CN104593362A - DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof - Google Patents
DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof Download PDFInfo
- Publication number
- CN104593362A CN104593362A CN201510007643.3A CN201510007643A CN104593362A CN 104593362 A CN104593362 A CN 104593362A CN 201510007643 A CN201510007643 A CN 201510007643A CN 104593362 A CN104593362 A CN 104593362A
- Authority
- CN
- China
- Prior art keywords
- miclo
- host cell
- cell
- oil body
- oil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a DNA sequence for encoding myrmecia incisa caleosin (MiClo). The DNA sequence is a nucleotide sequence (a) as shown in the SEQ ID NO.1 or SEQ ID NO.2 or a nucleotide sequence (b) which is complementary to the nucleotide sequence (a). The invention further provides a recombinant expression vector with the nucleotide sequence, a genetically engineered host cell and application of the genetically engineered host cell. According to the invention the full-length cDNA sequence and the full-length DNA sequence of the gene of the MiClo are selected and obtained, and the fusion expression of the gene with an eYFP (enhanced yellow fluorescent protein) in a eukaryotic model organism yeast strain BY4741 shows that the protein encoded by the gene is really positioned on the oil body of a yeast cell, and MiClo encoded by the gene can be anchored on the oil body accurately to fulfill the function of keeping the structure of the oil body intact.
Description
Technical field
The present invention relates to gene engineering technology field, specifically, relate to DNA sequence dna and application thereof that a kind of coding incises edge green alga caleosin protein (MiClo).
Background technology
The energy is the basis of human social development.The current whole world is faced with energy dilemma, and petroleum resources are in short supply, and recyclability makes the exploitation of bioenergy more and more receive the concern of society.Microalgae biodiesel do not strive grain with it with people, do not strive ground with grain, do not strive the unique advantage of material with poultry has attracted the concern of more and more researcher.In order to improve the oil offtake of various oil crops, oil body (oil body, OB) and oil-body-associated proteins (protein associated oil bodies) become the recent studies on target of Plant Biotechnology gradually.The ability of different types of micro-algae accumulation oil droplet is different, and the fat content of the micro-algae of its eucaryon such as green algae, diatom is higher, promises to be the production algae kind of biofuel.Use in experiment to incise edge green alga (Myrmeciaincisa Reisigl H4301) be the unicellular micro-algae of a kind of fresh water, be subordinate to Chlorophyta (Chlorophyta).This algae can accumulate triacylglycerol (TAG) in a large number, and especially under nitrogen stress condition, these TAG are wrapped in and are present in cell with the form of oil droplet in half unit membrane, are potential microalgae biodiesel algae kinds.
The oil body of cell also claims liposome (lipid body, LB) or fat to drip (lipid droplet, LD), and the growth in future for cell is provided stored carbon source and energy by them.Intracellular oil body, in order to avoid the fusion with plasma membrane and intercellular membrane, its half unit membrane inlays oil-body-associated proteins.Research shows, the caleosin protein (caleosin) in these oil-body-associated proteins is mainly present in fungi or unicellular algae, and oleosin (oleosin) is mainly present in higher plant.Some lower plant such as plant such as mosses, cycad is also the major oil binding protein precursor using caleosin protein instead of oleosin as them.This shows that caleosin protein has the conservative function maintaining oil body structure integrity.The oil body of plant particularly in its seed can be used to express the protein of high added value or carries hydrophobic medicine, also successfully can be produced have bioactive glucuronic acid enzyme (GUS), zytase and r-hirudin etc. by oil-body-associated proteins.In addition, vegetable oils associated proteins can also by with the foreign protein be of high nutritive value or peptide fusion, improve the nutritive ingredient of seed, improve seed eat and as the quality of feed, to play in high crop yield and genetically engineered security etc. and act on.
Summary of the invention
The object of the invention is, for deficiency of the prior art, to provide a kind of DNA sequence dna of separation.
Of the present invention again one object be that the purposes of the DNA sequence dna of above-mentioned separation is provided.
Another object of the present invention is, provides a kind of and expresses recombinant vectors.
4th object of the present invention provides the purposes of above-mentioned recombinant expression vector.
5th object of the present invention provides a kind of genetically engineered host cell.
6th object of the present invention provides the purposes of the host cell of said gene through engineering approaches.
