesized, respectively, so as to have recognition sites for restriction enzymes ClaI and NaeI at both ends of the signal sequence nucleotide sequence, and double-stranded oligonucleotides from the single-chain oligonucleotides In order to prepare an annealing (annealing) reaction was performed. Each signal sequence DNA fragment was recovered.

The recovered fragments were cut into the pASP503 vector with restriction enzymes Cla I and Nae I and cloned, and were named pASP601, pASP602, pASP603, pASP604, pASP60pASP605, pASP606, pASP607, pASP608, pASP609, pASP610, pASP611, pASP612, respectively.

The pASP504 vector contains a glaA promoter and a pdcA terminator, and contains a hygromycin resistance gene and a hygromycin B phosphotransferase (FIGS. 1 and 2 ). Hydromycin B is inserted into the peptidyl-tRNA in the ribosome and interferes with the translation of the peptidyl-tRNA. Hygromycin B phosphotransferase enzyme inactivates hygromycin B, so that recombinant microorganisms can be selected.

Lipase Signal sequence Gene ID enzyme Signal sequence (SS) amino acid
(AA) SS No. N-region H-region C-region An03g06560 triacyl
glycerol lipase maimkallwlslslavwa
(SEQ ID NO: 1) 562 18 1-5 6-15 15-18 An14g00860 triacyl
glycerol lipase masallwlsllggstla
(SEQ ID NO: 2) 582 17 One 2-12 13-17 An07g00440 triacyl
glycerol lipase myipsvlllaaslfhgata
(SEQ ID NO: 3) 418 19 1-2 3-14 15-19 An02g09690 triacyl
glycerol lipase mlklavalfsllavgna
(SEQ ID NO: 4) 561 17 1-3 4-12 13-17 An16g08870 triacyl
glycerol lipase miffhlapffflfglvvs
(SEQ ID NO: 5) 538 19 1-5 6-14 15-19 An06g00350 triacyl
glycerol lipase mvalltsfawagltalalg
(SEQ ID NO: 6) 529 19 1-2 3-14 15-19 An16g01880 triacyl
glycerol lipase mfsgrfgvlltalaalsaa
(SEQ ID NO: 7) 298 19 1-5 6-14 15-19 An12g06560 triacyl
glycerol lipase mfvsslallaliaplia
(SEQ ID NO: 8) 580 17 One 2-12 13-17 An09g02270 triacyl
glycerol lipase mlnarsialaslpvllllfaqqlas
(SEQ ID NO: 9) 592 25 1-7 8-19 20-25 An15g02210 triacyl
glycerol lipase mkgmlptlswlalgmaslatc
(SEQ ID NO: 10) 564 21 1-4 5-13 14-21 An13g02820 triacyl
glycerol lipase mrlsslalassailpalg
(SEQ ID NO: 11) 277 18 1-2 3-14 15-18 An11g00100 triacyl
glycerol lipase mgvmrktadqalgltatalalvsaaqa
(SEQ ID NO: 12) 581 27 1-10 11-22 23-27

Lipase Signal sequence Gene ID Signal sequence (SS) base sequence An03g06560 atgtggaacgccgcggtattctgcaggatgaactcatatgtcccgttgcggaaa (SEQ ID NO: 13) An14g00860 atggcgagcgcactcctctggctctccctgctgggtggcagcaccctagcc (SEQ ID NO: 14) An07g00440 atgtatatcccctcggtgctgcttctggccgcgagcctgttccatggcgcaacg (SEQ ID NO: 15) An02g09690 atgctaaagctcgctgttgctcttttttcgttacttgccgtgggcaatgca (SEQ ID NO: 16) An16g08870 atgattttctttcatctggcaccgttcttctttctctttggtctagtagtatcttcta (SEQ ID NO: 17) An06g00350 atggtggccttgctcacttcatttgcctgggcagggcttactgct (SEQ ID NO: 18) An16g01880 atgttctctggacggtttggagtgcttttgacggcgctcgctgcgctgagtgctgcg (SEQ ID NO: 19) An12g06560 atgtttgtttcctcgcttgctctattagcacttattgctcctttgatcgca (SEQ ID NO: 20) An09g02270 atgctgaatgcacgctccattgctctggcctcgttgccagttcttctcctactattcgcccagcaacttgcctct (SEQ ID NO: 21) An15g02210 atgaagggaatgctcccgacgcttagttggttggcactgggcatggccagcctggcaacctgc (SEQ ID NO: 22) An13g02820 tcacctgccgggagatcccagcgagcagacgaactcacgcttcggcgtagagtc (SEQ ID NO: 23) An11g00100 atgggcgtgatgcgcaagactgctgaccaggccttgggcctgaccgccaccgccctggctctggtcagtg ccgcccaggcc (SEQ ID NO: 24)

