CN102628083B - Method for detecting insertion flanking sequence and copying quantity of Tgf2 transposon in goldfish genome - Google Patents
Method for detecting insertion flanking sequence and copying quantity of Tgf2 transposon in goldfish genome Download PDFInfo
- Publication number
- CN102628083B CN102628083B CN 201210105195 CN201210105195A CN102628083B CN 102628083 B CN102628083 B CN 102628083B CN 201210105195 CN201210105195 CN 201210105195 CN 201210105195 A CN201210105195 A CN 201210105195A CN 102628083 B CN102628083 B CN 102628083B
- Authority
- CN
- China
- Prior art keywords
- tgf2
- transposon
- sequence
- seq
- genome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for detecting the insertion flanking sequence and copying quantity of a Tgf2 transposon in a goldfish genome. The method comprises the following steps of: extracting the DNA (Deoxyribose Nucleic Acid) of a goldfish genome with a Tgf2 transposon; performing restrictive incision enzyme digestion on the DNA of the genome; connecting an enzyme-digested DNA fragment with a splinkerette joint; and performing primary PCR (Polymerase Chain Reaction) and secondary PCR respectively to amplify flanking sequences of transposon insertion loci 5' and 3' respectively; and performing cloning and sequence measurement on a product of the secondary PCR to detect the flanking sequence of the transposon in a fish genome and presume an inserted copying quantity. The method has the advantages of easiness, convenience, high efficiency and low cost, and a rapid and accurate method can be provided for the detection of the copying quantities and flanking sequences of other fish genome insertion mutation and transgenic descendants mediated by the Tgf2 transposon.
Description
Technical field
The present invention relates to the fish gene engineering field, specifically, that a kind of Tgf2 of detection transposon inserts the method for flanking sequence and copy number at the goldfish genome, and the application in goldfish Tgf2 transposon insertion site detects, be applicable to carry out fast and accurately in goldfish and the transposon-mediated transgenosis of cultured fishes Tgf2 or in inserting mutagenic progeny the evaluation that genome inserts copy number and flanking sequence.
Background technology
DNA transposon (transposon) is that a class can change the Mobile Genetic Elements of on position in host genome, and the process of its change on position is called swivel base (transposition).The genome that a lot of different transposons (as the P factor and Mos1) mediate inserts the instrument that mutagenesis has been used as extensive genetic screening, not only in unicellular organism such as bacterium and yeast, and all being proved to be successful in multicellular organism comprises the research of worm, fruit bat and Arabidopis thaliana, they are for finding and these biological proterties master control genes of decoding have been made huge contribution.In recent years, we found in some goldfish strains one new, have a natural transposition activity hAT family transposon, have the vertebrates transposon of natural transposition activity for the second case of in recent years finding, according to the naming standard of international transposon, naming this transposon is the Tgf2 transposon.The Tgf2 transposon derives from cyprinid fish, and its transgenosis integration rate in the Cyprinidae cultured fishes is about 50%, is 10 times of 1st generation linearization plasmid injecting method.Insert TTAA with insect piggyBac transposon tendency and compare with the Tc1/mariner transposon preference AT of family site, Cyprinidae Tgf2 transposon is radom insertion, and this inserts mutagenesis research and established basic substance for opening up the full genome of Cyprinidae cultured fishes.
At present, carry out transposon and generally adopt inverse PCR (inverse PCR) method at biological genome insertion copy number and flanking sequence.Inverse PCR is first used digestion with restriction enzyme sample gene group DNA before amplification, connect into a ring-shaped DNA molecule with DNA ligase again, then pass through upstream fragment and the downstream fragment of inverse PCR amplimer, and check order, thereby flanking sequence and the copy number of copy number are inserted in acquisition.There are some shortcoming and defect in the inverse PCR method, for example, 1, the impact that process is subject to a lot of uncertain factors is cut, certainly connected to enzyme, need to be from many enzymes the selectional restriction enzyme, must select in other words a kind of suitable enzyme to carry out enzyme and cut the DNA fragmentation that just can obtain fair-sized, this selection can not be cut off target DNA at non-restriction enzyme site; 2, for improving the efficient of moleculartie, in ligation, the concentration of genomic dna is low, because the DNA of high density may improve non-homogeneous connection level, thereby produces non-specific amplification; 3, the double chain DNA molecule of Cheng Huan is easy to form superhelix and is unfavorable for the PCR reaction, and it is only to amplify shorter DNA fragmentation; 4, there is multiple copied in the fish transposon insertion site, and the inverse PCR primer may be hybridized with a plurality of gene orders, the evaluation of severe jamming transposon insertion site flanking sequence.
Chinese patent literature CN101962659A discloses a kind of fish gene transfer vector based on the Tgf2 transposon and preparation method thereof, formed by transgenosis donor plasmid and helper plasmid, the transgenosis donor plasmid is by the fish promoter sequence, as zebra fish Krt8 promotor, goal gene and goldfish Tgf2 transposon left and right arms sequence construct, helper plasmid is built by zebra fish β-actin promotor and goldfish Tgf2 transposase encoding gene, provides novel method for carrying out fish transgenosis research.Chinese patent literature CN101962660A discloses a kind of based on the fish transgenosis method of Tgf2 transposon and the preparation method of carrier and carrier thereof, by injection transgenosis donor plasmid, and be aided with two kinds of carriers based on Tgf2 transposase mRNA, jointly be injected into fish 1-2 phase cell stage zygote, can realize high-efficient transgenic, compare with conventional fish transgenosis technology, have advantages of that integration efficiency is high, loading capacity is large, general, safety and efficiently.But yet there are no report about a kind of Tgf2 of detection transposon in the method that the goldfish genome inserts flanking sequence and copy number.
Summary of the invention
The objective of the invention is for deficiency of the prior art, provide a kind of Tgf2 of detection transposon to insert the method for flanking sequence and copy number at the goldfish genome.
For achieving the above object, the technical scheme that the present invention takes is: a kind of Tgf2 of detection transposon inserts the method for flanking sequence and copy number at the goldfish genome, described method comprises the following steps: (1) is passed through the goldfish extracting genome DNA with the Tgf2 transposon; (2) again complete genome DNA is carried out digestion with restriction enzyme; (3) DNA fragmentation that cuts of enzyme is connected with the splinkerette joint; (4) next carry out respectively first round PCR and second and take turns PCR increase respectively transposon insertion site 5' and 3' flanking sequence, taking turns the PCR product to second clones and sequencing, thereby detect the Tgf2 transposon at fish gene group flanking sequence, and infer the copy number that inserts, described detected Tgf2 transposon is the copy number of insertion at fish gene group flanking sequence number.
Goldfish genomic dna in described step (1) comprises genome itself with each strain of goldfish of Tgf2 transposon with the Tgf2 transposon insertion site, and other fish that insert the Tgf2 transposon by the swivel base mode.
Restriction enzyme in described step (2) is Sau3A1, and the DNA fragmentation that enzyme cuts is with " GATC " sticky end.
Splinkerette joint in described step (3) comprises long sequence SEQ ID No:1 and short sequence SEQ ID No:2.
The synthesis step of described splinkerette joint is: the long sequence of splinkerette joint claimed in claim 4 is mixed with short sequence isoconcentration equal-volume, 95 ℃ of insulation 5min, then progressively be down to 4 ℃ with 1 ℃/15s, long sequence and the annealing of short sequence form the splinkerette joint.
Described splinkerette joint one side is with " GATC " sticky end of section sequence, and opposite side forms the mispairing district with the hairpin structure that forms a 7bp due to the pairing of the AT base complementrity in short sequence.
The DNA fragmentation that enzyme cuts in described step (3), connects by the T4 ligase enzyme all with " GATC " sticky end with the splinkerette joint, and the formation enzyme is cut DNA fragmentation two ends with the DNA fragmentation of splinkerette joint.
Carry out the first round PCR of transposon insertion site 5' flanking sequence amplification in described step (4), the primer is Splink1:SEQ ID No:5 and Tgf2-5'GSP3:SEQ ID No:3; To 50 times of first round PCR product dilutions, and carry out second and take turns PCR, primer used is: Splink2:SEQ ID No:6 and Tgf2-5'GSP4:SEQ ID No:4, take turns the PCR product to second and carry out the agarose gel electrophoresis separation, rubber tapping is connected with the T carrier after reclaiming, and is cloned in bacillus coli DH 5 alpha, selects positive colony and carries out the two-way mensuration of sequence, detect the Tgf2 transposon at goldfish genome 5' flanking sequence, and infer and the insertion copy number.
Carry out the first round PCR of transposon insertion site 3' flanking sequence amplification in described step (4), the primer is: Splink1:SEQ ID No:5 and Tgf2-3'GSP1:SEQ ID No:7; To 50 times of first round PCR product dilutions, carry out second and take turns PCR, primer used is: Splink2:SEQ ID No:6 and Tgf2-3'GSP2:SEQ ID No:8, take turns the PCR product to second and carry out the agarose gel electrophoresis separation, rubber tapping is connected with the T carrier after reclaiming, and is cloned in bacillus coli DH 5 alpha, selects positive colony and carries out the two-way mensuration of sequence, detect the Tgf2 transposon at goldfish genome 3' flanking sequence, and infer and the insertion copy number.
The invention has the advantages that:
1, can insert in the offspring at goldfish genome Tgf2 transposon, carry out fast and accurately the evaluation that genome inserts copy number and flanking sequence;
2, the present invention compared with prior art, has easy, efficient and low-cost characteristics, can be to utilize other transposon-mediated fish gene groups insertion mutagenesis of Tgf2 and the copy number of transgenic progeny and the detection of flanking sequence that method fast and accurately is provided.
Description of drawings
Accompanying drawing 1 is that the goldfish genome extracts agarose gel electrophoretogram.
Accompanying drawing 2 is the splinkerette joint collection of illustrative plates with " GATC " sticky end and a 7-bp hairpin structure that synthesize.
Accompanying drawing 5 is that the Tgf2 transposon is in the sequence alignment result of goldfish genome insert district 5' end.
Accompanying drawing 7 is that the Tgf2 transposon is in the sequence alignment result of goldfish genome insert district 3' end.
Accompanying drawing 8 is that the Tgf2 transposon inserts the genomic agarose gel electrophoretogram of goldfish.
Accompanying drawing 9 is that the Tgf2 transposon inserts the genomic sequence alignment result of goldfish.
Accompanying drawing 10 is that the Tgf2 transposon inserts the genomic agarose gel electrophoretogram of goldfish.
Accompanying drawing 11 is that the Tgf2 transposon inserts the genomic sequence alignment result of goldfish.
Embodiment
Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.
The objective of the invention is to set up a kind of Tgf2 of detection transposon and insert the method for flanking sequence and copy number at the goldfish genome, overcome inverse PCR and cut, certainly connect, form superhelix at selection, the enzyme of restriction endonuclease
,The problems such as non-specific amplification, and be difficult to detect fish gene group transposon multiple copied insertion points such as goldfish etc.Therefore the present invention, can avoid joint to the non-specific amplification between joint because the primer of joint is in full accord with the sequence of the chain in middle mispairing district, have simple to operate, detection efficiency is high and have the advantages that to detect the multiple copied insertion point.The present invention is applicable to the transposon-mediated goldfish of Tgf2 or other fish gene groups are inserted mutagenesis and transgenic research analysis.
A kind of Tgf2 transposon that detects of the present invention inserts the method for copy number and flanking sequence at the goldfish genome, comprise the following steps: by to the goldfish extracting genome DNA with the Tgf2 transposon; Again complete genome DNA is carried out digestion with restriction enzyme; The DNA fragmentation that enzyme cuts is connected with the splinkerette joint; Next carry out respectively first round PCR and second and take turns PCR increase respectively transposon insertion site 5' and 3' flanking sequence, taking turns the PCR product to second clones and sequencing, thereby detect the Tgf2 transposon at fish gene group flanking sequence, and infer the copy number that inserts.
Need to prove, described goldfish genomic dna comprises genome itself with each strain of goldfish of Tgf2 transposon with the Tgf2 transposon insertion site, and other fish that insert the Tgf2 transposon by the swivel base mode.
Described complete genome DNA is carried out the restriction enzyme that enzyme cuts is Sau3A1, and the DNA fragmentation that enzyme cuts is with " GATC " sticky end.
Described splinkerette joint comprises long sequence (5'-CGAAGAGTAACCGTTGCTAGGA GAGACCGTGGCTGAATGA GACTG GTGTCGACACTAGTGG-3') (SEQ ID No:1) and short sequence (5'-GATCCCACTAGTGTCGACACCAGTCTCTAATTTTTTTTT TCAAAAAAA-3') (SEQ ID No:2).The synthesis step of described splinkerette joint is: the long sequence of splinkerette joint claimed in claim 4 is mixed with short sequence isoconcentration equal-volume, 95 ℃ of insulation 5min, then progressively be down to 4 ℃ with 1 ℃/15s, long sequence and the annealing of short sequence form the splinkerette joint.Synthetic splinkerette joint one side is with " GATC " sticky end of section sequence, and opposite side forms the mispairing district with the hairpin structure that forms a 7bp due to the pairing of the AT base complementrity in short sequence.
The DNA fragmentation that described enzyme cuts and splinkerette joint be all with " GATC " sticky end, connects by the T4 ligase enzyme, forms enzyme and cut DNA fragmentation two ends with the DNA fragmentation of splinkerette joint.
the described first round PCR that carries out transposon insertion site 5' flanking sequence amplification, the primer is: Splink1:5'-CGAAGAGTAACCGTTGCTAGGAGAGACC-3'(SEQ ID No:5) and Tgf2-5'GSP3:5'-TAAGTACTTTTTGACTGTAAATAAAATTGTAAGGAGT-3'(SEQ ID No:3), to 50 times of first round PCR product dilutions, and carry out second and take turns PCR, primer used is: Splink2:5'-GTGGCTGAA TGAGACTGGTGTCGAC-3'(SEQ ID No:6) and Tgf2-5'GSP4:5'-AAGTATTGA TTTTTAATTGTACTCAAGTAA AGT-3'(SEQ ID No:4), take turns the PCR product to second and carry out the agarose gel electrophoresis separation, rubber tapping is connected with the T carrier after reclaiming, be cloned in bacillus coli DH 5 alpha, select positive colony and carry out the two-way mensuration of sequence, detect the Tgf2 transposon at goldfish genome 5' flanking sequence, and infer and the insertion copy number.
the described first round PCR that carries out transposon insertion site 3' flanking sequence amplification, the primer is: Splink1:5'-CGAAGAGTAACCGTTGCTAGGAGAGACC-3'(SEQ ID No:5) and Tgf2-3'GSP1:5'-AGACTAATACACCTCTTCCCGCATCG-3'(SEQ ID No:7), to 50 times of first round PCR product dilutions, carry out second and take turns PCR, primer used is: Splink2:5'-GTGGCTGAATGAGACTGGTGTCGAC-3'(SEQ ID No:6) and Tgf2-3'GSP2:5'-GGCTTGACACTAACAATTT TGAGAATC-3'(SEQ ID No:8), take turns the PCR product to second and carry out the agarose gel electrophoresis separation, rubber tapping is connected with the T carrier after reclaiming, be cloned in bacillus coli DH 5 alpha, select positive colony and carry out the two-way mensuration of sequence, detect the Tgf2 transposon at goldfish genome 3' flanking sequence, and infer and the insertion copy number.
Due to the Tgf2 transposon in the both sides of genome insertion point all with the 8-bp duplicate marking, according to the both sides primers with identical 8-bp duplicate marking, carry out pcr amplification, agarose gel electrophoresis separates, rubber tapping is connected with the T carrier after reclaiming, be cloned in bacillus coli DH 5 alpha, select positive colony and carry out the two-way mensuration of sequence, thereby identify the Tgf2 transposon at goldfish genome flanking sequence.
This inverse PCR method by passing through at genome transposon Tgf2 insertion point both sides introducing specificity splinkerette joint, because the sequence of the chain in the primer of joint and middle mispairing district is in full accord, therefore, can avoid joint to the non-specific amplification between joint.Overcome conventional counter PCR and cut, certainly connect, form superhelix at selection, the enzyme of restriction endonuclease
,The problems such as non-specific amplification, and be difficult to detect genome fish transposon multiple copied insertion point etc.Therefore, the present invention have simple to operate, detection efficiency is high and have the feature that detects goldfish Tgf2 transposon multiple copied insertion point.
Owing to there being the insertion of Tgf2 transposon in the goldfish genome, get 95% alcohol preservation or the approximately 100-200mg of goldfish tail fin that lives, shred 55 ℃ of oven dry 5-6min; The STE lysate (pH=8.10) that adds 410 μ L, SDS(10%, the pH=8.14 of 80 μ L) and the Proteinase K (20 μ g/ml) of 10 μ L; Upset shakes up, 56 ℃ of water bath heat preservation 14-15 hour; Add 340 μ L to the saturated nacl aqueous solution mixing of 400 μ L, jog 3min; Add 340 μ L to the chloroform of 400 μ L, shake up; 4 ℃ of centrifugal 20min of 12000rpm move into supernatant liquor in another clean centrifuge tube; Add 450 μ L to the Virahol (20 ℃) of 500 μ L, the centrifugal 20min(4 of 12000rpm ℃); Remove supernatant liquor, stay precipitation, add 75% washing with alcohol of 800 μ L; The centrifugal 5min of 12000rpm is to 15min(4 ℃); To removing ethanol, the oven dry precipitation adds 100 μ L to the distilled water of 200 μ L, then adds the RNase of 2 μ L.Get 1 μ l goldfish genomic dna, the quality of 0.8% detected through gel electrophoresis genomic dna (Fig. 1), all the other are standby in 4 ℃ of Refrigerator stores.
Need to prove, the described fish transgenosis method of inserting with the Tgf2 transposon sees 201010223188.8 1 kinds of Chinese patent application for details based on the fish transgenosis method of Tgf2 transposon and the preparation method of carrier and carrier thereof.
Synthesizing of embodiment 2 Splinkerette joints
Entrust Shanghai to give birth to the synthetic splinkerette joint of work the company required long sequence (SEQ ID No:1) of an oligonucleotide and a short sequence of oligonucleotide (SEQ ID No:2); Respectively the long sequence of oligonucleotide and short sequence are dissolved as 50 μ m/ μ l with aseptic double-distilled water, getting respectively the long sequence of 50 μ l oligonucleotide and short sequence equal-volume mixes, 95 ℃ of insulation 5min, then progressively be down to 4 ℃ with 1 ℃/15s on the PCR instrument, long sequence and short sequence just can form the splinkerette joint ,-20 ℃ of preservations in annealing process.Synthetic splinkerette joint one side is with " GATC " sticky end of restriction enzyme Sau3A1, and opposite side is with being formed the hairpin structure of a 7-bp and formed mispairing district (Fig. 2) by the pairing of the AT base complementrity in short sequence.
The enzyme of embodiment 3 goldfish genomic dnas is cut and is connected the splinkerette joint
Get the goldfish genomic dna that comprises the Tgf2 transposon that extracts in embodiment 1, carry out 37 ℃ of water-bath enzymes with restriction enzyme Sau3A1 and cut 12h, endonuclease reaction carries out in 30 μ l systems, comprise 10 μ l Genomic DNA (2.5 μ g), 3 μ l 10 * Sau3A1 Restriction buffer, 4 μ l Sau3A1 enzyme (10U/ μ l), 0.3 μ l Acetylated BSA (10mg/ml), 12.7 μ l ddH
2O。Enzyme is cut product through 1.2% agarose gel electrophoresis, take TBE as damping fluid, and the effect that the electrophoresis detection enzyme is cut under the voltage of 5V/cm (Fig. 3).Enzyme is cut completely goldfish genome Sau3A1 enzyme cut the DNA product at 65 ℃ of water-bath 20min, to stop the restriction enzyme enzymic activity, save backup in-20 ℃.The Sau3A1 enzyme is cut DNA product 4.5 μ l and splinkerette joint 1 μ l with 4 μ l T4 DNA ligases (Takara company, 5U/ μ l) connect 12 h in 40 μ l reaction systems, 65 ℃ of water-bath 20min afterwards, and cross column purification with a large amount of DNA purification kits (day root).
According to Tgf2 transposon primers Tgf2 5'-GSP3(SEQ ID No:3) and Tgf2 5'-GSP4(SEQ ID No:4), carry out 2 and take turns pcr amplification.First round amplification take embodiment 3 purifying with the genome endonuclease bamhi 5 μ l of splinkerette joint as template, add 5 μ l 10 * LA buffer (Mg2
+Plus), 5 μ l dNTP mixture 2.5mM, 1 μ l splink 1(SEQ ID No:5), 1 μ l Tgf2-5 ' GSP3(SEQ ID No:3) and, 0.5 μ l LA Taq enzyme, 32.5 μ l ddH
2O, cumulative volume 50 μ l.Response procedures is: 94 ℃ of 5min; 94 ℃ of 15s, 65 ℃ of 30s, 72 ℃ of 3min, 28 circulations; 72 ℃ extend 10min.Second takes turns amplification dilutes 50 times as template take first round PCR product, adds 5 μ l 10 * LA buffer (Mg2
+Plus), 5 μ l dNTP mixture 2.5mM, 1 μ l splink 2(SEQ ID No:6), 1 μ l Tgf2-5 ' GSP4(SEQ ID No:4) and, 0.5 μ l LA Taq enzyme, 32.5 μ l ddH
2O, cumulative volume 50 μ l.Response procedures is: 94 ℃ of 5min; 94 ℃ of 15s, 57 ℃ of 30s, 72 ℃ of 3min, 30 circulations; 72 ℃ extend 10min.Second takes turns amplified production through 1.2% sepharose, take TBE as damping fluid, and electrophoresis detection under the voltage of 5V/cm (Fig. 4).After 1.2% sepharose separates, bright band is reclaimed in rubber tapping, to reclaim product is connected to respectively in pMD-19T carrier (TaKaRa), and change bacillus coli DH 5 alpha over to, the picking positive colony, being inoculated into penbritin content is in the liquid LB substratum of 50 μ g/ml, 37 ℃ of shaken overnight are cultivated, get 200 μ l bacterium liquid glycerine and preserve, and be sent to Shanghai living work biotechnology company limited and check order.Carry out sequential analysis with Bioedit software, the Tgf2 transposon detects altogether 6 kinds of Tgf2 transposons at goldfish genome 5' flanking sequence, and infers that the insertion copy number is 6 in the result of goldfish genome insert district 5' end as shown in Figure 5.
According to Tgf2 transposon primers Tgf2 5'-GSP1(SEQ ID No:7) and Tgf2 5'-GSP2(SEQ ID No:8), carry out 2 and take turns pcr amplification.First round amplification take embodiment 3 purifying with the genome endonuclease bamhi 5 μ l of splinkerette joint as template, add 5 μ l 10 * LA buffer (Mg2
+Plus), 5 μ l dNTP mixture 2.5mM, 1 μ l Splink 1(SEQ ID No:5), 1 μ l Tgf2-3 ' GSP1(SEQ ID No:7) and, 0.5 μ l LA Taq enzyme, 32.5 μ l ddH
2O, cumulative volume 50 μ l.Response procedures is: 94 ℃ of 5min; 94 ℃ of 15s, 68 ℃ of 30s, 72 ℃ of 3min, 28 circulations; 72 ℃ extend 10min.Second takes turns amplification dilutes 50 times as template take first round PCR product, adds 5 μ l 10 * LA buffer (Mg2
+Plus), 5 μ l dNTP mixture 2.5mM, 1 μ l Splink 1(SEQ ID No:6), 1 μ l Tgf2-3 ' GSP2(SEQ ID No:8) and, 0.5 μ l LA Taq enzyme, 32.5 μ l ddH
2O, cumulative volume 50 μ l.Response procedures is: 94 ℃ of 5min; 94 ℃ of 15s, 61 ℃ of 30s, 72 ℃ of 3min, 30 circulations; 72 ℃ extend 10min.Second takes turns amplified production through 1.2% sepharose, take TBE as damping fluid, and electrophoresis detection under the voltage of 5V/cm (Fig. 6).After 1.2% sepharose separates, the purpose fragment is reclaimed in rubber tapping, to reclaim product is connected to respectively in pMD-19T carrier (TaKaRa), and change bacillus coli DH 5 alpha over to, the picking positive colony, being inoculated into penbritin content is in the liquid LB substratum of 50 μ g/ml, 37 ℃ of shaken overnight are cultivated, get 200 μ l bacterium liquid glycerine and preserve, and be sent to Shanghai living work biotechnology company limited and check order.Carry out sequential analysis with Bioedit software, the Tgf2 transposon detects altogether 6 kinds of Tgf2 transposons at goldfish genome 5' flanking sequence, and infers that the insertion copy number is 6 in the result of goldfish genome insert district 5' end as shown in Figure 7.
Choose the Tgf2 transposon that all detects in embodiment 4,5 and insert flanking sequence (8 base CTTGTTAC are identical for the Tgf2 end) design primer Tgf2-f1(SEQ ID No:9) and Tgf2-r1(SEQ ID No:10), the goldfish genome that extracts in the embodiment 1 carries out pcr amplification as template.Reaction system is: 1 μ l Genomic DNA, 5 μ l 10 * LA buffer (Mg2
+Plus), 5 μ l dNTP mixture 2.5mM, 1 μ l Tgf2-f1(SEQ ID No:9), 1 μ l Tgf2-r1(SEQ ID No:10) and, 0.5 μ l LA Taq enzyme, 32.5 μ l ddH
2O, cumulative volume 50 μ l.Response procedures is: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 5min, 28 circulations; 72 ℃ extend 10min.Amplified production is through 1.2% sepharose, take TBE as damping fluid, and electrophoresis detection under the voltage of 5V/cm.After 1.2% sepharose separates, 5.1kb and 0.4kb purpose fragment (Fig. 8) are reclaimed in rubber tapping, to reclaim product is connected to respectively in pMD-19T carrier (TaKaRa), and change bacillus coli DH 5 alpha over to, the picking positive colony, being inoculated into penbritin content is in the liquid LB substratum of 50 μ g/ml, 37 ℃ of shaken overnight are cultivated, get 200 μ l bacterium liquid glycerine and preserve, and be sent to Shanghai living work biotechnology company limited and check order.Carry out sequential analysis with Bioedit software, remain with the complete goldfish Tgf2 transposon of 4.7kb in 5.1kb long segment sequence.0.4kb the sequence that stays after short-movie section autonomous shearing that be goldfish Tgf2 transposon, wherein, shear or the wild type gene sequence fully for the Tgf2 transposon sequence-1, sequence-2 not exclusively have more part 8-bp forward repetition " TAC " sequence after shearing for the Tgf2 transposon, and sequence-3 are to have more part Tgf2 transposon (CAGACCTCTG) sequence (Fig. 9) after the Tgf2 transposon is not exclusively sheared.The above results has proved that embodiment 4, the 5 goldfish genome Tgf2 transposons that obtain insert the exactness of flanking sequence.
Choose the Tgf2 transposon that all detects in embodiment 4,5 and insert flanking sequence (8 bases G TTGTGTC are identical for the Tgf2 end) design primer Tgf2-f2(SEQ ID No:11) and Tgf2-r2(SEQ ID No:12), the goldfish genome that extracts in the embodiment 1 carries out pcr amplification as template.Reaction system is: 1 μ l Genomic DNA, 5 μ l 10 * LA buffer (Mg2
+Plus), 5 μ l dNTP mixture 2.5mM, 1 μ l Tgf2-f2(SEQ ID No:11), 1 μ l Tgf2-r2(SEQ ID No:12) and, 0.5 μ l LA Taq enzyme, 32.5 μ l ddH
2O, cumulative volume 50 μ l.Response procedures is: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 5min, 28 circulations; 72 ℃ extend 10min.Amplified production is through 1.2% sepharose, take TBE as damping fluid, and electrophoresis detection under the voltage of 5V/cm (Figure 10).After 1.2% sepharose separates, the purpose fragment is reclaimed in rubber tapping, to reclaim product is connected to respectively in pMD-19T carrier (TaKaRa), and change bacillus coli DH 5 alpha over to, the picking positive colony, being inoculated into penbritin content is in the liquid LB substratum of 50 μ g/ml, 37 ℃ of shaken overnight are cultivated, get 200 μ l bacterium liquid glycerine and preserve, and be sent to Shanghai living work biotechnology company limited and check order.Carry out sequential analysis with Bioedit software, remain with the complete goldfish Tgf2 transposon of 4.7kb in 5.2kb long segment sequence, 0.5kb short-movie section sequence is that goldfish Tgf2 transposon is independently sheared or wild type gene sequence (Figure 11) fully.The above results has proved that further embodiment 4, the 5 goldfish genome Tgf2 transposons that obtain insert the exactness of flanking sequence.
The above is only the preferred embodiment of the present invention; should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the inventive method; can also make some improvement and replenish, these improvement and replenish and also should be considered as protection scope of the present invention.
SEQUENCE LISTING
＜110〉Shanghai Ocean University
＜120〉a kind of Tgf2 transposon that detects inserts the method for flanking sequence and copy number at the goldfish genome
<130> /
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 61
<212> DNA
＜213〉artificial sequence
<400> 1
cgaagagtaa ccgttgctag gagagaccgt ggctgaatga gactggtgtc gacactagtg 60
g 61
<210> 2
<211> 48
<212> DNA
＜213〉artificial sequence
<400> 2
gatcccacta gtgtcgacac cagtctctaa tttttttttt caaaaaaa 48
<210> 3
<211> 37
<212> DNA
＜213〉artificial sequence
<400> 3
taagtacttt ttgactgtaa ataaaattgt aaggagt 37
<210> 4
<211> 33
<212> DNA
＜213〉artificial sequence
<400> 4
aagtattgat ttttaattgt actcaagtaa agt 33
<210> 5
<211> 28
<212> DNA
＜213〉artificial sequence
<400> 5
cgaagagtaa ccgttgctag gagagacc 28
<210> 6
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 6
gtggctgaat gagactggtg tcgac 25
<210> 7
<211> 26
<212> DNA
＜213〉artificial sequence
<400> 7
agactaatac acctcttccc gcatcg 26
<210> 8
<211> 27
<212> DNA
＜213〉artificial sequence
<400> 8
ggcttgacac taacaatttt gagaatc 27
<210> 9
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 9
gtcgttgctc ctccttttat ccttc 25
<210> 10
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 10
ctaagcacgt gcctggatac tatgc 25
<210> 11
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 11
gttggctgga ataaactcgc gtgtg 25
<210> 12
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 12
tgctttgggt gtctcaggtc tggtc 25
Claims (1)
1. one kind is detected the Tgf2 transposon in the method for goldfish genome insertion flanking sequence and copy number, it is characterized in that, described method comprises the following steps: (1) is passed through the goldfish extracting genome DNA with the Tgf2 transposon; (2) again complete genome DNA is carried out digestion with restriction enzyme; (3) DNA fragmentation that cuts of enzyme is connected with the splinkerette joint; (4) next carry out respectively first round PCR and second and take turns PCR increase respectively transposon insertion site 5' and 3' flanking sequence, taking turns the PCR product to second clones and sequencing, thereby detect the Tgf2 transposon at fish gene group flanking sequence, and infer the copy number that inserts, described detected Tgf2 transposon is the copy number of insertion at fish gene group flanking sequence number;
In described step (2), restriction enzyme is Sau3A1, and the DNA fragmentation that enzyme cuts is with " GATC " sticky end;
In described step (3), the splinkerette joint comprises long sequence SEQ ID No:1 and short sequence SEQ ID No:2; The synthesis step of described splinkerette joint is: the long sequence of described splinkerette joint is mixed with short sequence isoconcentration equal-volume, 95 ℃ of insulation 5min, then progressively be down to 4 ℃ with 1 ℃/15s, long sequence and the annealing of short sequence form the splinkerette joint;
Described splinkerette joint one side is with " GATC " sticky end of section sequence, and opposite side forms the mispairing district with the hairpin structure that forms a 7bp due to the pairing of the AT base complementrity in short sequence;
The DNA fragmentation that enzyme cuts in described step (3), connects by the T4 ligase enzyme all with " GATC " sticky end with the splinkerette joint, and the formation enzyme is cut DNA fragmentation two ends with the DNA fragmentation of splinkerette joint;
Carry out the first round PCR of transposon insertion site 5' flanking sequence amplification in described step (4), the primer is Splink1:SEQ ID No:5 and Tgf2-5'GSP3:SEQ ID No:3; To 50 times of first round PCR product dilutions, and carry out second and take turns PCR, primer used is: Splink2:SEQ ID No:6 and Tgf2-5'GSP4:SEQ ID No:4, take turns the PCR product to second and carry out the agarose gel electrophoresis separation, rubber tapping is connected with the T carrier after reclaiming, and is cloned in bacillus coli DH 5 alpha, selects positive colony and carries out the two-way mensuration of sequence, detect the Tgf2 transposon at goldfish genome 5' flanking sequence, and infer and the insertion copy number;
Carry out the first round PCR of transposon insertion site 3' flanking sequence amplification in described step (4), the primer is: Splink1:SEQ ID No:5 and Tgf2-3'GSP1:SEQ ID No:7; To 50 times of first round PCR product dilutions, carry out second and take turns PCR, primer used is: Splink2:SEQ ID No:6 and Tgf2-3'GSP2:SEQ ID No:8, take turns the PCR product to second and carry out the agarose gel electrophoresis separation, rubber tapping is connected with the T carrier after reclaiming, and is cloned in bacillus coli DH 5 alpha, selects positive colony and carries out the two-way mensuration of sequence, detect the Tgf2 transposon at goldfish genome 3' flanking sequence, and infer and the insertion copy number.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210105195 CN102628083B (en) | 2012-04-12 | 2012-04-12 | Method for detecting insertion flanking sequence and copying quantity of Tgf2 transposon in goldfish genome |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210105195 CN102628083B (en) | 2012-04-12 | 2012-04-12 | Method for detecting insertion flanking sequence and copying quantity of Tgf2 transposon in goldfish genome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102628083A CN102628083A (en) | 2012-08-08 |
| CN102628083B true CN102628083B (en) | 2013-11-06 |
Family
ID=46586474
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210105195 Expired - Fee Related CN102628083B (en) | 2012-04-12 | 2012-04-12 | Method for detecting insertion flanking sequence and copying quantity of Tgf2 transposon in goldfish genome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102628083B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816755B (en) * | 2012-09-05 | 2013-12-25 | 苏州大学 | Method for inserting site in clone provirus |
| CN103981204B (en) * | 2014-03-24 | 2016-05-04 | 上海海洋大学 | A kind of expression of activated goldfish Tgf2 transposons restructuring transposase albumen |
| CN108949911B (en) * | 2017-05-25 | 2022-10-14 | 北京大学 | Method for identifying and quantifying low frequency somatic mutations |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140450A (en) * | 2011-01-06 | 2011-08-03 | 河南科技大学 | Method for separating long terminal repeats of retrotransposons |
-
2012
- 2012-04-12 CN CN 201210105195 patent/CN102628083B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140450A (en) * | 2011-01-06 | 2011-08-03 | 河南科技大学 | Method for separating long terminal repeats of retrotransposons |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102628083A (en) | 2012-08-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105646719B (en) | Efficient fixed-point transgenic tool and application thereof | |
| CN105316327B (en) | Wheat TaAGO4a gene C RISPR/Cas9 carrier and its application | |
| US10982200B2 (en) | Enzymes with RuvC domains | |
| US20240117330A1 (en) | Enzymes with ruvc domains | |
| CN105112435B (en) | The building and application of plant polygenes knockout carrier | |
| CN106170549A (en) | For changing the CRISPR cas system of expression and the method for gene outcome | |
| CN105121648A (en) | Engineering of systems, methods and optimized guide compositions for sequence manipulation | |
| CN110331146A (en) | It is a kind of regulation sgRNA transcription promoter, expression vector and its genome editing system and application | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CA3177828A1 (en) | Enzymes with ruvc domains | |
| CN104673824B (en) | A kind of carrier of suitable gene stacking and its application | |
| WO2015144045A1 (en) | Plasmid library comprising two random markers and use thereof in high throughput sequencing | |
| CN102628083B (en) | Method for detecting insertion flanking sequence and copying quantity of Tgf2 transposon in goldfish genome | |
| WO2021178934A1 (en) | Class ii, type v crispr systems | |
| CN113025597A (en) | Improved genome editing system | |
| Le Saux et al. | Chromosome integration of BAC (bacterial artificial chromosome): evidence of multiple rearrangements | |
| CN102010860B (en) | Method for amplifying complete sequence of mitochondrial genome of Macrobrachium nipponense | |
| CN113881678B (en) | C/EBPZ gene promoter and application thereof | |
| CN110592073A (en) | Method for directionally genetically modifying aspergillus oryzae gene based on CRISPR technology | |
| AU2022335499A1 (en) | Enzymes with ruvc domains | |
| CN108531481A (en) | Method and the application of a kind of synthetic gene and its structure tobacco polygenes rite-directed mutagenesis carrier | |
| CN107475257B (en) | Promoter-like gene for efficiently promoting expression of foreign protein and application thereof | |
| González et al. | Optimization of vectors and targeting strategies including GoldenBraid and genome editing tools: GoldenBraid assembly of multiplex CRISPR/Cas12a guide RNAs for gene editing in Nicotiana benthamiana | |
| CN112094933A (en) | Rapid identification diploid gene editing crop T0Method for generating genotype |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20131106 Termination date: 20160412 |