For achieving the above object, the technical scheme that the present invention takes is:
A DNA sequence dna for separation, described DNA sequence dna is:
A) SEQ ID NO.1 or the nucleotide sequence described in SEQ ID NO.2; Or
The nucleotide sequence of the nucleotide sequence complementary b) and a).
For realizing above-mentioned second object, the technical scheme that the present invention takes is:
DNA sequence dna as above is in encodes oil body calsequestrin, the stability strengthening oil body in grain and oil crop or the application increased in the grease yield of grain and oil crop.
For realizing above-mentioned 3rd object, the technical scheme that the present invention takes is:
A kind of recombinant expression vector, described carrier is the recombinant expression vector constructed by nucleotide sequence as above and plasmid or virus.
Preferably, described plasmid is pYES2 plasmid.
For realizing above-mentioned 4th object, the technical scheme that the present invention takes is:
Recombinant expression vector as above is in encodes oil body calsequestrin, the stability strengthening oil body in grain and oil crop or the application increased in the grease yield of grain and oil crop.
For realizing above-mentioned 5th object, the technical scheme that the present invention takes is:
A genetically engineered host cell, described host cell be selected from following in one:
A) to transform with nucleotide sequence as above or the host cell of transduction and progeny cell thereof;
B) to transform with recombinant expression vector as above or the host cell of transduction and progeny cell thereof.
Described host cell is bacterial cell, fungal cell, or the offspring of these host cells.
Preferably, described host cell is yeast cell.
For realizing above-mentioned 6th object, the technical scheme that the present invention takes is:
Host cell as above is in encodes oil body calsequestrin, the stability strengthening oil body in grain and oil crop or the application increased in the grease yield of grain and oil crop.
The invention provides and incise edge green alga caleosin protein (MiClo) gene order and Function Identification is carried out to it.This gene is the structural protein that specificity is anchored to oil body surface, and in grain and oil crop, process LAN can strengthen the stability of oil body, and what thus can cause oil body crosses accumulation to increase grease yield.
The invention has the advantages that:
1, the present invention is based on and incise the high-throughout sequencing data of edge green alga transcript profile, filter out one has a long 810bp of very high similarity fragment with known caleosin protein gene.Design primer based on this fragment sequence and utilize cDNA end rapid amplifying (RACE) technology to be cloned into the full length cDNA sequence of this gene, determine that this gene is caleosin protein gene family by homology comparison, by this called after MiClo, and obtain the DNA full length sequence of MiClo further.
2, the present invention by eucaryon model animals yeast BY4741 bacterial strain with this gene of enhancement type yellow fluorescence protein (eYFP) amalgamation and expression, i.e. gene overexpression experiment, find that this gene coded protein is positioned on the oil body of yeast cell really, thus confirm that the albumen of MiClo coded by said gene can be anchored on oil body exactly, there is the function maintaining oil body structure integrity.
Accompanying drawing explanation
Accompanying drawing 1 is the gene structure display incising edge green alga MiClo, and in figure, grey lines is non-translational region, and black line is intron, and black box is exon.
Accompanying drawing 2 is fluorescence pictures of yeast cell, is followed successively by yeast strain BY4741 from top to bottom, turns the BY4741 bacterial strain carrying eYFP carrier pY-eYFP, turns the BY4741 bacterial strain carrying the eYFP fusion expression vector pY-MiClo-eYFP of goal gene.Bright is light field figure, Yellow is the yellow fluorescence protein signal graph that eYFP launches, and Red is the red fluorescent figure launched after Nile Red dyes, and Merged is the stacking diagram of three width figure above.
Accompanying drawing 3 is pMD19T Vector map.
Accompanying drawing 4 is pYES2 Vector map.
Embodiment
Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.
Technological line of the present invention is:
1) temperature be 25 DEG C, intensity of illumination is 115 μm of ol photons m
-2s
-1condition under, in BG-11 substratum cultivate incise edge green alga.Collect frustule, and extract genomic dna and RNA.
2) certainly incise screening in edge green alga transcript profile sequencing data and obtain one has the long 810bp of very high similarity fragment with known caleosin protein gene, based on this fragment sequence, utilize RACE technology to obtain the cDNA sequence total length of caleosin protein gene, we are by its called after MiClo.Then, the cDNA that incises edge green alga RNA reverse transcription is utilized to carry out this sequence verification for the cDNA full length sequence of masterplate to MiClo.