Example 2: TLL Preparation of expression vector

TLL encodes 291 amino acids, and includes a signal sequence consisting of 17 amino acids and a presequence consisting of 5 amino acids. Mature TLL consists of 269 amino acids and has a molecular weight of 29.3 kD.

TLL DNA that does not contain a signal sequence has a primer of SEQ ID NO: 25 (TLLF: atgaggagctcccttgtgctg) that does not have a restriction enzyme recognition site at the 5'end of the sequence and a single restriction enzyme NotI recognition site at the 3'end of the sequence. The primer of 26 (TLLNotR: gcggccgcctaaagacatgtcccaattaac) was chemically synthesized, and a 2145 bp fragment was obtained by performing a polymerase chain reaction (PCR) using two primers. The obtained fragments were cloned by digesting the pASP600s vector with NaeI and NotI, and were named pASP601TLL, pASP602TLL, pASP603TLL, pASP604TLL, pASP605TLL, pASP606TLL, pASP607TLL, pASP608TLL, pASP609TLL, pASP609TLL, pASP609TLL, and pASP609TLL, pASP609TLL, pATL611.

Example 3: Preparation of Recombinant Microorganisms Incorporating Expression Vectors and Method of Screening Recombinant Microorganism

The expression vector of Example 2 was introduced into Aspergillus Niger and transformed (Tilburn et al., Gene. , 26:205-221, 1983). For transformation, the mycelium cultured in liquid phase was treated with a cell wall degrading enzyme to create a protoplast, and then pASP600s DNA was inserted into the genome. In addition, for selection of recombinant microorganisms, it was selected and subcultured in agar medium to which hygromascin was added.

Example 4: Flask culture of recombinant microorganisms

Among the recombinant microorganisms of Example 3, the recombinant microorganisms resistant to hygromycin B were spot inoculated on the same agar medium, and the first passage was performed. After 4 days, the recombinant microorganism spores are evenly dispersed in the agar-complete medium, and then cultured for 5-6 days at 30° C. until spores are evenly formed.

From the culture dish cultured for 5 days, asexual spores ^{were harvested at 1×10 6} cells/ml with 0.1% Tween 80, and this dilution was inoculated into 1 ml liquid complete medium. Incubate for 4 days at 28°C, 200 rpm in a shaking incubator. The culture solution was centrifuged at 10,000 g for 10 minutes to remove the cells, and activity was confirmed in the collected culture supernatant. Each recombinant vector was cultured in 20 Aspergillus Niger recombinant microorganism flasks.

Example 5: TLL Enzyme activity measurement

1U is the amount of enzyme that releases 1 mole of butyric acid per minute. To 1% dried acacia solution, 13.5 ml of tributyrin, 2% calcium chloride, and 1.0 ml of 1M sodium chloride (NaCl) were added to make a solution at pH 10. To the pH STAT, 21 ml of the solution and 1 ml of fermentation broth were added and reacted at 30° C. for 15 minutes. Prepare a titration curve per minute for the consumed ml of 0.05M NaOH solution added in the course of the reaction.

U/ml=(Slope determinde by titration in ml/min*DF*0.05/W

DF: dilution factor, specified concentration of 0.05-NaOH solution (M)

W: Amount of sample contained in 1 ml of sample solution (g)

An03g06560, An13g02820, An14g00860, An07g00440, An02g09690, An06g00350 An16g01880, An12g06560, An15g02210 lipase signal sequence showed up to 7 times higher activity than the TLL self sequence (Table 3).

