CN107556373B - Incise the gene order and its application of the main fat drips albumen of edge green alga - Google Patents

Abstract

The present invention relates to the gene orders and its application of incising the main fat drips albumen of edge green alga.The present invention obtains a kind of gene order of main fat drips albumen from incising in edge green alga, it is tested by gene overexpression and finds that the gene coded protein positively locates in the fat drips of yeast cells, to confirm that the gene participates in the function that fat drips are formed, further confirm that it has the ability for improving Accu-mulation by Yeast Cells or storing triacylglycerol further through thin-layer chromatographic analysis.Therefore, of the invention to incise the main fat drips albumen of edge green alga and its gene order and be applied to Biological Energy Industry, to increase grease yield.

Description

Incise the gene order and its application of the main fat drips albumen of edge green alga

Technical field

The present invention relates to bioenergies and plant biotechnology field, specifically, being related to incising the main fat drips of edge green alga The gene order and its application of albumen (major lipid droplet protein, MLDP).

Background technique

The energy is the basis of human social development.The whole world is faced with energy crisis at present, and petroleum resources are in short supply, and Reproducibility makes concern of the exploitation of bioenergy increasingly by society.Microalgae biodiesel do not striven with people with it grain, not with The unique advantage that grain strives ground, does not strive material with poultry has attracted the concerns of more and more researchers.Make to improve various oil plants The oil production of object, fat drips and fat drips binding protein (protein associated lipid droplet) are increasingly becoming plant The goal in research of biotechnology.The ability of different types of microalgae accumulation fat drips is different, the eukaryons microalgae such as green algae, diatom Fat content is relatively high, promises to be the production algae of biodiesel.Edge green alga (Myrmecia is incised in this laboratory research Incisa Reisigl H4301) it is a kind of unicellular microalgae of fresh water, it is subordinate to Chlorophyta (Chlorophyta).The algae can be a large amount of It accumulates triacylglycerol (TAG), especially under the conditions of nitrogen stress, these TAG are wrapped in half elementary membrane to be existed in the form of fat drips It is potential microalgae biodiesel algae in cell.

The fat drips (lipid droplet, LD) of cell be also referred to as oil body (oil body, OB) or liposome (lipid body, LB), they will provide the carbon source stored and energy by the following growth of cell.Fat drips are the main of intracellular neutral fats storage Place is made of polarity list phospholipid layer package hydrophobic core.Proteomics research in recent years show fat drips surface there is also Many functional proteins, further disclose that fat drips may participate in the metabolism of intracellular matter and transhipment and cell signal pass It the processes such as leads, is the vigorous multi-functional organelle of an activity.

Patent document CN103965306A, publication date 2014.08.06, disclose a kind of oleaginous yeast fat drips albumen and its Encoding gene and application.Inventor identifies oleaginous yeast rhodotorula glutinis by fat drips proteomics research A kind of novel all rouge element sample albumen high abundance expression during (Rhodotorula glutinis) oil and fat accumulation, and find the egg White abundance is directly proportional to fat content, be named as RgLDP1 (R.glutinis lipid droplet protein 1, Rhodotorula glutinis fat drips albumen 1), green fluorescent protein common location and the oil fermentation analytical proof gene and oleaginous microorganism grease Accumulation, storing are closely related with metabolic regulation, can significantly improve cell grease accumulation and storage capacity.

However, yet there are no the related report for incising the main fat drips albumen of edge green alga that can significantly improve synthesis TAG function Road.

Summary of the invention

The purpose of the present invention is aiming at the shortcomings in the prior art, provide a kind of base for incising the main fat drips albumen of edge green alga Because of sequence and its application.

In a first aspect, the present invention provides a kind of polypeptide, the amino acid sequence of the polypeptide such as SEQ ID NO.11 institute Show.

Second aspect, the present invention provides a kind of isolated nucleotide sequence, the nucleotide sequence includes:

A) nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.10；Or

B) with a) described in the complementary nucleotide sequence of nucleotide sequence.

The third aspect, the present invention provides a kind of recombinant expression carrier, the recombinant expression carrier is by as described above Nucleotide sequence and plasmid or virus constructed by recombinant expression carrier.

As a preference, the plasmid is pYES2 plasmid.

Fourth aspect, the present invention provides a kind of genetically engineered host cell, the host cell is selected from down One of column:

A) host cell for being converted or being transduceed with nucleotide sequence as described above；

B) host cell for being converted or being transduceed with recombinant expression carrier as described above.

As a preference, the host cell is bacterial cell or fungal cell.

As a preference, the host cell is yeast cells.

5th aspect, the present invention provides polypeptide as described above, nucleotide sequence as described above, weights as described above Group expression vector and host cell as described above are increasing the purposes in grease yield.

As a preference, the increase grease yield, which refers to, increases triacylglycerol yield.

The invention has the advantages that:

1, the present invention has screened one and known main rouge in the sequencing data for incising edge green alga transcript profile high throughput Drop albumen has the segment of the long 1508bp of certain similitude.Quickly expanded based on the fragment sequence design primer and using the end cDNA Increase the full length cDNA sequence that (RACE) technology is cloned into the gene, determines that the gene is main fat drips albumen base by homologous comparison Because of family, this is named as MiMLDP.By in eukaryon model organism yeast BY4741 bacterial strain with enhanced yellow fluorescence egg The experiment of white (eYFP) the amalgamation and expression gene, i.e. gene overexpression, it is found that the gene coded protein is positively located in yeast cells Fat drips on, to confirm the function of gene chemical synthesis TAG.Further through thin-layer chromatographic analysis, it was demonstrated that it, which has, improves yeast Cellular Accumulation or the ability for storing TAG.Based on this, the present invention provides one kind to incise the main fat drips albumen of edge green alga, its gene The purposes of sequence and they, is overexpressed the gene in grain and oil crop or albumen can increase the stability of fat drips, can lead to fat drips Formation to increase grease yield.