3) according to the cDNA sequence design primer of MiClo total length, utilization is incised edge green alga DNA and is carried out pcr amplification as masterplate, obtains the DNA full length sequence of MiClo.
4) according to the cDNA full length sequence of MiClo and the primers of eYFP (enhanced yellow fluorescentprotein, enhancement type yellow fluorescence protein), PCR is utilized to build pMD19T/MiClo and pMD19T/eYFP plasmid.
5) double digestion (EcoRI/XbaI) is carried out to pYES2 carrier and pMD19T/eYFP plasmid, reclaim object fragment, then connect the recombinant expression vector pY-eYFP obtaining carrying eYFP with T4 ligase enzyme.
6) then double digestion (HindIII/EcoRI) is carried out to pY-eYFP carrier and pMD19T/MiClo plasmid, reclaim object fragment, then connect the recombinant vectors pY-MiClo-eYFP obtaining carrying goal gene and eYFP amalgamation and expression with T4 ligase enzyme.
7) respectively by recombinant vectors pY-eYFP and pY-MiClo-eYFP electroporation apparatus electric shocking method transformed yeast BY4741, the synthetic medium (SC-U) of application uracil-deficient screens transformant, and screening obtains transgenic yeast pY-eYFP and pY-MiClo-eYFP.
8) by turning goal gene, (namely only carrying the pYES2 carrier of eYFP) and not genetically modified yeast BY4741 are inoculated in SC substratum to turn empty carrier, collect yeast after cultivating 72h.
9) utilize oil body specific fluorescence dye Nile red (Nile Red) to carry out cell dyeing to yeast strain and transgenic yeast, utilize confocal laser scanning microscope to find: yellow fluorescence is disperse shape in the yeast cell turning pY-eYFP; And in the yeast cell turning goal gene MiClo and eYFP fusion expression vector, yellow fluorescence overlaps with the red fluorescence of dye oil body.This result demonstrates protein localization coded by MiClo on oil body, has the function maintaining oil body structure integrity.
Embodiment
1, experiment material
1) edge green alga (Myrmecia incisa Reisigl H4301) is incised purchased from Prague, CZE Charles university's algae culture center (CAUP).Temperature be 25 DEG C, intensity of illumination is 115 μm of ol photons m
-2s
-1, light/is secretly than for cultivating under the condition of 12h/12h, and substratum is BG-11, purchased from Hu Yu bio tech ltd, Shanghai.
2) pMD19T carrier (Vector map is shown in Fig. 3), pYES2 carrier (Vector map is shown in Fig. 4) are purchased from Invitrogen company.Yeast defect strain BY4741 (Mata his3 Δ leu2 Δ met15 Δ ura3 Δ) is purchased from German EUROSCARF.By yeast-inoculated in SC substratum, cultivate with 200 revs/min of (rpm) speed oscillations at 30 DEG C.SC substratum is purchased from Mei Lian bio tech ltd, Shanghai.
2, experimental technique
1) get 100mg fresh incise the mortar that edge chlorella cell is placed in precooling, add liquid nitrogen and fully grind.
2) utilize CTAB method (cetyl trimethylammonium bromide method) and TRIzol method to extract genomic dna and the total serum IgE of frustule respectively ,-20 DEG C save backup.
3) screen one and show the long 810bp fragment (Contig2882_5) of 81% similarity with the caleosin protein code sequence of this green alga of Auxenochlorellaprotothecoides incising in edge green alga transcript profile high-flux sequence database, according to its primers, utilize the SMART of Clontech company
tMrACEcDNA amplification kit carries out pcr amplification.5 '-RACE Cai Yong Testis formula PCR, the PCR reaction conditions of the first round is: 94 DEG C of sex change 30s, 68 DEG C of annealing 30s and 72 DEG C of extension 2min, 20 circulations, primer is the UPM in GSP1 (AGCACAGTTCTGTTGGCACTGGGTTTG, SEQ ID NO.3) and test kit; Second takes turns PCR reaction gets 1.5 μ L first round PCR primer and directly takes turns reaction template as second, reaction conditions is 94 DEG C of sex change 30s, 70 DEG C of annealing 1min and 72 DEG C of extension 2min, totally 30 circulations, primer is the NUPM in GSP2 (TCTGGGTATTCCCGTGTCACTGTCTTG, SEQ ID NO.4) and test kit.3 '-RACE reaction conditions takes turns the condition of PCR reaction with 5 '-RACE second, and primer is GSP (CTTTGTGCCTGAGAAGTTTGAGGAGAT, SEQ ID NO.5) and UPM.Be connected to pMD19T carrier after PCR primer is carried out glue recovery, transformation of E. coli DH5 α competent cell, blue hickie screening, picking positive colony, bacterium colony PCR verifies, bacterium liquid delivers to the order-checking of Shanghai Sheng Gong biotechnology company limited.Obtain checking order 5 '-splice with 3 '-fragment and known sequence fragment, obtain the full length cDNA sequence of coding MiClo gene.