Confirmation of activity of expression vector Expression vector Signal sequence (SS) Active U/ml pASP43TLL TLL SS 850 pASP601TLL An03g06560 2.130 pASP602TLL An14g00860 5.029 pASP603TLL An07g00440 6.012 pASP604TLL An02g09690 1.020 pASP605TLL An16g08870 310 pASP606TLL An06g00350 5.050 pASP607TLL An16g01880 1.009 pASP608TLL An12g06560 3.251 pASP609TLL An09g02270 10 pASP610TLL An15g02210 2.669 pASP611TLL An13g02820 532 pASP612TLL An11g00100 9 Host cell - 11

As a result of SDS PAGE analysis, the TLL molecular weight was 29.3 kD, but it was confirmed that the actual size was 31 kD due to glycosylation. As a result, it was confirmed that the recombinant protein was secreted to the outside of Aspergillus Niger by the Aspergillus Niger lipase signal sequences of the present invention.

As described above, specific parts of the present invention have been described in detail, and it is obvious that these specific techniques are only preferred embodiments for those of ordinary skill in the art, and the scope of the present invention is not limited thereby. something to do. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> Genofocus, Inc. <120> New Lipase Signal Sequences and Expression Method Using The Same <130> P14-B176 <160> 26 <170> KopatentIn 2.0 <210> 1 <211> 18 <212> PRT <213> Aspergillus niger <400> 1 Met Ala Ile Met Lys Ala Leu Leu Trp Leu Ser Leu Ser Leu Ala Val 1 5 10 15 Trp Ala <210> 2 <211> 17 <212> PRT <213> Aspergillus niger <400> 2 Met Ala Ser Ala Leu Leu Trp Leu Ser Leu Leu Gly Gly Ser Thr Leu 1 5 10 15 Ala <210> 3 <211> 19 <212> PRT <213> Aspergillus niger <400> 3 Met Tyr Ile Pro Ser Val Leu Leu Leu Ala Ala Ser Leu Phe His Gly 1 5 10 15 Ala Thr Ala <210> 4 <211> 17 <212> PRT <213> Aspergillus niger <400> 4 Met Leu Lys Leu Ala Val Ala Leu Phe Ser Leu Leu Ala Val Gly Asn 1 5 10 15 Ala <210> 5 <211> 18 <212> PRT <213> Aspergillus niger <400> 5 Met Ile Phe Phe His Leu Ala Pro Phe Phe Phe Leu Phe Gly Leu Val 1 5 10 15 Val Ser <210> 6 <211> 19 <212> PRT <213> Aspergillus niger <400> 6 Met Val Ala Leu Leu Thr Ser Phe Ala Trp Ala Gly Leu Thr Ala Leu 1 5 10 15 Ala Leu Gly <210> 7 <211> 19 <212> PRT <213> Aspergillus niger <400> 7 Met Phe Ser Gly Arg Phe Gly Val Leu Leu Thr Ala Leu Ala Ala Leu 1 5 10 15 Ser Ala Ala <210> 8 <211> 17 <212> PRT <213> Aspergillus niger <400> 8 Met Phe Val Ser Ser Leu Ala Leu Leu Ala Leu Ile Ala Pro Leu Ile 1 5 10 15 Ala <210> 9 <211> 25 <212> PRT <213> Aspergillus niger <400> 9 Met Leu Asn Ala Arg Ser Ile Ala Leu Ala Ser Leu Pro Val Leu Leu 1 5 10 15 Leu Leu Phe Ala Gln Gln Leu Ala Ser 20 25 <210> 10 <211> 21 <212> PRT <213> Aspergillus niger <400> 10 Met Lys Gly Met Leu Pro Thr Leu Ser Trp Leu Ala Leu Gly Met Ala 1 5 10 15 Ser Leu Ala Thr Cys 20 <210> 11 <211> 18 <212> PRT <213> Aspergillus niger <400> 11 Met Arg Leu Ser Ser Leu Ala Leu Ala Ser Ser Ala Ile Leu Pro Ala 1 5 10 15 Leu Gly <210> 12 <211> 27 <212> PRT <213> Aspergillus niger <400> 12 Met Gly Val Met Arg Lys Thr Ala Asp Gln Ala Leu Gly Leu Thr Ala 1 5 10 15 Thr Ala Leu Ala Leu Val Ser Ala Ala Gln Ala 20 25 <210> 13 <211> 54 <212> DNA <213> Aspergillus niger <400> 13 atgtggaacg ccgcggtatt ctgcaggatg aactcatatg tcccgttgcg gaaa 54 <210> 14 <211> 51 <212> DNA <213> Aspergillus niger <400> 14 atggcgagcg cactcctctg gctctccctg ctgggtggca gcaccctagc c 51 <210> 15 <211> 54 <212> DNA <213> Aspergillus niger <400> 15 atgtatatcc cctcggtgct gcttctggcc gcgagcctgt tccatggcgc aacg 54 <210> 16 <211> 51 <212> DNA <213> Aspergillus niger <400> 16 atgctaaagc tcgctgttgc tcttttttcg ttacttgccg tgggcaatgc a 51 <210> 17 <211> 58 <212> DNA <213> Aspergillus niger <400> 17 atgattttct ttcatctggc accgttcttc tttctctttg gtctagtagt atcttcta 58 <210> 18 <211> 45 <212> DNA <213> Aspergillus niger <400> 18 atggtggcct tgctcacttc atttgcctgg gcagggctta ctgct 45 <210> 19 <211> 57 <212> DNA <213> Aspergillus niger <400> 19 atgttctctg gacggtttgg agtgcttttg acggcgctcg ctgcgctgag tgctgcg 57 <210> 20 <211> 51 <212> DNA <213> Aspergillus niger <400> 20 atgtttgttt cctcgcttgc tctattagca cttattgctc ctttgatcgc a 51 <210> 21 <211> 75 <212> DNA <213> Aspergillus niger <400> 21 atgctgaatg cacgctccat tgctctggcc tcgttgccag ttcttctcct actattcgcc 60 cagcaacttg cctct 75 <210> 22 <211> 63 <212> DNA <213> Aspergillus niger <400> 22 atgaagggaa tgctcccgac gcttagttgg ttggcactgg gcatggccag cctggcaacc 60 tgc 63 <210> 23 <211> 54 <212> DNA <213> Aspergillus niger <400> 23 tcacctgccg ggagatccca gcgagcagac gaactcacgc ttcggcgtag agtc 54 <210> 24 <211> 81 <212> DNA <213> Aspergillus niger <400> 24 atgggcgtga tgcgcaagac tgctgaccag gccttgggcc tgaccgccac cgccctggct 60 ctggtcagtg ccgcccaggc c 81 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TLLF <400> 25 atgaggagct cccttgtgct g 21 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> TLLNotR <400> 26 gcggccgcct aaagacatgt cccaattaac 30