2, the ability for incising the main fat drips albumen raising TAG synthesis of edge green alga of the invention is very prominent, is significantly better than this Invent other albumen of seminar's synchronized detection.

To sum up, the present invention has broad application prospects in Biological Energy Industry.

Detailed description of the invention

Fig. 1 incises the gene structure display of edge green alga MiMLDP.Grey lines are non-translational regions, and black line is introne, Black box is exon.

The fluorescence picture of Fig. 2 yeast cells.It is followed successively by yeast strain BY4741 from top to bottom, turns to carry eYFP carrier (pY-eYFP) BY4741 bacterial strain turns the eYFP fusion expression vector (pY-MiMLDP-eYFP) for carrying target gene BY4741 bacterial strain.Bright is light field figure, and Yellow is the yellow fluorescence protein signal graph of eYFP transmitting, and Red is Nile Red The red fluorescent figure emitted after dyeing, Merged are the stacking chart of three width figure of front.

Fig. 3 analyzes yeast lipid with thin layer chromatography (TLC).Swimming lane from left to right is respectively to turn to carry purpose base The BY4741 bacterial strain of the eYFP fusion expression vector (pY-MiMLDP-eYFP) of cause turns to carry eYFP carrier (pY-eYFP) BY4741 bacterial strain, yeast strain BY4741, TAG standard (Avanti, the U.S.).

Specific embodiment

It elaborates with reference to the accompanying drawing to specific embodiment provided by the invention.

Embodiment 1

Used primary operational route includes:

1) temperature is 25 DEG C, intensity of illumination is 115 μm of ol photonsm^-2·s^-1Under conditions of, it is cultivated in BG-11 Edge green alga is incised in culture in base.Frustule is collected, and extracts genomic DNA and RNA.

2) screening in edge green alga transcript profile sequencing data is incised certainly obtains one and main fat drips albumen (major lipid Droplet protein, MLDP) gene have relatively high similitude long 1508bp segment, be based on the fragment sequence, utilize RACE technology obtains the cDNA sequence overall length of MLDP gene, we are named as MiMLDP.Then, using incising edge green alga The cDNA of RNA reverse transcription is that template carries out sequence verification to the cDNA full length sequence of MiMLDP.

3) according to the cDNA sequence design primer of MiMLDP overall length, PCR expansion is carried out using edge green alga DNA is incised as template Increase, obtains the DNA full length sequence of MiMLDP.

4) according to the cDNA full length sequence of MiMLDP and the primers of eYFP, pMD19T/ is constructed using PCR MiMLDP and pMD19T/eYFP plasmid.

5) double digestion (EcoRI/XbaI) is carried out to pYES2 carrier and pMD19T/eYFP plasmid, recycles target fragment, then It is connected to obtain the recombinant expression carrier pY-eYFP for carrying eYFP with T4 ligase.

6) double digestion (HindIII/EcoRI) then is carried out to pY-eYFP carrier and pMD19T/MiMLDP plasmid, recycling Target fragment, then connected to obtain the recombinant vector pY-MiMLDP- for carrying target gene and eYFP amalgamation and expression with T4 ligase eYFP。

7) recombinant vector pY-eYFP and pY-MiMLDP-eYFP electroporation apparatus electric shocking method is distinguished into transformed yeast BY4741 screens transformant using the synthetic media (SC-U) of uracil-deficient, and screening obtains carrying pY-eYFP and pY- The transgenic yeast of MiMLDP-eYFP.

8) the yeast BY4741 for turning target gene, turning empty carrier (pY-eYFP) and non-transgenosis is inoculated in SC culture medium, Yeast is collected after culture 72h.

9) yeast strain and transgenic yeast are carried out using fat drips specific fluorescence dye Nile red (Nile Red) thin Born of the same parents' dyeing, is found using confocal laser scanning microscope: yellow fluorescence is in the transgenic yeast cell for carrying pY-eYFP Disperse shape；And in the yeast cells for turning target gene MiMLDP and eYFP fusion expression vector (pY-MiMLDP-eYFP), it is yellow Color fluorescence and the red fluorescence of dye fat drips are completely coincident.The result demonstrates the encoded albumen of MiMLDP and is positioned in fat drips, Have the function of stablizing fat drips structure.

10) 50mg yeast freeze-dried powder is taken, the chloroform of 1mL is added: then methanol (2:1) solution uses N to extract its total rouge₂ After drying, 30 μ L chloroforms are added, sample is resuspended, draws a certain amount of sample and point sample to 60F254 silica gel thin-layer chromatography plate In (Merck, Germany), while adding TAG standard specimen (Avanti, the U.S.).It is unfolded and is developed the color with solvent again, compares containing for TAG Amount.

Specific operation process is as follows:

1, material

1) edge green alga (Myrmecia incisa Reisigl H4301) is incised purchased from Prague, CZE Charles university algae Class Culture Center.Temperature is 25 DEG C, intensity of illumination is 115 μm of ol photonsm^-2·s^-1, light dark is than for 12h/12h's Under the conditions of cultivate, culture medium BG-11.

2) pYES2 carrier is purchased from Invitrogen company.Yeast defect strain BY4741 (Mata his3 Δ leu2 Δ met15 Δ ura3 Δ) it is purchased from Germany EUROSCARF.By yeast-inoculated in SC culture medium, with 200 turns of minutes at 30 DEG C^-1(rpm) turn Fast shaken cultivation.

2, method

1) the edge chlorella cell of incising for taking 100mg fresh is placed in the mortar of pre-cooling, and liquid nitrogen is added and is fully ground.

2) it is utilized respectively CTAB method and TRIzol method extracts the genomic DNA and total serum IgE of frustule, -20 DEG C save backup.

3) one and Dunaliella salina are screened in incising edge green alga transcript profile high-flux sequence database (Dunaliella salina) MLDP (AEW43285.1) code sequence shows the long 1508bp segment of 24% similitude (Contig21779), according to its primers, the SMART of Clontech company is utilized^TMRACE cDNA amplification kit Carry out PCR amplification.5 '-RACE use nest-type PRC.

The PCR reaction condition of the first round are as follows: 94 DEG C of denaturation 30s, 75 DEG C of annealing 45s and 72 DEG C of extension 2min, last 72 DEG C Extend 10min, 20 circulations；Primer be 5GSP1 (5 '-CTCCATGGCACGCACGCAGGTGTGTCCAA-3 ', SEQ ID NO: 1) and kit in UPM.Second wheel PCR reaction takes 1.5 μ L first round PCR products directly as the second wheel reaction template, instead Answering condition is 94 DEG C of denaturation 30s, 73 DEG C of annealing 45s and 72 DEG C of extension 2min, last 72 DEG C of extensions 10min, and totally 30 recycle；Draw Object is the NUPM in 5GSP2 (5 '-GCCATAAGTCCGCAGAAACTCCAGCCG-3 ', SEQ ID NO:2) and kit.3'- RACE also uses nest-type PRC.The PCR reaction condition of the first round are as follows: 30s and 72 DEG C of 94 DEG C of denaturation 30s, 73 DEG C of annealing extension 2min, last 72 DEG C of extensions 10min, 20 circulations；Primer be 3GSP1 (5 '-CCCAGACGAAACGGCATGTCAGGAGC-3 ', SEQ ID NO:3) and UPM.Second wheel PCR reaction takes 1.5 μ L first round PCR products directly as the second wheel reaction template, instead Answering condition is 94 DEG C of denaturation 30s, 71 DEG C of annealing 1min and 72 DEG C of extension 2min, last 72 DEG C of extensions 10min, and totally 30 recycle； Primer is the NUPM in 3GSP2 (5 '-GCCATAAGTCCGCAGAAACTCCAGCCG-3 ', SEQ ID NO:4) and kit.It will PCR product is connected to pMD19T carrier after carrying out glue recycling, converts Escherichia coli (Escherichia coli) DH5 α competence Cell, blue hickie screening, picking positive colony, bacterium colony PCR verifying, bacterium solution are sent to the survey of Shanghai Sheng Gong bioengineering Co., Ltd Sequence.5 '-and the 3 '-terminal fragment sequences that sequencing obtains are spliced with known sequence fragment, obtain the overall length of MiMLDP CDNA sequence.

4) the cDNA full length sequence of MiMLDP, design primer (upstream primer CDF:5 '-are obtained according to RACE technology ATGGGGATAAGAAGGGGAGG-3 ', SEQ ID NO:5, downstream primer CDR:5 '-AACCAGCCGGGACTAGTAACTC-3 ', SEQ ID NO:6) carry out PCR amplification.PCR response procedures are 94 DEG C of initial denaturation 5min, 35 circulations comprising 94 DEG C of denaturation 30s, 64 DEG C of annealing 45s, 72 DEG C of extensions 70s, last 72 DEG C of extensions 10min.Glue recycling, TA clone, bacterium colony are carried out according to the method described above After PCR verifying, bacterium solution is sent to the sequencing of Shanghai Sheng Gong bioengineering Co., Ltd, it was demonstrated that incises the cDNA overall length of edge green alga MiMLDP Sequence (SEQ ID NO:7).

5) according to cDNA full length sequence design primer (the upstream primer DF:5 '-of MiMLDP GGTCCGGCTAATGCGACTTCAA-3 ', SEQ ID NO:8, downstream primer DR:5 '-TGACACAGATCACGCTCGCT-3 ', SEQ ID NO:9), PCR amplification is carried out as template to incise edge green alga DNA.Amplification condition is 94 DEG C of initial denaturation 5min, and 35 are followed Ring includes 94 DEG C of denaturation 45s, 67 DEG C of annealing 45s, 72 DEG C of extensions 80s, last 72 DEG C of extensions 10min.PCR product is according to the above method After glue recycling, TA clone and bacterium colony PCR verifying, the sequencing of Hai Shenggong bio-engineering corporation is served, obtains incising edge green alga The DNA full length sequence (SEQ ID NO:10) of MiMLDP.

6) according to the cDNA overall length of MiMLDP and eYFP sequence separately design primer (SEQ ID NO:11-SEQ ID NO: 14), their restriction enzyme sites respectively containing HindIII/EcoRI and EcoRI/XbaI utilize PCR reaction building pMD19T/ MiMLDP and pMD19T/eYFP plasmid.The pcr amplification reaction system of 25 μ L includes the Ex Taq buffer of 2.5 μ L, 2 μ L The Mg of dNTPs, 2 μ L²⁺, the cDNA template of 2 μ L, the primer of 1 μ L, the Ex Taq enzyme of 0.25 μ L and 14.5 μ L sterile waters.Expand item Part is 94 DEG C of initial denaturation 5min, and 35 circulations include 94 DEG C of denaturation 45s, 64 DEG C of (eYFP annealing temperature is 60 DEG C) annealing 45s, 72 DEG C extend 2min, last 72 DEG C of extensions 10min.PCR product is cloned through glue recycling, TA according to the above method, serves the raw work biology in sea The accuracy to ensure sequence is sequenced in engineering company.

7) pMD19T/MiMLDP and pMD19T/eYFP plasmid is extracted from bacillus coli DH 5 alpha.Use restriction enzyme EcoRI and XbaI carries out double digested reaction to pMD19T/eYFP, while using identical restriction endonuclease to pYES2 plasmid Carry out double digested reaction.Reaction system be 4 μ L 10 × M buffer, the 0.1%BSA of 4 μ L, DNA about 2 μ g, XbaI and Each 1 μ L of EcoRI, adds no RNase water to 20 μ L.37 DEG C of digestion reaction 4h.Target fragment after being tapped and recovered digestion, and use T₄ DNA ligase connect the eYFP segment after digestion to obtain recombinant vector pY-eYFP with pYES2 segment.Coupled reaction system is The buffer of 2.5 μ L, the DNA of eYFP about 0.3pmol, the DNA of carrier pYES2 about 0.03pmol, the T of 1 μ L₄DNA ligase adds Without RNase water to 25 μ L.16 DEG C of connections are overnight.Be ligated and transformed into bacillus coli DH 5 alpha competent cell, according to the method described above into Row clone, bacterium colony PCR verifying and sequencing.PY-eYFP plasmid is extracted from bacillus coli DH 5 alpha, -20 DEG C save backup.Then it uses Restriction enzyme HindIII and EcoRI carries out double digested reaction to pMD19T/MiMLDP and pY-eYFP plasmid respectively, Recombinant vector pY-MiMLDP-eYFP is obtained using method same as described above.

8) prepared by competent yeast cells.By yeast-inoculated in SC culture medium, then 30 DEG C of recovery overnight incubations press 1: 100 amplification cultures, are about 1 × 10 with 200rpm speed oscillation culture to cell density⁸Cell mL^-1(about 4~5h).It is cold on ice But 15min makes cell stop growing, and collects yeast cells under the conditions of 4 DEG C with 5 000rpm revolving speeds centrifugation 5min, sterile water is pre-chilled It washs cell 3 times, is collected by centrifugation under similarity condition.1M sorbitol washes cell 1 time of 20mL pre-cooling, it is pre- to be then dissolved in 0.5mL Cold 1M sorbierite adjusts the concentration of cell 1 × 10¹⁰Cell mL^-1.Cell is saved on ice, is used convenient for electric shock.

9) it is shocked by electricity using electroporation apparatus (Bio-Rad), recombinant vector pY-MiMLDP-eYFP transformed yeast BY4741 is felt By state cell.Take about 5~10 μ L (5~200ng) of DNA of the recombinant vector pY-MiMLDP-eYFP to be transformed being pre-chilled on ice with Competent yeast cells mix, and are pre-chilled on ice together with the electric shock cup of 0.2cm, are then transferred to DNA and cell mixture The electric shock cup of pre-cooling mixes gently, and after ice bath 5min, option program Sc2 electric shock is primary, removes electric shock cup, it is pre- to be added immediately 1mL Cold 1M sorbierite is gently transferred in new YPD culture medium, and bacterium solution is coated on containing 1M sorb by 30 DEG C of slight oscillatory 5h On the uracil-deficient synthetic media (SC-U) of alcohol, 30 DEG C of inversion stationary culture 48-72h, picking colony is trained in liquid SC-U It supports and is cultivated in base.After bacterium colony PCR verifying, strain is saved with the SC-U culture medium containing 2% glucose.In addition, pressing above-mentioned same sample prescription Method goes to unloaded pY-eYFP electricity on BY4741.

10) viable yeast is contaminated with fat drips specific fluorescent dye Nile Red (Genmed Scientifics Inc., the U.S.) Color is taken pictures with laser confocal microscope (Carl Zeiss LSM 710, Germany) observation.Wherein Nile Red fluorescent dye Excitation wavelength used is 543nm, and launch wavelength 598nm, yellow fluorescence protein excitation wavelength is 514nm, and launch wavelength is 527nm。

11) 50mg yeast freeze-dried powder is taken, the chloroform of 1mL: the bead of methanol (2:1) solution and 200~300 μ L is added After (0.4~0.6mm of diameter) (Sigma, the U.S.), 1h is acutely vibrated.Microscopy is centrifuged after clasmatosis with 5500rpm 15min.It takes supernatant into new centrifuge tube, is separately added into the 50mmol/L citric acid and 600 μ L chloroforms of 400 μ L, then with 5500rpm is centrifuged 15min.It is careful to draw lower layer's organic phase, use N₂It is saved backup for -20 DEG C after drying.Add in the sample of drying Enter the resuspension of 30 μ L chloroforms, draw 15 μ L samples with pipettor and is put 60F254 silica gel thin-layer chromatography plate (Merck, Germany) On, while adding TAG standard specimen (Avanti, the U.S.).It is opened up again with solvent (n-hexane: ether: glacial acetic acid, 80:20:1, v/v/v) It opens, finally by the color developing agent (CuSO of phosphoric acid and 10% (w/v) containing 8% (v/v)₄·5H₂O it) is sprayed on silica gel column chromatography plate, 10min colour developing is dried in 140 DEG C to compare the content of TAG.

3, result

1) it is verified according to RACE technology and by PCR amplification, obtains the cDNA full length sequence for incising edge green alga MiMLDP (SEQ ID NO:7)；Its long 780bp of 5 '-non-translational region (UTR) long 217bp, 3 '-UTR, opens frame frame (ORF) long 918bp, compiles One albumen being made of 305 amino acid of code, the amino acid sequence of the albumen is as shown in SEQ ID NO:11.Using incising edge Green alga genomic DNA is that template carries out pcr amplification reaction, DNA full length sequence (the SEQ ID of MiMLDP known to after sequence is analyzed NO:10) overall length 2353bp, there are 4 intrones in ORF, the length of these intrones is successively distinguished from 5 '-ends to 3 '-ends For 87bp, 79bp, 164bp and 86bp, so that the ORF of the gene is separated into 5 exons (Fig. 1).

2) yeast and transgenic yeast utilize fat drips specific fluorescent dye Nile Red couple after galactolipin Fiber differentiation Its cell is dyed, and is observed under different excitation wavelengths by laser confocal microscope.Turning unloaded (pY-eYFP) In yeast cells, discovery yellow fluorescence diffuses entire cell spaces other than the cores；Melt turning target gene MiMLDP and eYFP Close expression vector (pY-MiMLDP-eYFP) yeast in, yellow fluorescence be concentrated mainly on specifically emitted by Nile Red it is red In region, that is, fat drips of color fluorescence (Fig. 2).Illustrate that the MiMLDP of amalgamation and expression can fluorescence by eYFP from other intracellular positions Signal is concentrated in fat drips, it was demonstrated that the albumen of MiMLDP coded by said gene can be accurately anchored in fat drips, had and stablized rouge Drip the function of structure.

3) yeast lipid is analyzed by TLC technique, it is known that yeast BY4741 bacterial strain carries unloaded (pY-eYFP) Transgenic yeast and the transgenic yeast for carrying target gene (pY-MiMLDP-eYFP) can synthesize TAG.Compared to BY4741 bacterial strain and the transgenic strain for carrying pY-eYFP carry the transgenic yeast of target gene (pY-MiMLDP-eYFP) Contained TAG amount is relatively high (Fig. 3), is estimated according to area using ImageJ software, is BY4741 bacterial strain respectively and carries empty Carry 3.20 and 2.48 times of (pY-eYFP) transgenic yeast TAG amount.Illustrate to be overexpressed in yeast and incises edge green alga MiMLDP, because MiMLDP is anchored in fat drips to increase the stability of fat drips, to improve yeast cells storage or accumulate TAG's Ability.

It is the special instruction about some sequences below:

The cDNA full length sequence (underscore is starting or terminator codon) of SEQ ID NO:7 --- MiMLDP:

GATTAAGCAGTGGTATCAACGCAGAGTACATGGGGATAAGAAGGGGAGGCCCTGGGGGCAAGAGGAGCG GCACAGCGTCTTGTAAGACTCAGTGATTACAGGTCCGGCTAATGCGACTTCAACTGGATAACAAGCCGCTGTGCAAA GCAGAGGTTCGTGTACCGCCCCGAGGTCTCGTTGCAACAGCAGCCCCGGAGAAAGCCTGCAGGAGGCAAGCATGGGC AAGTCCTCCAAAGCCCGCCATTACCATCACCCTGGTAAATACCCATACTGCCCAGTCAGGGCACCGGCCAACGTGCT GGTGATGCGCTCACCTCTGCGACAGCAGGAAAATGGTCAAGTGGCCGGCGTGGCAGGGCAGGGCGCGTCCCCCTTCT GGCCTGCTGAGCCTGCTGGCAAGGCTCACGACCTCAAACGGCTGGAGTTTCTGCGGACTTATGGCGAGTACTACTGG AGCAAGGCTAACCAGCTGGCTTCCACAGTTTACTCCACGGGTCGCGCCTACACGCCTGCAACCTTGGACACACACCT GCGTGCCATGGAGGAGCGGGTGTCGTCCTTCAGCCTGCCCATTGTGTGTGCTGTGACGCAGCAGACTGAGAGCGTCC TGCGTTCCTTGGACGGCAAGGTGGATGGCGTGTTCCATGCAGCGTCAGAGCTGTTTGCTCACAATAGCTTCGTGGGT GACGCATTTGAGCGGCAGCGGGGCTACCACTCCCCCTCACTCAAGGCAGCCGGGGAGGAGTACCTGCACAAGCTGGA AGAGGCCTGGTGCAAGCTCATAGCGCTGCCCCCAGTCAACAAGCTCCTGGAGAGCACTGCGCCGTCCGTCGATTTCA CCCGCCGCAAGTACCTGGCCGCACACGATGTGGTGGTGGGGTCCACCTCCTACAATAAGGCCTTGGCAACGGCCGCC AGCATGCTGGATCAGGTCAAGGATACTTTTGTGTACAAGGCCGCTGCTAGCAAGCTGTACCCAGTCATCTCGCCGCT GGCGGACCCAGCCCTCAGCAAGATCACACATTCAGCCTGCTACAGCGCTGTTGTTGACCACCTGAAGCCAACTGGCC CCTCAAGCGACAGCGTGCACCACGCCGACCAGGCGTGGCGAGTCCTGTCTTGTGCCCAGTGCTAAGCCAGGCGGGCG TGTAGCCGTCTACTGCCTTTGTTGCCGACAGCGGCAGCTGGACTAGGCGGTAGTTGACCGTCTTATGCCTTGGGCTC ATGCGCTGGGGTCCCAAGTGGCGTCATTGTGCAAAACAACCCAGACGAAACGGCATGTCAGGAGCTCCGAGATGAGA GAGGGAATGCGGGTGACAGCTGGCAGGGCCAGCTTGGATCTCGTCATCCCAGCGGTGTGCTTCTGAAACCGGGTGCT GGCAAGTGCAAGCGGGTCTGCAGAACTGTAGTGGATAGCTGTGCCCCTTGCCATTCCACCTTGCAGCCAACGCTACT ACGCATGCGGGCATCAACGATGTGGGCAGTGTGAAAGGTGCTGCCTATCAAGTGAGAGAGCGAGCGTGATCTGTGTG TCAGCGGCGGGCCTCTGCGCAGCAGCCGGAATGAGCCCTCGCGTGGGCAGGGGGCAGTTGGCAAGATAAAGTGCCGG CACGAAGGGCAGGATGGACGCGCTGGTTGCAGGTCCTTCTCAAGTTTTGCAATGAGAGCGCACAAGGAGGACCATGT GCACATAACCCATGACCTAGCCGCTGAGCCTGCGGTTGTTACGGGGGAACGCTGTATGATCTGTCGTGTGCAAGCCA GGAGTTGTTTGCTCTGCATGTATGACATCACGTATCAAAGAAGCCCGCATGTGTTTTCAGTCGCTGTTGTTGCTCGA GTTACTAGTCCCGGCTGGTTGGGAGTTGTAGATGATCCTGCTTTCATCAAAAGATTGCAATCACTTGATTGTATC

(underscore is starting or terminator codon, runic portion to the DNA full length sequence of SEQ ID NO:10 --- MiMLDP It is divided into intron sequences):

SEQ ID NO:11 and SEQ ID NO:12 --- according to the cDNA full length sequence of MiMLDP design band HindIII and The primer of EcoRI restriction enzyme site:

(lowercase is upstream primer MOF:5 '-aagcttATGGGCAAGTCCTCCAAAGCC-3 ', SEQ ID NO:11 HindIII restriction enzyme site)；

Downstream primer MOR:5 '-gaattcTTAGCACTGGGCACAAGACAGGA-3 ', SEQ ID NO:12 (lowercase For EcoRI restriction enzyme site).

SEQ ID NO:13 and SEQ ID NO:14 --- according to eYFP sequence design with EcoRI and XbaI enzyme cutting site Primer:

(lowercase is EcoRI enzyme to upstream primer YF:5 '-gaattcATGGTGAGCAAGGG-3 ', SEQ ID NO:13 Enzyme site)；

Downstream primer YR:5 '-tctagaTTTACTTGTACAGCTCG-3 ', SEQ ID NO:14 (lowercase XbaI Restriction enzyme site).

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art Member, under the premise of not departing from the method for the present invention, can also make several improvement and supplement, these are improved and supplement also should be regarded as Protection scope of the present invention.

SEQUENCE LISTING

<110>Shanghai Ocean University

<120>gene order and its application of the main fat drips albumen of edge green alga are incised

<130> /

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 29

<212> DNA

<213>artificial sequence

<400> 1

ctccatggca cgcacgcagg tgtgtccaa 29

<210> 2

<211> 27

<212> DNA

<213>artificial sequence

<400> 2

gccataagtc cgcagaaact ccagccg 27

<210> 3

<211> 26

<212> DNA

<213>artificial sequence

<400> 3

cccagacgaa acggcatgtc aggagc 26

<210> 4

<211> 27

<212> DNA

<213>artificial sequence

<400> 4

gccataagtc cgcagaaact ccagccg 27

<210> 5

<211> 20

<212> DNA

<213>artificial sequence

<400> 5

atggggataa gaaggggagg 20

<210> 6

<211> 22

<212> DNA

<213>artificial sequence

<400> 6

aaccagccgg gactagtaac tc 22

<210> 7

<211> 1915

<212> DNA

<213> Myrmecia incisa

<400> 7

gattaagcag tggtatcaac gcagagtaca tggggataag aaggggaggc cctgggggca 60

agaggagcgg cacagcgtct tgtaagactc agtgattaca ggtccggcta atgcgacttc 120

aactggataa caagccgctg tgcaaagcag aggttcgtgt accgccccga ggtctcgttg 180

caacagcagc cccggagaaa gcctgcagga ggcaagcatg ggcaagtcct ccaaagcccg 240

ccattaccat caccctggta aatacccata ctgcccagtc agggcaccgg ccaacgtgct 300

ggtgatgcgc tcacctctgc gacagcagga aaatggtcaa gtggccggcg tggcagggca 360

gggcgcgtcc cccttctggc ctgctgagcc tgctggcaag gctcacgacc tcaaacggct 420

ggagtttctg cggacttatg gcgagtacta ctggagcaag gctaaccagc tggcttccac 480

agtttactcc acgggtcgcg cctacacgcc tgcaaccttg gacacacacc tgcgtgccat 540

ggaggagcgg gtgtcgtcct tcagcctgcc cattgtgtgt gctgtgacgc agcagactga 600

gagcgtcctg cgttccttgg acggcaaggt ggatggcgtg ttccatgcag cgtcagagct 660

gtttgctcac aatagcttcg tgggtgacgc atttgagcgg cagcggggct accactcccc 720

ctcactcaag gcagccgggg aggagtacct gcacaagctg gaagaggcct ggtgcaagct 780

catagcgctg cccccagtca acaagctcct ggagagcact gcgccgtccg tcgatttcac 840

ccgccgcaag tacctggccg cacacgatgt ggtggtgggg tccacctcct acaataaggc 900

cttggcaacg gccgccagca tgctggatca ggtcaaggat acttttgtgt acaaggccgc 960

tgctagcaag ctgtacccag tcatctcgcc gctggcggac ccagccctca gcaagatcac 1020

acattcagcc tgctacagcg ctgttgttga ccacctgaag ccaactggcc cctcaagcga 1080

cagcgtgcac cacgccgacc aggcgtggcg agtcctgtct tgtgcccagt gctaagccag 1140

gcgggcgtgt agccgtctac tgcctttgtt gccgacagcg gcagctggac taggcggtag 1200

ttgaccgtct tatgccttgg gctcatgcgc tggggtccca agtggcgtca ttgtgcaaaa 1260

caacccagac gaaacggcat gtcaggagct ccgagatgag agagggaatg cgggtgacag 1320

ctggcagggc cagcttggat ctcgtcatcc cagcggtgtg cttctgaaac cgggtgctgg 1380

caagtgcaag cgggtctgca gaactgtagt ggatagctgt gccccttgcc attccacctt 1440

gcagccaacg ctactacgca tgcgggcatc aacgatgtgg gcagtgtgaa aggtgctgcc 1500

tatcaagtga gagagcgagc gtgatctgtg tgtcagcggc gggcctctgc gcagcagccg 1560

gaatgagccc tcgcgtgggc agggggcagt tggcaagata aagtgccggc acgaagggca 1620

ggatggacgc gctggttgca ggtccttctc aagttttgca atgagagcgc acaaggagga 1680

ccatgtgcac ataacccatg acctagccgc tgagcctgcg gttgttacgg gggaacgctg 1740

tatgatctgt cgtgtgcaag ccaggagttg tttgctctgc atgtatgaca tcacgtatca 1800

aagaagcccg catgtgtttt cagtcgctgt tgttgctcga gttactagtc ccggctggtt 1860

gggagttgta gatgatcctg ctttcatcaa aagattgcaa tcacttgatt gtatc 1915

<210> 8

<211> 22

<212> DNA

<213>artificial sequence

<400> 8

ggtccggcta atgcgacttc aa 22

<210> 9

<211> 20

<212> DNA

<213>artificial sequence

<400> 9

tgacacagat cacgctcgct 20

<210> 10

<211> 2331

<212> DNA

<213> Myrmecia incisa

<400> 10

gattaagcag tggtatcaac gcagagtaca tggggataag aaggggaggc cctgggggca 60

agaggagcgg cacagcgtct tgtaagactc agtgattaca ggtccggcta atgcgacttc 120

aactggataa caagccgctg tgcaaagcag aggttcgtgt accgccccga ggtctcgttg 180

caacagcagc cccggagaaa gcctgcagga ggcaagcatg ggcaagtcct ccaaagcccg 240

ccattaccat caccctggta aatacccata ctgcccagtc agggcaccgg ccaacgtgct 300

ggtgatgcgc tcacctctgc gacagcagga aaatggtcaa gtggccggtg agtacagaca 360

cggctgccac gggtgctgag gtactgcggg tcgctgcctg ctggcgcttg acgtgccctg 420

tgcgcctcgg acaggcgtgg cagggcaggg cgcgtccccc ttctggcctg ctgagcctgc 480

tggcaaggct cacgacctca aacggctgga gtttctgcgg acttatggcg agtactactg 540

gagcaaggct aaccagctgg cttccacagt ttactccacg ggtcgcgcct acacgcctgc 600

aaccttggac acacacctgc gtgccatgga ggagcgggtg tcgtccttca gcctgcccat 660

tgtgtgtgct gtgacgcagc agactgagag cgtcctgcgt tccttggacg gcaaggtaag 720

aacttgtttg gctgccagct attctgtcca tggacactac agactggtct gctgacagtg 780

tggctgccct ctaggtggat ggcgtgttcc atgcagcgtc agagctgttt gctcacaata 840

gcttcgtggg tgacgcattt gagcggcagc ggggctacca ctccccctca ctcaaggcag 900

ccggggagga gtacctgcac aagctggaag aggcctggtg caagctcata gcgctgcccc 960

caggtgtgcc ccgtccatgc ctggttttca gccgcagcgc ggctgccgat gtacctgacc 1020

cttcgcgtcg ttgccaactt gctatcattg caggcagtgt cagcttgctg catcttttgg 1080

cttgtgcgca accggtgatg gtgacttgag gccggcatgt gtcgcagtca acaagctcct 1140

ggagagcact gcgccgtccg tcgatttcac ccgccgcaag tacctggccg cgcacgatgt 1200

ggtggtgggg tccacctcct acaataaggc cttggcaacg gccgccagca tgctggatca 1260

ggtcagcagc tgtgtggcag ctggctccgt tgctcttgcg tcctgctacc tcttgcagcc 1320

ttgcaagctg tcgtgggctg tccgcaggtc aaggatactt ttgtgtacaa ggccgctgct 1380

agcaagctgt acccagtcat ctcgccgctg gcggacccag ccctcagcaa gatcacacat 1440

tcagcctgct acagcgctgt tgttgaccac ctgaagccaa ctggcccctc aagcgacagc 1500

gtgcaccacg ccgaccaggc gtggcgagtc ctgtcttgtg cccagtgcta agccaggcgg 1560

gcgtgtagcc gtctactgcc tttgttgccg acagcggcag ctggactagg cggtagttga 1620

ccgtcttatg ccttgggctc atgcgctggg gtcccaagtg gcgtcattgt gcaaaacaac 1680

ccagacgaaa cggcatgtca ggagctccga gatgagagag ggaatgcggg tgacagctgg 1740

cagggccagc ttggatctcg tcatcccagc ggtgtgcttc tgaaaccggg tgctggcaag 1800

tgcaagcggg tctgcagaac tgtagtggat agctgtgccc cttgccattc caccttgcag 1860

ccaacgctac tacgcatgcg ggcatcaacg atgtgggcag tgtgaaaggt gctgcctatc 1920

aagtgagaga gcgagcgtga tctgtgtgtc agcggcgggc ctctgcgcag cagccggaat 1980

gagccctcgc gtgggcaggg ggcagttggc aagataaagt gccggcacga agggcaggat 2040

ggacgcgctg gttgcaggtc cttctcaagt tttgcaatga gagcgcacaa ggaggaccat 2100

gtgcacataa cccatgacct agccgctgag cctgcggttg ttacggggga acgctgtatg 2160

atctgtcgtg tgcaagccag gagttgtttg ctctgcatgt atgacatcac gtatcaaaga 2220

agcccgcatg tgttttcagt cgctgttgtt gctcgagtta ctagtcccgg ctggttggga 2280

gttgtagatg atcctgcttt catcaaaaga ttgcaatcac ttgattgtat c 2331

<210> 11

<211> 305

<212> PRT

<213> Myrmecia incisa

<400> 11

Met Gly Lys Ser Ser Lys Ala Arg His Tyr His His Pro Gly Lys Tyr

1 5 10 15

Pro Tyr Cys Pro Val Arg Ala Pro Ala Asn Val Leu Val Met Arg Ser

20 25 30

Pro Leu Arg Gln Gln Glu Asn Gly Gln Val Ala Gly Val Ala Gly Gln

35 40 45

Gly Ala Ser Pro Phe Trp Pro Ala Glu Pro Ala Gly Lys Ala His Asp

50 55 60

Leu Lys Arg Leu Glu Phe Leu Arg Thr Tyr Gly Glu Tyr Tyr Trp Ser

65 70 75 80

Lys Ala Asn Gln Leu Ala Ser Thr Val Tyr Ser Thr Gly Arg Ala Tyr

85 90 95

Thr Pro Ala Thr Leu Asp Thr His Leu Arg Ala Met Glu Glu Arg Val

100 105 110

Ser Ser Phe Ser Leu Pro Ile Val Cys Ala Val Thr Gln Gln Thr Glu

115 120 125

Ser Val Leu Arg Ser Leu Asp Gly Lys Val Asp Gly Val Phe His Ala

130 135 140

Ala Ser Glu Leu Phe Ala His Asn Ser Phe Val Gly Asp Ala Phe Glu

145 150 155 160

Arg Gln Arg Gly Tyr His Ser Pro Ser Leu Lys Ala Ala Gly Glu Glu

165 170 175

Tyr Leu His Lys Leu Glu Glu Ala Trp Cys Lys Leu Ile Ala Leu Pro

180 185 190

Pro Val Asn Lys Leu Leu Glu Ser Thr Ala Pro Ser Val Asp Phe Thr

195 200 205

Arg Arg Lys Tyr Leu Ala Ala His Asp Val Val Val Gly Ser Thr Ser

210 215 220

Tyr Asn Lys Ala Leu Ala Thr Ala Ala Ser Met Leu Asp Gln Val Lys

225 230 235 240

Asp Thr Phe Val Tyr Lys Ala Ala Ala Ser Lys Leu Tyr Pro Val Ile

245 250 255

Ser Pro Leu Ala Asp Pro Ala Leu Ser Lys Ile Thr His Ser Ala Cys

260 265 270

Tyr Ser Ala Val Val Asp His Leu Lys Pro Thr Gly Pro Ser Ser Asp

275 280 285

Ser Val His His Ala Asp Gln Ala Trp Arg Val Leu Ser Cys Ala Gln

290 295 300

Cys

305

Claims (8)

1. a kind of polypeptide, which is characterized in that the amino acid sequence of the polypeptide is as shown in SEQ ID NO.11.

2. a kind of isolated nucleotide, which is characterized in that the nucleotide sequence are as follows:

A) nucleotide sequence shown in SEQ ID NO.7 or SEQ ID NO.10；Or

B) with a) described in the complementary nucleotide sequence of nucleotide sequence.

3. a kind of recombinant expression carrier, which is characterized in that the recombinant expression carrier is by nucleotide as claimed in claim 2 Recombinant expression carrier constructed by sequence and plasmid or virus.

4. recombinant expression carrier according to claim 3, which is characterized in that the plasmid is pYES2 plasmid.

5. a kind of genetically engineered host cell, which is characterized in that the host cell is bacterial cell or fungal cell, The host cell is selected from one of the following:

A) host cell for being converted or being transduceed with nucleotide sequence as claimed in claim 2；

B) host cell for being converted or being transduceed with recombinant expression carrier as claimed in claim 3.

6. host cell according to claim 5, which is characterized in that the host cell is yeast cells.

7. recombinant expression described in polypeptide described in claim 1, nucleotide as claimed in claim 2, claim 3 or 4 carries Body or host cell described in claim 5 or 6 are increasing the purposes in grease yield.

8. purposes according to claim 7, which is characterized in that the increase grease yield refers to that increasing triacylglycerol produces Amount.