4) cDNA full length sequence design primer: the upstream primer F1:CGCCTACTCAAACCG (SEQ ID NO.6) of MiClo is obtained according to RACE technology; Downstream primer R1:CCCTGCCTAGTCCAAA (SEQ ID NO.7), carries out pcr amplification.PCR response procedures is 94 DEG C of denaturation 5min, and 35 circulations comprise 94 DEG C of sex change 30s, 57 DEG C of annealing 45s, 72 DEG C of extension 2min, and last 72 DEG C extend 10min.After carrying out glue recovery, TA clone, bacterium colony PCR checking according to the method described above, bacterium liquid delivers to the order-checking of Shanghai Sheng Gong biotechnology company limited, confirms the cDNA full length sequence (SEQ IDNO.1) incising edge green alga MiClo.
5) utilize MiClo full length cDNA sequence checking primer (i.e. F1 and R1) of above-mentioned design, carry out pcr amplification to incise edge green alga DNA for masterplate.Amplification condition is 94 DEG C of denaturation 5min, and 35 circulations comprise 94 DEG C of sex change 45s, 60 DEG C of annealing 45s, 72 DEG C of extension 2min, and last 72 DEG C extend 10min.PCR primer reclaims through glue as stated above, TA clones and after bacterium colony PCR checking, serve the order-checking of Hai Sheng work bio-engineering corporation, obtain the DNA full length sequence (SEQ ID NO.2) incising edge green alga MiClo.
6) according to the primer of cDNA full length sequence design band HindIII and the EcoRI restriction enzyme site of MiClo:
Upstream primer YF1 (SEQ ID NO.8): aagcttATGTTGTGCAAGCTGCAAGG, wherein lowercase is HindIII restriction enzyme site;
Downstream primer YR1 (SEQ ID NO.9): gaattcGCGCCTGCCCCCCTT, wherein lowercase is EcoRI restriction enzyme site.
Primer according to eYFP sequences Design band EcoRI and XbaI enzyme cutting site:
Upstream primer YF2 (SEQ ID NO.10): gaattcATGGTGAGCAAGGG, wherein lowercase is EcoRI restriction enzyme site;
Downstream primer YR2 (SEQ ID NO.11): tctagaTTTACTTGTACAGCTCG, wherein lowercase is XbaI enzyme cutting site.
Use the above-mentioned primer respectively containing HindIII/EcoRI and EcoRI/XbaI restriction enzyme site, utilize PCR to build pMD19T/MiClo and pMD19T/eYFP plasmid.The pcr amplification reaction system of 25 μ L comprises Ex Taq damping fluid, the dNTP of 2 μ L, the Mg of 2 μ L of 2.5 μ L
2+, the cDNA masterplate of 2 μ L, the primer of 1 μ L, the Ex Taq enzyme of 0.25 μ L and 14.5 μ L sterilized waters.Amplification condition is 94 DEG C of denaturation 5min, and 35 circulations comprise 94 DEG C of sex change 45s, 64 DEG C (eYFP annealing temperature is 60 DEG C) annealing 45s, 72 DEG C of extension 2min, and last 72 DEG C extend 10min.PCR primer reclaims through glue as stated above, TA clone, serves the order-checking of Hai Sheng work bio-engineering corporation with the accuracy guaranteeing sequence.