Claims (14)

delete delete delete An expression vector for extracellular secretion of a foreign target protein comprising a nucleic acid encoding a lipase signal sequence represented by SEQ ID NO: 2 and a gene of a foreign target protein.
5. The expression vector according to claim 4, wherein the foreign target protein is lipase.
6. The expression vector according to claim 5, wherein the lipase is a lipase (TLL) derived from Thermomyces lanuginosus .
5. The expression vector according to claim 4, further comprising a glucoamylase promoter.
8. The expression vector according to claim 7, wherein the glucoamylase promoter is an Aspergillus oryzae glucoamylase (glaA) promoter.
delete 9. A recombinant microorganism into which the expression vector of any one of claims 4 to 8 has been introduced.
11. The recombinant microorganism according to claim 10, which is Aspergillus niger .
A recombinant microorganism into which a nucleic acid encoding a lipase signal sequence represented by SEQ ID NO: 2 and a gene construct operably linked to a gene of a foreign target protein are introduced.
A method for producing a foreign protein of interest, comprising the steps of:
(a) culturing the recombinant microorganism of claim 10 to produce a foreign target protein; And
(b) separating the generated foreign target protein.
A method for producing a foreign protein of interest, comprising the steps of:
(a) culturing the recombinant microorganism of claim 12 to produce a foreign target protein; And
(b) separating the generated foreign target protein.

Images