CN102943081B - Deoxyribose nucleic acid (DNA) sequence for encoding parietchloris incise diacylglycerol acyltransferase and application thereof - Google Patents

Abstract

The invention relates to a separated deoxyribose nucleic acid (DNA) sequence. The DNA sequence comprises a nucleotide sequence (a) of SEQIDNO.1 or SEQIDNO.2; or a nucleotide sequence (b) complementary with the nucleotide sequence (a). The invention further provides a recombinant expression vector containing the nucleotide sequence, a genetic engineering host cell and application of the nucleotide sequence, the recombinant expression vector and the host cell for encoding the diacylglycerol acyltransferase or producing triacylglycerol. The DNA sequence has the advantages that a cDNA full-length sequence and a DNA full-length sequence of a parietchloris incise diacylglycerol acyltransferase gene are obtained by screening, encoded protein of the gene has a triacylglycerol synthesis capability by expression of the gene in a TAG synthesis defect strain H1246 of yeast, and conditions are created for utilizing the gene to achieve large-scale synthesis of triacylglycerol by genetic operation.

Description

A kind of coding is incised DNA sequence dna and the application thereof of edge green alga Diacrylglycerol acyl transferase

Technical field

The present invention relates to gene engineering technology field, specifically, relate to DNA sequence dna and application thereof that a kind of coding is incised edge green alga Diacrylglycerol acyl transferase (MiDGAT2).

Background technology

The energy is the basis of human social development, and the whole world is being faced with energy dilemma at present, and petroleum resources are in short supply.Due to the recyclability of bioenergy, the exploitation of bioenergy more and more receives publicity, and micro-algae biofuel with its not with people strive grain, not with grain strive ground, not strive material with poultry unique advantage attracted the concern of more and more researchers.

The ability of the synthetic triacylglycerol (triacylglycerol, TAG) of different types of micro-algae is different.Research discovery, the fat content of the micro-algaes of eucaryon such as green alga, diatom is higher, promises to be the production algae kind of biofuel.Incise edge green alga ( myrmecia incisareisigl H4301) be the unicellular micro-algae of a kind of fresh water, be subordinate to Chlorophyta (Chlorophyta), this algae can accumulate TAG in a large number,, under nitrogen stress condition, is especially potential micro-algae biofuel algae kind.

TAG is topmost storage lipid in plant, and growing of plant also played an important role.The synthetic enzyme that has been found that at present TAG has Diacrylglycerol acyl transferase (DGAT; EC 2.3.1.20), phosphatide: Diacrylglycerol acyl transferase (PDAT; EC 2.3.1.158) and diglyceride transacylase (DGAT).Wherein, DGAT is the synthetic main enzyme of TAG, and it,, along the synthetic final step of Kennedy approach catalysis TAG, is also rate-limiting enzyme unique in this route of synthesis.Up to the present, find that DGAT has three families, be respectively DGAT1, DGAT2 and DGAT3.

Meeting paper in " Chinese phycology the 8th member representative assembly of meeting and the 16 the academic discussion thesis summary set " of 2011 " is incised the GPAT gene clone of edge green alga and prokaryotic expression ", 116061306) and Chlamydomonas reinhardtii (GenBank accession number: G3PAT amino acid conserved sequence 159473711) author is based on Ostreococcus tauri(GenBank accession number:, according to the Preference design pair of degenerate primers of incising edge green alga codon, carry out pcr amplification to incise edge green alga cDNA as template, obtain a 321bp amplified production, through sequential analysis, the G3PAT aminoacid sequence of it and Chlamydomonas reinhardtii has 75% homology.Utilize SMART RACE technology amplification to obtain after its 5'-end and 3'-end cDNA sequence, being 3284bp with gained fragment sequence splicing acquisition length incises edge green alga GPAT (MiG3PAT) gene cDNA full length sequence.But yet there are no people clone about incising edge green alga Diacrylglycerol acyl transferase full length gene at present.

Chinese periodical " Shanghai Ocean University's journal ", in September, 2012, the 21st the 5th phase of volume, the paper of publishing " is incised edge green alga and is transcribed group order-checking and lipid metabolism related genes annotation ", this Authors of Science Articles is in order in depth to understand the metabolic process of incising edge green alga arachidonic acid and lipid, utilize Roche 454 GS FLX sequenators to transcribe group to this algae and carry out high-throughout tetra-sodium order-checking, obtain high quality and read 382468 of orders (read), account for original 97.14% of the order of reading, read the long 322bp of order for average every, total size reaches 123Mb, obtain 22714 contigs through the splicing of CAP3 software again, article 25621, singleton.These sequences and public database are carried out to homology search, comparison, annotation of gene function and classification, and based on transcribing the gene constructed edge green alga lipid metabolism approach of incising annotating in group.But this paper does not disclose the cDNA sequence of incising edge green alga Diacrylglycerol acyl transferase, and those skilled in the art all know, high-flux sequence method exists error, and the cDNA sequence of measuring is not 100% accurate, exists the possibility of error very big.Therefore, if need to obtain the sequence of cDNA accurately of incising edge green alga Diacrylglycerol acyl transferase, need it to verify, and primer sequence be designed to committed step, determine that success clone obtains aim sequence.Obtain after the correct cDNA sequence of incising edge green alga Diacrylglycerol acyl transferase, can further obtain its DNA full length sequence.

Summary of the invention

The object of the invention is, for deficiency of the prior art, provides a kind of DNA sequence dna of separation.

One object more of the present invention is that a kind of purposes of DNA sequence dna of above-mentioned separation is provided.

Another object of the present invention is that a kind of recombinant expression vector is provided.

The 4th object of the present invention is that a kind of purposes of above-mentioned recombinant expression vector is provided.

The 5th object of the present invention is that a kind of genetically engineered host cell is provided.

The 6th object of the present invention is that a kind of purposes of host cell of said gene through engineering approaches is provided.

For achieving the above object, the technical scheme that the present invention takes is:

A DNA sequence dna for separation, described DNA sequence dna comprises:

A) nucleotide sequence described in SEQ ID NO.1 or SEQ ID NO.2; Or

The nucleotide sequence of the nucleotide sequence complementation b) and a).

For realizing above-mentioned second object, the technical scheme that the present invention takes is:

DNA sequence dna as above is at coding Diacrylglycerol acyl transferase or produce the purposes in triacylglycerol.

For realizing above-mentioned the 3rd object, the technical scheme that the present invention takes is:

A kind of recombinant expression vector, described carrier is by nucleotide sequence as above and plasmid or viral constructed recombinant expression vector.

Preferably, described plasmid is pYES2 plasmid.

For realizing above-mentioned the 4th object, the technical scheme that the present invention takes is:

Recombinant expression vector as above is at coding Diacrylglycerol acyl transferase or produce the purposes in triacylglycerol.

For realizing above-mentioned the 5th object, the technical scheme that the present invention takes is:

A genetically engineered host cell, described host cell is selected from the one in following:

A) host cell and the progeny cell thereof that transform or transduce with nucleotide sequence as above;

B) host cell and the progeny cell thereof that transform or transduce with recombinant expression vector as above.

Described host cell can be bacterial cell, fungal cell, vegetable cell or zooblast, or the offspring of these host cells.

Preferably, described host cell is yeast cell.

For realizing above-mentioned the 6th object, the technical scheme that the present invention takes is:

Host cell as above is at coding Diacrylglycerol acyl transferase or produce the purposes in triacylglycerol.

The invention has the advantages that:

1, the present invention is based on and incise edge green alga and transcribe group sequencing data; screening obtains the correct cDNA full length sequence of incising edge green alga Diacrylglycerol acyl transferase (MiDGAT2) gene; determine that by homology compare of analysis this enzyme is DAGT2 gene family, and further obtained miDGAT2dNA full length sequence;

2, the present invention will be by being somebody's turn to do miDGAT2in the synthetic defect strain H1246 of the TAG of yeast, express, confirm that this gene coded protein has the synthesis capability of TAG really;

3, miDGAT2the acquisition of cDNA full length sequence and DNA full length sequence is to utilize this gene to realize the extensive synthetic condition of having created of TAG by genetic manipulation.

Brief description of the drawings

Accompanying drawing 1 is pMD19T carrier collection of illustrative plates.

Accompanying drawing 2 is pYES2 carrier collection of illustrative plates.

Accompanying drawing 3 is to incise edge green alga miDGAT2gene structure display.In figure, grey lines is nontranscribed domain, and black line is intron, and black box is exon.

Accompanying drawing 4 is TLC collection of illustrative plates of yeast grease.From left side swimming lane to right side swimming lane be followed successively by wild-type yeast scy62, defect strain H1246, carry pYES2 defect strain, turn miDGAT2defect strain and TAG standard substance.

Accompanying drawing 5 is BODIPY dyeing pictures of yeast cell.Be followed successively by from left to right wild-type yeast scy62, defect strain H1246, carry the defect strain of pYES2 and turn miDGAT2defect strain.

Embodiment

Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.

Technological line of the present invention is:

1) be that 25 DEG C, intensity of illumination are 115 μ mol photons m in temperature ^-2s ^-1condition under, in BG-11 substratum, cultivate and incise edge green alga.Collect frustule, and extract genomic dna and RNA;

2) certainly incise edge green alga and transcribe screening in group sequencing data and obtain incising the cDNA full length sequence of edge green alga Diacrylglycerol acyl transferase (MiDGAT2) gene, and with the cDNA that incises edge green alga RNA reverse transcription be template pair miDGAT2cDNA full length sequence verify;

3) basis miDGAT2the cDNA primers of total length, utilization is incised edge green alga DNA and is carried out PCR as template, obtains miDGAT2dNA full length sequence;

4) basis miDGAT2cDNA full length sequence design primer, utilize PCR to build pMD19T/MiDGAT2 plasmid;

5) to pYES2 carrier and pMD19T/MiDGAT2 plasmid carry out double digestion ( hind

/ ecor ), reclaim object fragment, then connect and obtain recombinant vectors pY-MiDAGT2 with T4 ligase enzyme;

6) by electroporation apparatus electric shocking method transformed yeast defect strain H1246 for recombinant vectors pY-MiDAGT2, synthetic medium (SC-U substratum) the screening transformant of application uridylic defect, screening obtains transgenic yeast Y-MiDGAT2;

7) by transgenosis, turn empty carrier and not genetically modified yeast H1246 and wild-type yeast scy62 and be inoculated in SC substratum, after 72h, collect yeast, lyophilize;

8) utilize thin-layer chromatography (TLC) to detect the total fat composition of yeast, observe transgenic yeast Y-MiDGAT2 and whether contain triacylglycerol.Also utilize oil body specific fluorescence dyestuff BODIPY to carry out cell dyeing to transgenosis, defective type and wild-type yeast simultaneously, confirm that whether transgenic yeast Y-MiDGAT2 has rebuild oil body, further confirms miDGAT2whether proteins encoded has the complex functionality of TAG.

embodiment 1

1, experiment material

1) incise edge green alga ( myrmecia incisareisigl H4301) purchased from Prague, CZE Charles university's algae culture center (CAUP).Be that 25 DEG C, intensity of illumination are 115 μ mol photons m in temperature ^-2s ^-1, light/secretly than cultivating under the condition for 12h/12h, substratum is BG-11, purchased from Hu Yu bio tech ltd, Shanghai.

2) pMD19T carrier (Fig. 1 is shown in by carrier collection of illustrative plates), pYES2 carrier (Fig. 2 is shown in by carrier collection of illustrative plates) are purchased from Invitrogen company.Yeast defect strain H1246 and wild-type scy62 are purchased from the Dr. Stymne of agricultural science and technology university of Sweden laboratory.Yeast, at SC substratum, 30 DEG C, is cultivated with 200 rpm speed oscillations.SC substratum is purchased from Mei Lian bio tech ltd, Shanghai.Bacillus coli DH 5 alpha competent cell is purchased from Shanghai Sheng Gong Biological Co., Ltd..Viable yeast uses oil body specific fluorescence dyestuff BODIPY purchased from GENMED SCIENTIFICS INC. U.S.A.TAG standard substance are purchased from Nu-Chek company of Britain.

2, experimental technique

1) get fresh the incising edge chlorella cell and be placed in the mortar of precooling of 100 mg, add liquid nitrogen fully to grind.

2) CTAB method is extracted genomic dna and TRIzol method extracted total RNA, and-20 DEG C save backup.

3) periodical " Shanghai Ocean University's journal ", in September, 2012, the 21st the 5th phase of volume, the paper of publishing " is incised edge green alga and is transcribed group order-checking and lipid metabolism related genes annotation ", this Authors of Science Articles is in order in depth to understand the metabolic process of incising edge green alga arachidonic acid and lipid, utilize Roche 454 GS FLX sequenators to transcribe group to this algae and carry out high-throughout tetra-sodium order-checking, obtain high quality and read 382468 of orders (read), account for original 97.14% of the order of reading, read the long 322bp of order for average every, total size reaches 123Mb, obtain 22714 contigs through the splicing of CAP3 software again, article 25621, singleton.These sequences and public database are carried out to homology search, comparison, annotation of gene function and classification, and based on transcribing the gene constructed edge green alga lipid metabolism approach of incising annotating in group.We obtain according to the method screening of the document miDGAT2cDNA full length sequence (SEQ ID NO.3), and according to this miDGAT2the following primer of cDNA full length sequence design:

Upstream primer F(SEQ ID NO.4): CGAGCTTGTTGACAGCCACGGCAG;

Downstream primer R(SEQ ID NO.5): CATCCCCAACCAAGGCAGCTCACGA,

Then carry out pcr amplification taking the cDNA that incises edge green alga RNA reverse transcription as template.PCR response procedures is 94 DEG C of denaturation 3 min, 35 circulations, and each circulation comprises 94 DEG C of sex change 30 s, 68 DEG C of annealing 30 s, 72 DEG C of extension 2 min, and last 72 DEG C are extended 7 min.PCR product glue is connected to pMD19T carrier after reclaiming, and transforms bacillus coli DH 5 alpha competent cell, blue hickie screening, picking positive colony, bacterium colony PCR checking, bacterium liquid is delivered to the order-checking of Shanghai Sheng Gong biotechnology company limited, incises accurately edge green alga to confirm and to obtain miDGAT2cDNA full length sequence.

4) finally obtain accurately according to step 3) miDGAT2cDNA full length sequence (SEQ ID NO.1) design primer, upstream and downstream primer sequence respectively as shown in SEQ ID NO.4 and SEQ ID NO.5, carries out pcr amplification to incise edge green alga DNA as template.Amplification condition is 94 DEG C of denaturation 5 min, 35 circulations, and each circulation comprises 94 DEG C of sex change 30 s, 69 DEG C of annealing 30 s, 72 DEG C of extension 2 min, and last 72 DEG C are extended 10 min.PCR product is connected to pMD19T carrier through glue recovery, TA clone as stated above, serves the order-checking of Hai Sheng work bio-engineering corporation, incises edge green alga to obtain miDGAT2dNA full length sequence.

5) basis miDGAT2cDNA full length sequence (SEQ ID NO.1) design primer:

Upstream primer F(SEQ ID NO.6): aagcttAACATGCTACGCTGGTCGAGGGTCG, wherein lowercase is hind restriction enzyme site, the AAC after restriction enzyme site is yeast consensus sequence;

Downstream primer R(SEQ ID NO.7): gaattcCTACTCGACCATGCGCAGCTCCTGC, wherein lowercase is ecor

restriction enzyme site.

Above-mentioned primer contains hindiII and ecothe restriction enzyme site of RI, utilizes PCR method to build pMD19T/MiDGAT2 plasmid.The Ex that the pcr amplification reaction system of 25 μ L comprises 2.5 μ L taqthe dNTP of damping fluid, 2 μ L, the Mg of 2 μ L ²⁺, the each 1 μ L of cDNA template, primer of 2 μ L, the Ex of 0.25 μ L taqenzyme and 14.5 μ L sterilized waters.Amplification condition is 94 DEG C of denaturation 5 min, 35 circulations, and each circulation comprises 94 DEG C of sex change 30 s, 69 DEG C of annealing 30 s, 72 DEG C of extension 2 min, and last 72 DEG C are extended 10 min.PCR product is connected to pMD19T carrier through glue recovery, TA clone, serves the accuracy of Hai Sheng work bio-engineering corporation order-checking guarantee sequence.

6) extracting pMD19T/MiDGAT2 plasmid from bacillus coli DH 5 alpha, uses restriction enzyme hind

with ecor

carry out double digestion digestion reaction, pYES2 plasmid is also carried out simultaneously hind

/ ecor

double digestion reaction.Reaction system is 10 × H damping fluid of 4 μ L, 0.1% BSA of 4 μ L, and DNA 2 μ g, hind

and ecor

each 1 μ L, adds the L without RNase water to 20 μ.37 DEG C of digestion reaction 4 h.The object fragment after enzyme is cut is reclaimed in rubber tapping, and after enzyme being cut with T4 DNA ligase miDGAT2fragment is connected and obtains recombinant vectors pY-MiDGAT2 with pYES2 fragment.Ligation system is the damping fluid of 2.5 μ L, DNA fragmentation ( miDGAT2) approximately 0.3 pmol, carrier DNA (pYES2 fragment) approximately 0.03 pmol, the T4 DNA ligase of 1 μ L, adds the L without RNase water to 25 μ.16 DEG C of connections are spent the night.After connecting, transform bacillus coli DH 5 alpha competent cell, according to preceding method clone, bacterium colony PCR checking and order-checking.Extracting pY-MiDGAT2 plasmid from bacillus coli DH 5 alpha ,-20 DEG C save backup.

7) yeast competent cell preparation.By yeast-inoculated, in SC substratum, 30 DEG C of recovery overnight incubation, then press 1:100 amplification culture, be cultured to cell density be about 1 × 10 with 200 rpm speed oscillations ⁸cells/mL(approximately 4 ~ 5 h).Cooled on ice 15 min stop growing cell, under 4 DEG C of conditions, collect yeast cell, precooling sterilized water washed cell 2 times, centrifugal collection under similarity condition with centrifugal 5 min of 5 000 rpm rotating speeds.1 M sorbyl alcohol washed cell of 20 mL precoolings 1 time, is then dissolved in 1 M sorbyl alcohol of 0.5 mL precooling, adjusts the concentration of cell 1 × 10 ¹⁰cells/mL.Preserve cell on ice, be convenient to electric shock and use.

8) utilize electroporation apparatus (Bio-Rad) electric shock, by the carrier pY-MiDGAT2 transformed yeast H1246 competent cell of restructuring.Be taken at the DNA(pY-MiDGAT2 to be transformed of precooling on ice) approximately 5 ~ 10 μ L(5 ~ 200 ng) mix with competent cell, and with precooling on ice together with the electric shock cup of 0.2 cm, then the electric shock cup of DNA-cell mixture being transferred to precooling mixes gently, after ice bath 5 min, select procedure Sc2 shocks by electricity once, remove electric shock cup, add at once 1 M sorbyl alcohol of 1 mL precooling, transfer to gently in new YPD substratum, 30 DEG C of slight vibration 5 h, bacterium liquid is coated on the uridylic defect synthetic medium (SC-U) that contains 1 M sorbyl alcohol, be inverted to leave standstill for 30 DEG C and cultivate 48 ~ 72 h, picking colony is cultivated in liquid SC-U substratum.After bacterium colony PCR checking, with the SC-U substratum preservation bacterial classification containing 2% glucose or 2% raffinose.In addition, by above-mentioned same method, empty carrier pYES2 electricity is forwarded on H1246.

9) the bacterium liquid of preservation is seeded in SC substratum, cultivates 72 h with 200 rpm speed oscillations at 30 DEG C, collect yeast, freeze-drying.

10) total fat of yeast after extraction freeze-drying.Extracting method: accurately weigh 50 mg yeast powders and be placed in test tube, add 1 mL chloroform: methyl alcohol (1:2), then add 200-300 μ L granulated glass sphere, and vortex shakes 15 min, and whether microscopy observation of cell wall is completely broken.After centrifugal 15 min of 4000 rpm, supernatant liquor sucking-off, to new test tube, is added to 400 μ L 50 mM citric acids and 600 μ L chloroforms, after fully mixing, centrifugal 15 min of 4000 rpm, carefully draw lower floor's solution, put into esterification bottle nitrogen and dry up.

11) triacylglycerol of thin-layer chromatography (TLC) checking transgenic yeast.Developping agent used is hexane: ether: Glacial acetic acid (80/20/1, v/v/v).Developer: 10%(w/v) CuSO ₄5H ₂o is added to 8%(v/v) phosphoric acid solution.In the total fat of yeast extracting, add 20 μ L chloroforms, upper to silica gel 60 F254 plates (Merck) with kapillary point sample, plate is put into chromatography cylinder and launch, take out, spray developer, 140 DEG C are cured 10 min.

12) by oil body specific fluorescence dyestuff BODIPY dyeing for viable yeast, observe with laser confocal microscope (Leica), take pictures.

3, experimental result

1) transcribe from incising edge green alga the sequential analysis that screens and pass through pcr amplification product group sequencing data, obtain accurately miDGAT2cDNA full length sequence (SEQ ID NO.1); Its 5 '-non-transcribed head of district 44 bp, 3 '-non-transcribed head of district, 873 bp, open long 1056 bp of frame frame, and 45-47bp is initiator codon, and 1098-1100bp is terminator codon.Utilization is incised edge green alga genomic dna and is carried out pcr amplification reaction for template, and product obtains after sequential analysis miDGAT2dNA full length sequence (SEQ ID NO.2); Its overall length 4251 bp, there are 6 introns, their length is respectively 213 bp(236-448bp), 763 bp(524-1286bp), 296 bp(1372-1667bp), 392 bp(1877-2268bp), 381 bp(2485-2865bp) and 233 bp(3091-3323bp), the encoding sequence of this gene is divided into 7 sections of (see figure 3)s; 45-47bp is initiator codon, and 3376-3378bp is terminator codon.

2) transgenic yeast Y-MiDGAT2 is after semi-lactosi inducing culture, and its fatty TLC detected result shows, miDGAT2expression product can make again to synthesize TAG(in the synthetic defect strain yeast H1246 of TAG and see Fig. 4).

3) utilize oil body specific fluorescence dyestuff BODIPY to carry out cell dyeing to yeast, compare with the synthetic defect strain yeast H1246 of TAG, find that transgenic yeast Y-MiDGAT2 has rebuild oil body (see figure 5), thereby proved miDGAT2proteins encoded has the complex functionality of TAG.

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, do not departing under the prerequisite of the inventive method; can also make some improvement and supplement, these improvement and the supplementary protection scope of the present invention that also should be considered as.

SEQUENCE LISTING

<110> Shanghai Ocean University

DNA sequence dna and application thereof that <120> coding is incised edge green alga Diacrylglycerol acyl transferase

<130> /

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 1973

<212> DNA

<213> incises edge green alga (Myrmecia incisa Reisigl H4301)

<400> 1

cgagcttgtt gacagccacg gcaggtgtct tgccactcag gggtatgcta cgctggtcga 60

gggtcgagga tctggccttc aggctccggc ggacatctcc agcgatggac ccgcgcacgg 120

cccaaaagct agcggccctt ttctacgtgg tgtcgttctc gagcgggctt tggtgctggg 180

ttctgacggc gtacttgcta tacagaggcc catatacagc gatcccgacg cttatatatg 240

tgatctacat atggttcgga ccaggcgcgc gtgcatccgg tgaaggcagc tggcctacac 300

cgttcaaaag gcttacagtc tggcgcactt tcgcagagta cttccccgcc actctcgtca 360

agacctgcga gctggaccca gacaagagct acctgttcgg cttccaccca catggcatcc 420

tgagcgtcag cgcctgggtg ggcttcgtca ccgaggccac cggcttcagc aagcagttcc 480

cggggctcac cctgcacggc atgacgctca agcccaactt caagacgccg ctgctgcgag 540

agtggctcct cctgcacggc atgtgcgact gcgaccgcaa gacctgcgtg cgcatgctgt 600

ctaggtcggg cagcgcgatc ctgctggcca ttggcggcgc ggtggagagc ctgcacagcg 660

cccccgggac ctttgacctg gtgctgacgc ggcgcaaggg ctttgtgcgc gtggccttgg 720

aatcaggcgc cagcctggtg cccgtcatcg cgttcggcga agtggacctg ttctacacgt 780

gcaagccgcc gcccgcctcc cggatagcca ggttccagag gtggatcgag aaaacctggg 840

gcgtcacttt ccctctcgcg cacggggacg gcatcatcac ccccgggacc ggcttccttc 900

cccggcggca gccgctgcac atcgtggtcg gcagccccat cgacctgccc aagtatcccg 960

gggatttgca cagcggggag gggcagaagc tgacagacga gttccatggc aagtatgtgg 1020

ccgcgctgca ggcgctgtgg gacaggtaca aggatgacta tgcgccgacg cggaagcagg 1080

agctgcgcat ggtcgagtag ggtcccaagc gtgccggcgt tagggttgtg ttgttggggt 1140

cgaaccccag tttgtaaagg ccatttgtgg gccaccagtt gcgcccgctg gcgaacactt 1200

cacgcctggg tgtgtggtgc acctgactct gctggtattc atcaggtgcc agctggttgt 1260

gtgatggcat ggggtgttgt ttatgcaaag caaagtggtg ctcgtgggca ggttgagcac 1320

gacacagagg gtgaacagtg cgtcctagtc ctgtgtgaat tgggcttgca cttgaggcaa 1380

agctggaagg gacaagatct tgggccatac tggctttaca gcactcgagt ggcaaggcag 1440

tattgctgca aaaccttccc aggcgggacg cgccggtcag ggggttgtga gacaatgctc 1500

tttttggacc gcactctggg cctttgtttg ggttgctgct agggtatttg tatcttgatg 1560

gtttgcttga agtgggggcc gctgcgtcta gccccaggac cggagtagag tactttggtg 1620

tgtcggctgc taatggggcc ttgggaccta ggctagtgcg gtgcttcatg tacatgttgt 1680

gatgtgttgt cagcagtgag ttttggcgtc tacctgaaca acaggtaggc aggtgcaaag 1740

tgtaggtact gagactgcag ggtacttttg agtcaggccg tgatcgcagc actgccgcag 1800

cagcagcatg tagtcaggcc gtaatgcagc aaacatgatt tgtgccaacg cgcttcatca 1860

cggtatgctc gtcgatatat catgtaccca caggccaggc ggggctttgc agtaaacgtc 1920

gagttgagca ggtggctggt ggcacgagtc gtgagctgcc ttggttgggg atg 1973

<210> 2

<211> 4251

<212> DNA

<213> incises edge green alga (Myrmecia incisa Reisigl H4301)

<400> 2

cgagcttgtt gacagccacg gcaggtgtct tgccactcag gggtatgcta cgctggtcga 60

gggtcgagga tctggccttc aggctccggc ggacatctcc agcgatggac ccgcgcacgg 120

cccaaaagct agcggccctt ttctacgtgg tgtcgttctc gagcgggctt tggtgctggg 180

ttctgacggc gtacttgcta tacagaggcc catatacagc gatcccgacg cttatgtagg 240

ttctatggca tggccgtcca ctgcctgcag tccggcagat tccgacttag tccatacact 300

gttcagctgt tcaagaaggg tttgaccttg aaccccgttt ggcagcaata gatggtcggg 360

tttctggata acctcttctg cctcactcgc tgcacgctga cacttgctgc tctcttgctg 420

cgttatacac agcactcttt gtttgcagat atgtgatcta catatggttc ggaccaggcg 480

cgcgtgcatc cggtgaaggc agctggccta caccgttcaa aaggtaactt tgccatcgtg 540

aacatagcag gggtggggtg ctgaaggggc ttgacaatct cgttgagatc ctctgctttc 600

gtggatgtca gcacaagcca cagatttgtt tgaaccgggc gtgcgccttg agtcagtggc 660

aggatggatg atagatgctg aatactcagc gtgaggtggc accctggcaa cctggcaacc 720

ttgcacgcct tatatcccac atagaggcct gcaagtagtg cacttgcagc gtgagtgccc 780

tgagctggtg tatgccagca catgccagca tgccaagtga aagcctgtgg catagcacct 840

ctgacaaaca ccaagctacc acctcctagc aacgcggagc atcgtacttc tgtagctagt 900

agcagtacct tgcaagttct ctccatggcc agcttgacaa tgtcacttgg accacaccca 960

gtaacacctc acagggctag catgccggta gccccagctt tattactcta cacgttcagc 1020

gggcaacctg atgtgagcat gggcggcaga ccgcacgctt agtctagcca ctcagcccgc 1080

aagcgaagcc gcagccttcc aaatggagcg gggctgcaga taaagtcgct ctgttccgca 1140

aagctctatc tcatacttgg aaactgctgt tgctgagctg taacgttggt tacgtatggc 1200

aaatcgtgca gctgcgtgca tgcctgggag cacaactgct ggtttgtggc tggtctgtgg 1260

tgtgctgaag ggcttgctgc ctgcaggctt acagtctggc gcactttcgc agagtacttc 1320

cccgccactc tcgtcaagac ctgcgagctg gacccagaca agagctacct ggtgtgtgcc 1380

ctcccctgtg ctgacaagcg gtgttagacg agagtaacat acaggcagat tgcagccgtt 1440

taccgcatac ctatagacta ccgtgaatgc tagactcttg catgcccttc gacatcgtgc 1500

gcatatgagc atgggctcca gaacttgggc tgtggtactt tggtatggcc taccgccgca 1560

ggggcgttgg tccagacata tggtcaaggt gcatgtcatg catgtgaagc aacctggcac 1620

ctgcaggctg gctacatgca cgctgatcat cgtatgctgc cttgcagttc ggcttccacc 1680

cacatggcat cctgagcgtc agcgcctggg tgggcttcgt caccgaggcc accggcttca 1740

gcaagcagtt cccggggctc accctgcacg gcatgacgct caagcccaac ttcaagacgc 1800

cgctgctgcg agagtggctc ctcctgcacg gcatgtgcga ctgcgaccgc aagacctgcg 1860

tgcgcatgct gtctaggtga gggctacacc gtgcacactg atgccctacc gcaagcctcc 1920

aacactagca cagcccggct tggccagcct tgcctcccga tgccatgagg ggctagctat 1980

tccgcacgaa ctacagcatt gctcgagtct gacggtgcct gctgggcgtg atgtcatcat 2040

acattgcatc tttgagtttg ctgtaggatg catgtttcat cgggcaggta atacatccca 2100

gctgtgcctc aacgcagcag cacagaatag ggcacggagc accacacata ccgttacccc 2160

cgcgctgtgc tgtgctgcgc tgcgcaggtc aggcggcgca accctgctcg gtgccattga 2220

gagtgggaag cagtgcagct gttgaccatg ctgtgctgcg ctgcgcaggt cgggcagcgc 2280

gatcctgctg gccattggcg gcgcggtgga gagcctgcac agcgcccccg ggacctttga 2340

cctggtgctg acgcggcgca agggctttgt gcgcgtggcc ttggaatcag gcgccagcct 2400

ggtgcccgtc atcgcgttcg gcgaagtgga cctgttctac acgtgcaagc cgccgcccgc 2460

ctcccggata gccaggttcc agaggtgagg cattggataa gccatgttgg ggttgttgat 2520

cagcctgtct acatagtgtt aggtttgaca aggaggcagc agagggatgg catgcgtcat 2580

gaagccgggc tagtaatgac tacgctgagg tttggaaggt gcatggcgcg cttctttcgc 2640

accttggcat gagccatgct gccggttgtt agtcatgtgt gccgcataca tgctgcttgc 2700

tgctggcagg tgtgttgcag tccgccagat cactgctggg tctccactcg aggcttaagc 2760

gcgaactcac ttgatgcggc atttgcagca gttgctggta tgggcagggt gggaaatccc 2820

caccgtattg tcatgcatgc ccaggaccgg tttcatttgc cgcaggtgga tcgagaaaac 2880

ctggggcgtc actttccctc tcgcgcacgg ggacggcatc atcacccccg ggaccggctt 2940

ccttccccgg cggcagccgc tgcacatcgt ggtcggcagc cccatcgacc tgcccaagta 3000

tcccggggat ttgcacagcg gggaggggca gaagctgaca gacgagttcc atggcaagta 3060

tgtggccgcg ctgcaggcgc tgtgggacag gtgagcttga tgctagctgg acgccacaag 3120

caagcgtcgt cacatgctat tgcatgtgtg tccatgccac agggtgaggt gggtgcctgc 3180

tagctgagcg cctatgatgc tgcccttgat ggtgctgctg tgacagacca gtatggctag 3240

acagtgcgag atgtgtcatg gttacagcat cttcagagct caacagctga accttgcaag 3300

tgaccgttgc acgatgtggg caggtacaag gatgactatg cgccgacgcg gaagcaggag 3360

ctgcgcatgg tcgagtaggg tcccaagcgt gccggcgtta gggttgtgtt gttggggtcg 3420

aaccccagtt tgtaaaggcc atttgtgggc caccagttgc gcccgctggc gaacacttca 3480

cgcctgggtg tgtggtgcac ctgactctgc tggtattcat caggtgccag ctggttgtgt 3540

gatggcatgg ggtgttgttt atgcaaagca aagtggtgct cgtgggcagg ttgagcacga 3600

cacagagggt gaacagtgcg tcctagtcct gtgtgaattg ggcttgcact tgaggcaaag 3660

ctggaaggga caagatcttg ggccatactg gctttacagc actcgagtgg caaggcagta 3720

ttgctgcaaa accttcccag gcgggacgcg ccggtcaggg ggttgtgaga caatgctctt 3780

tttggaccgc actctgggcc tttgtttggg ttgctgctag ggtatttgta tcttgatggt 3840

ttgcttgaag tgggggccgc tgcgtctagc cccaggaccg gagtagagta ctttggtgtg 3900

tcggctgcta atggggcctt gggacctagg ctagtgcggt gcttcatgta catgttgtga 3960

tgtgttgtca gcagtgagtt ttggcgtcta cctgaacaac aggtaggcag gtgcaaagtg 4020

taggtactga gactgcaggg tacttttgag tcaggccgtg atcgcagcac tgccgcagca 4080

gcagcatgta gtcaggccgt aatgcagcaa acatgatttg tgccaacgcg cttcatcacg 4140

gtatgctcgt cgatatatca tgtacccaca ggccaggcgg ggctttgcag taaacgtcga 4200

gttgagcagg tggctggtgg cacgagtcgt gagctgcctt ggttggggat g 4251

<210> 3

<211> 1997

<212> DNA

<213> incises edge green alga (Myrmecia incisa Reisigl H4301)

<400> 3

tttttttgga gttttagctc attacatccc caaccaaggc agctcacgac tcgtgccacc 60

agccacctgc tcaactcgac gtttactgca aagccccgcc tggcctgtgg gtacatgata 120

tatcgacgag cataccgtga tgaagcgcgt tggcacaaat catgtttgct gcattacggc 180

ctgactacat gctgctgctg cggcagtgct gcgatcacgg cctgactcaa aagtaccctg 240

cagtctcagt acctacactt tgcacctgcc tacctgttgt tcaggtagac gccaaaactc 300

actgctgaca acacatcaca acatgtacat gaagcaccgc actagcctag gtcccaaggc 360

cccattagca gccgacacac caaagtactc tactccggtc ctggggctag acgcagcggc 420

ccccacttca agcaaaccat caagatacaa ataccctagc agcaacccaa acaaaggccc 480

agagtgcggt ccaaaaagag cattgtctca caaccccctg accggcgcgt cccgcctggg 540

aaggttttgc agcaatactg ccttgccact cgagtgctgt aaagccagta tggcccaaga 600

tcttgtccct tccagctttg cctcaagtgc aagcccaatt cacacaggac taggacgcac 660

tgttcaccct ctgtgtcgtg ctcaacctgc ccacgagcac cactttgctt tgcataaaca 720

acaccccatg ccatcacaca accagctggc acctgatgaa taccagcaga gtcaggtgca 780

ccacacaccc aggcgtgaag tgttcgccag cgggcgcaac tggtggccca caaatggcct 840

ttacaaactg gggttcgacc ccaacaacac aaccctaacg ccggcacgct tgggacccta 900

ctcgaccatg cgcagctcct gcttccgcgt cggcgcatag tcatccttgt acctgtccca 960

cagcgcctgc agcgcggcca catacttgcc atggaactcg tctgtcagct tctgcccctc 1020

cccgctgtgc aaatccccgg gatacttggg caggtcgatg gggctgccga ccacgatgtg 1080

cagcggctgc cgccggggaa ggaagccggt cccgggggtg atgatgccgt ccccgtgcgc 1140

gagagggaaa gtgacgcccc aggttttctc gatccacctc tggaacctgg ctatccggga 1200

ggcgggcggc ggcttgcacg tgtagaacag gtccacttcg ccgaacgcga tgacgggcac 1260

caggctggcg cctgattcca aggccacgcg cacaaagccc ttgcgccgcg tcagcaccag 1320

gtcaaaggtc ccgggggcgc tgtgcaggct ctccaccgcg ccgccaatgg ccagcaggat 1380

cgcgctgccc gacctagaca gcatgcgcac gcaggtcttg cggtcgcagt cgcacatgcc 1440

gtgcaggagg agccactctc gcagcagcgg cgtcttgaag ttgggcttga gcgtcatgcc 1500

gtgcagggtg agccccggga actgcttgct gaagccggtg gcctcggtga cgaagcccac 1560

ccaggcgctg acgctcagga tgccatgtgg gtggaagccg aacaggtagc tcttgtctgg 1620

gtccagctcg caggtcttga cgagagtggc ggggaagtac tctgcgaaag tgcgccagac 1680

tgtaagcctt ttgaacggtg taggccagct gccttcaccg gatgcacgcg cgcctggtcc 1740

gaaccatatg tagatcacat atataagcgt cgggatcgct gtatatgggc ctctgtatag 1800

caagtacgcc gtcagaaccc agcaccaaag cccgctcgag aacgacacca cgtagaaaag 1860

ggccgctagc ttttgggccg tgcgcgggtc catcgctgga gatgtccgcc ggagcctgaa 1920

ggccagatcc tcgaccctcg accagcgtag catacccctg agtggcaaga cacctgccgt 1980

ggctgtcaac aagctcg 1997

<210> 4

<211> 24

<212> DNA

<213> artificial sequence

<400> 4

cgagcttgtt gacagccacg gcag 24

<210> 5

<211> 25

<212> DNA

<213> artificial sequence

<400> 5

catccccaac caaggcagct cacga 25

<210> 6

<211> 31

<212> DNA

<213> artificial sequence

<400> 6

aagcttaaca tgctacgctg gtcgagggtc g 31

<210> 7

<211> 31

<212> DNA

<213> artificial sequence

<400> 7

gaattcctac tcgaccatgc gcagctcctg c 31

Claims (5)

1. a DNA sequence dna for separation, is characterized in that, described DNA sequence dna is:

A) nucleotide sequence described in SEQ ID NO.1 or SEQ ID NO.2; Or

The nucleotide sequence of the nucleotide sequence complementation b) and a).

2. the purposes of DNA sequence dna claimed in claim 1 in coding Diacrylglycerol acyl transferase or production triacylglycerol.

3. a recombinant expression vector, is characterized in that, described carrier is by nucleotide sequence claimed in claim 1 and plasmid or the constructed recombinant expression vector of virus.

4. recombinant expression vector according to claim 3, is characterized in that, described plasmid is pYES2 plasmid.

5. the purposes of the recombinant expression vector described in claim 3 or 4 in coding Diacrylglycerol acyl transferase or production triacylglycerol.

Images