7) extracting pMD19T/MiClo and pMD19T/eYFP plasmid from bacillus coli DH 5 alpha.With restriction enzyme EcoRI and XbaI, double digested reaction is carried out to pMD19T/eYFP, the double digested reaction of EcoRI/XbaI is also carried out to pYES2 plasmid simultaneously.Reaction system is the 0.1%BSA of 10 × M damping fluid of 4 μ L, 4 μ L, DNA about 2 μ g, and each 1 μ L of XbaI and EcoRI, adds without RNase water to 20 μ L.37 DEG C of digestion reaction 4h.Rubber tapping reclaim enzyme cut after object fragment, and the eYFP fragment after being cut by enzyme with T4DNA ligase enzyme is connected with pYES2 fragment and obtains recombinant vectors pY-eYFP.Ligation system is the damping fluid of 2.5 μ L, and the DNA of eYFP is about 0.3pmol, and the DNA of carrier pYES2 is about 0.03pmol, the T of 1 μ L
4dNA ligase, adds without RNase water to 25 μ L.16 DEG C of connections are spent the night.Transformation of E. coli DH5 α competent cell after connecting, carries out according to the method described above cloning, bacterium colony PCR verifies and order-checking.Extracting pY-eYFP plasmid from bacillus coli DH 5 alpha ,-20 DEG C save backup.Then with restriction enzyme HindIII and EcoRI, respectively double digested reaction is carried out to pMD19T/MiClo and pY-eYFP plasmid, adopt method same as described above to obtain recombinant vectors pY-MiClo-eYFP.
8) competent yeast cells preparation.By yeast-inoculated in SC substratum, 30 DEG C of recovery overnight incubation, then press 1:100 amplification culture, be cultured to cell density be about 1 × 10 with 200rpm speed oscillation
8cells/mL (about 4 ~ 5h).Cooled on ice 15min makes cell stop growing, and collects yeast cell, precooling sterilized water washed cell 3 times, collected by centrifugation under similarity condition under 4 DEG C of conditions with the centrifugal 5min of 5000rpm rotating speed.The 1M sorbitol washes cell of 20mL precooling 1 time, is then dissolved in the 1M sorbyl alcohol of 0.5mL precooling, and the concentration of adjustment cell is 1 × 10
10cells/mL.Preserve cell on ice, be convenient to electric shock and use.
9) electroporation apparatus (Bio-Rad) is utilized to shock by electricity, by recombinant vectors pY-MiClo-eYFP transformed yeast BY4741 competent cell.The DNA about 5 ~ 10 μ L (5 ~ 200ng) being taken at the recombinant vectors pY-MiClo-eYFP to be transformed of precooling on ice mixes with competent yeast cells, and precooling on ice together with the electric shock cup of 0.2cm, then electric shock cup DNA and cell mixture being transferred to precooling mixes gently, after ice bath 5min, select procedure Sc2 shocks by electricity once, remove electric shock cup, add the 1M sorbyl alcohol of 1mL precooling at once, transfer in new YPD substratum gently, 30 DEG C of slight oscillatory 5h, bacterium liquid is coated on the uracil-deficient synthetic medium (SC-U) containing 1M sorbyl alcohol, be inverted quiescent culture 48-72h for 30 DEG C, picking colony is cultivated in liquid SC-U substratum.After bacterium colony PCR verifies, preserve bacterial classification with the SC-U substratum containing 2% glucose.In addition, by above-mentioned same method, unloaded pY-eYFP electricity is forwarded on BY4741.
10) by viable yeast oil body specific fluorescent dye Nile Red (Genmed Scientifics Inc.USA) dyeing, observe with laser confocal microscope (Carl Zeiss LSM 710, Germany), take pictures.Wherein NileRed fluorescence dye excitation wavelength used is 543nm, and yellow fluorescence protein excitation wavelength used is 514nm.
3, experimental result
1) obtain according to RACE technology and through pcr amplification checking, obtain the cDNA full length sequence (SEQ ID NO.1) incising edge green alga MiClo; Its 5 '-non-translational region (UTR) long 142bp, 3 '-non-transcribed head of district 711bp, open the long 840bp of frame frame, 143-145bp is initiator codon, and 980-982bp is terminator codon, the albumen be made up of 279 amino acid of encoding.Utilization is incised edge green alga genomic dna for masterplate and is carried out pcr amplification reaction, and product obtains the DNA full length sequence (SEQ ID NO.2) of MiClo after sequential analysis; Its overall length 2099bp, there are 4 introns, the length of these introns from 5 '-hold 3 '-end respectively to be 140bp (345bp is to 484bp), 93bp (614bp is to 706bp place), 94bp (891bp is to 984bp place) and 102bp (1068bp is to 1169bp place), thus the encoding sequence of this gene is separated into 5 exons (Fig. 1); Wherein, 143-145bp is initiator codon, and 1408-1410bp is terminator codon.
2) yeast and transgenic yeast are after semi-lactosi inducing culture, utilize oil body specific fluorescent dye NileRed to dye to its cell, are observed by laser confocal microscope under different excitation wavelengths.In the yeast cell turning unloaded pY-eYFP, find that yellow fluorescence fills the air the whole cell spaces except core; In the yeast turning goal gene MiClo and eYFP amalgamation and expression, yellow fluorescence mainly concentrates on the region (Fig. 2) of being launched red fluorescence by Nile Red specifically.Illustrate that eYFP can be concentrated to oil body from other positions intracellular by the MiClo of amalgamation and expression, thus the albumen demonstrating MiClo coded by said gene can be anchored on oil body exactly, there is the function maintaining oil body structure integrity.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the inventive method; can also make some improvement and supplement, these improve and supplement and also should be considered as protection scope of the present invention.
Claims (9)
1. the DNA sequence dna be separated, it is characterized in that, described DNA sequence dna is:
A) SEQ ID NO.1 or the nucleotide sequence described in SEQ ID NO.2; Or
The nucleotide sequence of the nucleotide sequence complementary b) and a).
2. DNA sequence dna according to claim 1 is in encodes oil body calsequestrin, the stability strengthening oil body in grain and oil crop or the application increased in the grease yield of grain and oil crop.
3. a recombinant expression vector, is characterized in that, described carrier is the recombinant expression vector constructed by nucleotide sequence according to claim 1 and plasmid or virus.
4. recombinant expression vector according to claim 3, is characterized in that, described plasmid is pYES2 plasmid.
5. the recombinant expression vector described in claim 3 or 4 is in encodes oil body calsequestrin, the stability strengthening oil body in grain and oil crop or the application increased in the grease yield of grain and oil crop.
6. a genetically engineered host cell, is characterized in that, described host cell be selected from following in one:
A) to transform with nucleotide sequence according to claim 1 or the host cell of transduction and progeny cell thereof;
B) host cell using the recombinant expression vector described in claim 3 or 4 to transform or to transduce and progeny cell thereof.
7. host cell according to claim 6, is characterized in that, described host cell is bacterial cell, fungal cell, or the offspring of these host cells.
8. host cell according to claim 6, is characterized in that, described host cell is yeast cell.
9. host cell according to claim 6 is in encodes oil body calsequestrin, the stability strengthening oil body in grain and oil crop or the application increased in the grease yield of grain and oil crop.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510007643.3A CN104593362B (en) | 2015-01-08 | 2015-01-08 | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510007643.3A CN104593362B (en) | 2015-01-08 | 2015-01-08 | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104593362A true CN104593362A (en) | 2015-05-06 |
| CN104593362B CN104593362B (en) | 2017-05-03 |
Family
ID=53119417
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510007643.3A Active CN104593362B (en) | 2015-01-08 | 2015-01-08 | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104593362B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107556373A (en) * | 2017-10-24 | 2018-01-09 | 上海海洋大学 | Incise gene order and its application of the main fat drips albumen of edge green alga |
| CN112210520A (en) * | 2019-07-11 | 2021-01-12 | 王峥鉴 | Biocontrol bacterium for expressing yellow-green fluorescent protein and construction method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101932706A (en) * | 2007-12-04 | 2010-12-29 | 俄亥俄州州立大学研究基金会 | Molecular approaches for the optimization of biofuel production |
| WO2011127118A1 (en) * | 2010-04-06 | 2011-10-13 | Algenetix, Inc. | Methods of producing oil in non-plant organisms |
| CN103562217A (en) * | 2011-05-26 | 2014-02-05 | 纳幕尔杜邦公司 | Expression of caleosin in recombinant oleaginous microorganisms to increase oil content therein |
-
2015
- 2015-01-08 CN CN201510007643.3A patent/CN104593362B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101932706A (en) * | 2007-12-04 | 2010-12-29 | 俄亥俄州州立大学研究基金会 | Molecular approaches for the optimization of biofuel production |
| WO2011127118A1 (en) * | 2010-04-06 | 2011-10-13 | Algenetix, Inc. | Methods of producing oil in non-plant organisms |
| CN103562217A (en) * | 2011-05-26 | 2014-02-05 | 纳幕尔杜邦公司 | Expression of caleosin in recombinant oleaginous microorganisms to increase oil content therein |
Non-Patent Citations (2)
| Title |
|---|
| LONG-LING OUYANG等: "Transcriptome analysis reveals unique C4-like photosynthesis and oil body formation in an arachidonic acid-rich microalga Myrmecia incisa Reisigl H4301", 《BMC GENOMICS》 * |
| Transcriptome analysis reveals unique C4-like photosynthesis and oil body formation in an arachidonic acid-rich microalga Myrmecia incisa Reisigl H4301;Long-Ling Ouyang等;《BMC Genomics》;20131231;第14卷(第396期);摘要，第2页右栏第2-8行，第9页左栏第31-44行，第10页右栏第15-24行 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107556373A (en) * | 2017-10-24 | 2018-01-09 | 上海海洋大学 | Incise gene order and its application of the main fat drips albumen of edge green alga |
| CN107556373B (en) * | 2017-10-24 | 2019-08-06 | 上海海洋大学 | Incise the gene order and its application of the main fat drips albumen of edge green alga |
| CN112210520A (en) * | 2019-07-11 | 2021-01-12 | 王峥鉴 | Biocontrol bacterium for expressing yellow-green fluorescent protein and construction method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104593362B (en) | 2017-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120088279A1 (en) | Algal lipid production | |
| CN102943081B (en) | Deoxyribose nucleic acid (DNA) sequence for encoding parietchloris incise diacylglycerol acyltransferase and application thereof | |
| KR101952470B1 (en) | Filamentous fungi having an altered viscosity phenotype | |
| AU2010224029A1 (en) | Engineering salt tolerance in photosynthetic microorganisms | |
| CN103756985B (en) | Myrmecia incisa Reisigl diacylglycerol acyltransferase gene sequence and use thereof | |
| CN102268448A (en) | Expression equipment for expressing heterologous protein in Trichoderma reesei cell, and gene engineering bacteria | |
| CN102304540A (en) | Expression equipment for expressing exogenous protein by secretion in trichoderma reesei and application of expression equipment | |
| Wang et al. | The chloroplast genetic engineering of a unicellular green alga Chlorella vulgaris with two foreign peptides co-expression | |
| CN101585871B (en) | Protein related to heat resistance property and coding gene and application thereof | |
| CN104593362A (en) | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof | |
| CN107556373B (en) | Incise the gene order and its application of the main fat drips albumen of edge green alga | |
| CN103468737B (en) | A kind of vegetable oils containing keratinocyte growth factor KGF2 | |
| CN105924512B (en) | One kind GhLPAAT5-like albumen relevant to fat content and its encoding gene and application | |
| CN104232642A (en) | Low-temperature induction-type promoter of tea tree | |
| CN105274068A (en) | Myrmecia incisa reisigl delta 9 fatty acid desaturase coding DNA (deoxyribonucleic acid) sequence and application thereof | |
| WO2021239071A1 (en) | Cultivation method for improving yield of microalgae triacylglycerol (tag) and application thereof | |
| KR102211740B1 (en) | Novel promoter HASP1 of Phaeodactylum tricornutum and signal peptide thereof and uses thereof | |
| JPWO2020135763A5 (en) | ||
| CN113736806A (en) | Gene for improving oil synthesis of marine nannochloropsis and application thereof | |
| CN105177027A (en) | Peach fatty acid desaturase gene PpFAD2 and application thereof | |
| CN102226196A (en) | DNA sequence for coding Myrmecia incisa delta-6 fatty acid elongase and application thereof | |
| CN107227308B (en) | Rape BnaSPT3 gene is promoting the application in the growth of dicotyledon silique | |
| CN105132391B (en) | A kind of polypeptide of triacylglycerol synthesis capability for improving MiDGAT1 in brewer's yeast and application thereof | |
| EP2441828B1 (en) | Algal bio-flocculation by inactivation of photoreceptors | |
| CN103320457B (en) | A kind of vegetable oils containing CoQ10 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |