CN102965350B - Cordyceps sinensis stearoyl-CoA desaturase, gene and application of gene - Google Patents

Abstract

The invention relates to stearoyl-CoA desaturase which is from Bailing producing-strain cordyceps sinensis hirsutella sinensis and participates to a metabolic pathway of oleoyl coenzyme A synthesized from stearoyl-CoA, a gene coding the stearoyl-CoA desaturase and application of the gene. The amino acid sequence of the stearoyl-CoA desaturase has the homology more than 90% with a sequence shown in SEQ ID No. 1. According to the stearoyl-CoA desaturase, the gene coding the stearoyl-CoA desaturase and the application of the gene, disclosed by the invention, detailed researches are carried out based on a principle of the metabolic pathway of the oleoyl coenzyme A synthesized from the stearoyl-CoA, a clone DNA (deoxyribonucleic acid) including the nucleotide sequence provided by the invention can be used for being transferred into an engineering bacteria through transduction, transformation and combination transfer methods, high expressivity is applied to a host stearoyl-CoA desaturase by regulating the expression of an oleoyl coenzyme A biosynthesis gene, effective ways are provided for increasing the yield of oleic acid, and the application prospect is important.

Description

A kind of Cordyceps sinensis stearyl-coenzyme A desaturase, gene and application thereof

(1) technical field

The present invention relates to the set out stearyl-coenzyme A desaturase (stearoyl-CoA desaturase) of anabolism oleyl coenzyme A of a kind of participation stearyl-coenzyme A from " hundred makes " production bacterium Cordyceps sinensis China pilose spore, the gene of this enzyme of encoding and application thereof.Oleyl coenzyme A generates oleic acid through hydrolysis again.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma on lepidopteran (Lepidoptera) Hepialidae insect (Hepialus armoricanusOberthur) larva and the complex body (comprising stroma and polypide) on larva corpse.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various feature of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern, worldwide enjoys high praise.The traditional Chinese medical science thinks, Cordyceps sinensis enters lung kidney two warps, can tonifying lung the moon, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough weakness, phthisical cough phlegm blood, spontaneous sweatings etc., are unique a kind of balance simultaneously, the Chinese medicine that regulates negative and positive.Modern pharmacology confirms, and Cordyceps sinensis has the biological activity widely such as immunomodulatory, antibacterial, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual production such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the qualification of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph confirmation, activeconstituents compartment analysis and the mechanism of action, Application and Development.Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, therefore its output is very low, price is high.Wild cordyceps is because factors such as being subject to growing environment restricts, scarcity of resources.Owing to making little progress on artificial culture in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation is produced Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, and not climate, geographical environment and the strict restriction of Chinese caterpillar fungus parasitic conditions is again suitable for large-scale industrialization and produces.The substitute of producing is as also similar to natural cs with drug effect in its composition of mycelium, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, prove with natural cs chemical constitution, pharmacological action basically identical, can replace natural cs to produce cordyceps product, to make up the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites is all significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, in to worm grass product research and development, progressively turn to deeper functional meta-bolites to study by the direct utilization of Chinese caterpillar fungus raw material or crude extract.Chinese caterpillar fungus meta-bolites is done to a large amount of research both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative functional meta-bolites such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL wins initial success in the research of the aspect such as biosynthesizing, pharmacological action.

Unsaturated fatty acids refers to the lipid acid that contains one or more pairs of keys in molecule, and its fusing point is low compared with saturated fatty acid.Unsaturated fatty acids is a kind of lipid acid that forms body fat, the lipid acid of needed by human, and unsaturated fatty acids, according to the difference of two key numbers, is divided into two kinds of monounsaturated fatty acids and polyunsaturated fatty acids.Polyunsaturated fatty acid (Polyunsaturated FattyAcids, PUFAs) relative saturation lipid acid has more effect, it can reduce blood cholesterol and triglyceride level, regulate heart function, reduce blood viscosity, improve blood microcirculation, improve the activity of brain cell, memory and thinking ability, strengthen human defensive system's function etc., in addition it can also get rid of unnecessary " rubbish " in human body, namely due to the superabundant fat that forms of excessive saturated fatty acid of having taken the photograph people, thereby reaches the object of fat-reducing.Therefore, its potential medical pharmaceutical use has been subject to the extensive concern in the world, has caused the great attention of the industries such as food, medical even makeup.

Yung-Sheng in 1999 draws and has cloned △ 6 and △ 12 fatty acid dehydrogenase genes of Mortierella alpina (Mortiere Uaalpina) and expressed in yeast saccharomyces cerevisiae.2004,3 desaturases of the △ in tung oil tree are proceeded to yeast by the people such as Dyer, successfully obtained and produced linolenic yeast.△ 12 desaturases of the blue or green bacterium of algae (Cyanobacterium) are proceeded to potato by the people such as Maali-Amiri in 2007, successfully detects that considerable change has occurred potato fatty acid component.2008, the people such as Hao turned △ 6 desaturases of volume branch Mucor in people's transgene tobacco, have successfully obtained the bacterial strain of high yield gamma-linolenic acid.In addition, also have the gene that many fatty acid desaturases are relevant to be cloned and Transformation Application.Because most of desaturase is embrane-associated protein, its separation and purification is very difficult, and the desaturase of separation and purification qualification is very few, and most research is carried out around delta 8 desaturase genes and expression regulation thereof.

At present, applied unsaturated fatty acids is produced bacterium taking subtilis as main, and as the Cordyceps fungus of important anabolism unsaturated fatty acids, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in Cordyceps fungus unsaturated fatty acids metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is for the deficiency of above existence and the technical issues that need to address, " hundred make " produced to enzyme and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore anabolism oleic acid and further investigate, the enzyme, encoding gene and the application thereof that provide " hundred make " production bacterium Cordyceps sinensis China pilose spore participation stearyl-coenzyme A to set out anabolism oleyl coenzyme A.

The technical solution used in the present invention is:

Participate in a stearyl-coenzyme A desaturase for stearyl-coenzyme A anabolism oleyl coenzyme A, there is 90% above homology with sequence shown in SEQ ID No.1.This enzyme can be prepared corresponding oleyl coenzyme A by catalysis stearyl-coenzyme A, and oleyl coenzyme A generates oleic acid through the effect of Perhydrolase again.Due to the singularity of aminoacid sequence; any fragment that contains the peptide protein of aminoacid sequence shown in SEQ ID NO.1 or its variant; as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology, more than 90%, all belong to the row of protection domain of the present invention.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in aminoacid sequence; Wherein, change for the conservative property of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replaced Isoleucine with leucine, variant also can have non-conservation and change, as replaced glycine with tryptophane.

The path that is obtained corresponding oleyl coenzyme A, oleyl coenzyme A hydrolysis generation oleic acid by stearyl-coenzyme A anabolism is as follows:

Preferably, the aminoacid sequence of described stearyl-coenzyme A desaturase (is designated as unsD albumen) as shown in SEQ ID No.1.

Stearyl-coenzyme A desaturase of the present invention is produced bacterium Cordyceps sinensis China pilose spore from " hundred make ".

The invention still further relates to described stearyl-coenzyme A desaturase and prepare the application in oleyl coenzyme A at biocatalysis stearyl-coenzyme A.

The invention still further relates to the encoding gene of above-mentioned stearyl-coenzyme A desaturase, i.e. stearyl-coenzyme A dehydrogenase gene.Concrete, this encoding gene can be the gene order with polynucleotide shown in SEQ ID NO.2 with 90% above homology.Due to the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO.2, as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide changes that has.The variant of these polynucleotide can make raw displacement varient or the varient of non-life, comprises and replaces varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from not changing in fact the function of peptide protein of its coding.

Preferably, described gene nucleotide series (is designated as unsD gene) as shown in SEQ ID No.2.

Described gene can be used for building the genetic engineering bacterium of can biocatalysis stearyl-coenzyme A preparing oleyl coenzyme A, to expand the output of oleic acid or derivatives thereof.

Main points of the present invention have been to provide the aminoacid sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ IDNO.2, the in the situation that of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, be all apparent to those skilled in the art.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in detail the synthetic oleyl coenzyme A pathways metabolism of stearyl-coenzyme A principle, the cloned DNA that comprises nucleotide sequence provided by the present invention can be used for by transduction, transform, proceeds in engineering bacteria in conjunction with the method shifting, by regulating the expression of oleyl coenzyme A biosynthesis gene, give the high expression level of host's stearyl-coenzyme A desaturase, for the output that expands oleic acid or derivatives thereof provides effective way, there is major application prospect.

(4) brief description of the drawings

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is Fatty acid biosynthesis metabolism approach annotated map;

Fig. 3 is fatty acid metabolism approach annotated map;

Fig. 4 is unsaturated fatty acids metabolic pathway of synthesizing annotated map;

Fig. 5 is stearyl-coenzyme A dehydrogenase gene pcr amplification product gel electrophoresis figure;

Fig. 6 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 7 is restructuring cloned plasmids pMD18-T/uns D physical map;

Fig. 8 is recombinant expression plasmid pET-28a/uns D building process schematic diagram;

Fig. 9 is recombinant expression plasmid pET-28a/uns D physical map;

Figure 10 is the SDS-PAGE figure of stearyl-coenzyme A apodehydrogenase.

(5) embodiment

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: first gather natural cordyceps from Qinghai, and taken back Hangzhou and carried out separation screening, obtain L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, in the patent CN102373190A of previously application, discloses.

This bacterial classification is inoculated in to inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, prepare afterwards bevel again in following ratio) be glucose 2.0%(w/v, 1% represents to contain 1g in 100mL substratum, Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, magnesium sulfate 0.05%, potassium primary phosphate 0.05%, agar powder 1.0% down together),, surplus is water, cultivates 25 days at 12 ~ 16 DEG C; Then bacterial classification is inoculated in to fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, magnesium sulfate 0.01%, potassium primary phosphate 0.02%, surplus is water, be placed on shaking table, 12 ~ 16 DEG C of cultivations of temperature 25 days, under aseptic condition, carry out solid-liquid separation after cultivation finishes, and solid is placed in to aseptic utensil, for subsequent use.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

Extract total RNA with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly add liquid nitrogen to be fully ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mix, leave standstill 5min on ice, nucleic acid-protein mixture is separated completely.2) RNA separates: add 0.2mL chloroform, firmly concussion mixes 15s, leaves standstill 2 ~ 3min on ice, 4 DEG C, the centrifugal 15min of 12000rpm, and layering, gets upper strata water, approximately 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leave standstill 10min on ice, 4 DEG C, the centrifugal 10min of 12000rpm, abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol, will precipitate and hang, leave standstill 10min, 4 DEG C, the centrifugal 15min of 7500rpm on ice; Repeat washing step above, then wash one time.5) dissolve RNA: centrifuge tube is placed in and opens wide dry 5 ~ 10min on ice, add appropriate DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

Extract after sample total RNA, use with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer that mRNA is broken into short-movie section (200 ~ 700bp), taking mRNA as template, with the synthetic Article 1 cDNA chain of hexabasic base random primer (random hexamers), then synthetic Article 2 cDNA chain, do end reparation, add polyA and connect sequence measuring joints through QiaQuick PCR test kit purifying and after adding EB buffer solution elution again, then carry out clip size selection with agarose gel electrophoresis, finally carry out pcr amplification, the sequencing library of building up checks order with IlluminaGA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains adaptor sequence in primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo(Li, Zhu et al. De novoassembly of human genomes with massively parallel short read sequencing [J]. Genome Res, 2010,20:265-272.) transcribe group and from the beginning assemble.First SOAPdenovo is linked to be the reads with certain length overlap the longer Contig fragment that does not contain N.Then reads is compared back to Contig, determine from the distance between different Contig and these Contig of same transcript by paired-end reads, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads to do filling-up hole processing to Scaffold, finally obtain containing N minimum, the Unigene sequence that two ends can not extend again.Finally, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done to blastx and compare (evalue<0.00001), get the best albumen of comparison result and determine the sequence direction of Unigene.If the comparison result between different sink is contradictory, press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al. ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J]. In Proceedings of 9th InternationalConference on Intelligent Systemsfor Molecular Biology. AAAIPress, Menlo Park, CA, pp.1999, 138-148.) predict its coding region and determine the direction of sequence.Provide its sequence from 5' to 3' direction for the Unigene that can determine sequence direction, provide for the Unigene that cannot determine sequence direction the sequence that composite software obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function annotation, Pathway annotation, COG functional annotation and the Gene Ontology(GO of Unigene) functional annotation.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue<0.00001), obtain thering is the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.Can further obtain the Pathway annotation of Unigene according to KEGG annotation information.Unigene and COG database are compared, and the function that prediction Unigene is possible is also done function statistic of classification to it.According to nr annotation information, use Blast2GO software (Conesa, Gotz et al. Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J]. Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.Obtain after the GO annotation of each Unigene, with WEGO software (Ye, Fang et al. WEGO:a web tool for plotting GO annotations[J]. Nucleic Acids Research, 2006,34:293-297.) all Unigene are done to GO functional classification statistics, be familiar with the gene function distribution characteristics of these species from macroscopic view.

Embodiment 6: " hundred make " produced bacterium Cordyceps sinensis China pilose spore oleic acid pathways metabolism and analyzed

Fig. 2 is the Fatty acid biosynthesis metabolism (map00061) in KEGG pathways metabolism annotation, Fig. 3 is the fatty acid metabolism (map00071) in KEGG pathways metabolism annotation, Fig. 4 is the unsaturated fatty acids anabolism (map01040) in KEGG pathways metabolism annotation, the enzyme having annotated is that " hundred make " that detected produces bacterium Cordyceps sinensis China pilose spore oleic acid pathways metabolism relevant enzymes, as can be seen from the figure, detected from a stearyl-coenzyme A dehydrogenase 1 Unigene of the synthetic corresponding oleyl coenzyme A of stearyl-coenzyme A.Detect online by the ORF Finder software in NCBI, found out the open reading frame (SEQ ID No.2) of this gene and obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces bacterium Cordyceps sinensis China pilose spore stearyl-coenzyme A dehydrogenase gene design of primers

The each gene open reading frame DNA sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, produce the stearyl-coenzyme A dehydrogenase gene of bacterium China pilose spore anabolism oleic acid for clone's " hundred make ", primer is synthetic by Shanghai Sheng Gong biotechnology company limited, and primer sequence is listed as follows:

UnsD gene: forward primer 5 ' ATAGAATTCATGGCCTTCGTCGGCCTCGC3 '

Reverse primer 5 ' ATAAAGCTTTCAATGGGTCGGCGTCTCAACC3 '

UnsD mrna length is 405bp.

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

The method first providing according to embodiment 1 is turned out after sutella sinensis fermented mycelium, the method providing according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain by following after total RNA, for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) in Microtube pipe, prepare following mixed solution.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the annealing of the specificity of reverse transcription primer and template, can improve reverse transcription reaction efficiency, so carry out sex change, annealing reaction on PCR instrument, condition setting is as follows:

65℃，5 min

3) annealing finishes the mixed solution that the rear centrifugal several seconds makes template ribonucleic acid/primer etc. and is gathered in Microtube pipe bottom.

4) in above-mentioned Microtube pipe, prepare following inverse transcription reaction liquid.

5) on PCR instrument, carry out reverse transcription reaction by following condition.

42℃ 15～30 min

70℃ 15 min

Generalized case, there is a PolyA structure at eukaryote mRNA 3 ' end, the quantity of A base ten to hundreds of not etc., utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, synthetic cDNA the first chain taking mRNA as template, the sequence (providing in PrimeScript 1st Strand cDNA Synthesis Kit) in the dT region of being developed alone by TaKaRa is provided in the present invention is primer, if the mRNA integrity obtaining is better, can obtain so cDNA first chain of all zymoprotein encoding genes in species by reverse transcription process.

Embodiment 9: " hundred make " produces the detection of clone, expression and the protein vigor of bacterium Cordyceps sinensis China pilose spore anabolism oleic acid functional gene stearyl-coenzyme A desaturase unsD gene

1, the pcr amplification of stearyl-coenzyme A desaturase unsD gene

Taking cDNA the first chain of obtaining in embodiment 8 as template, unsD gene primer with synthetic in embodiment 7: 5 ' ATA GAA TTC ATG GCC TTC GTC GGC CTC GC3 ' and 5 ' ATA AAG CTT TCA ATG GGT CGG CGT CTC AAC C3 ' carry out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2, stearyl-coenzyme A desaturase unsD gene PCR product gel electrophoresis detection

Concrete detection method is: 1) it is uniformly dissolved 0.9% the sepharose microwave-oven-heating preparing; 2) get 15mL gel, in the time that gel is cooled to 50 DEG C of left and right, add 1 μ L staining fluid Gold view, after mixing, pour on treatments of Electrophoretic Slab Gels, remove and insert point sample comb after bubble; 3) after gel solidifies, carefully take out point sample comb, offset plate is put into electrophoresis chamber (one end, point sample hole is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add TAE electrophoretic buffer; 4) get 5 μ L samples and then add 6 × Loading Buffer, 1.5 μ L and ddH ₂after O 4 μ L mix, using liquid-transfering gun loading, applied sample amount is 10 μ L; 5) connect the supply lead between electrophoresis chamber and electrophoresis apparatus, just very red, negative pole is black; 6) power-on, starts electrophoresis, and maximum voltage is no more than 5 V/cm; 7) when sample ran offset plate 2/3 time can stop electrophoresis; 8), after cutting off the electricity supply, gel taken out and put into the observation of gel imaging instrument, take pictures.

The size of transcribing group order-checking prediction stearyl-coenzyme A desaturase unsD gene is 405bp, and agarose gel electrophoresis result shows successfully to have amplified stearyl-coenzyme A desaturase unsD gene, and size is about 400bp.Fig. 5 is that " hundred make " produces bacterium China pilose spore anabolism oleyl coenzyme A functional gene PCR product gel electrophorogram.

3, the base A that adds of stearyl-coenzyme A desaturase unsD gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier also need to add base A processing, purifying after glue reclaims after.It is as follows that glue recovery product adds base A system:

In PCR instrument, 72 DEG C add A base 20 min, finally purify with AxyPrep PCR cleaning agents box.

4, being connected of stearyl-coenzyme A desaturase unsD gene and cloning vector

Cloning vector pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), its physical map is shown in Fig. 6, stearyl-coenzyme A desaturase unsD gene is connected to construction recombination plasmid pMD18-T/unsD with cloning vector, physical map is shown in Fig. 7, and linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 DEG C, 16h; Deactivation: 65 DEG C, 15min.

5, the conversion of stearyl-coenzyme A desaturase recombinant plasmid pMD18-T/unsD

Recombinant plasmid pMD18-T/unsD is proceeded in intestinal bacteria E. coli JM109 and to build the recombinant bacterium E. coli JM109/pMD18-T/unsD that carries stearyl-coenzyme A desaturase unsD gene, concrete steps are: 1) 10 μ L reaction systems are gone in competent cell E. coli JM109 to ice bath 30min; 2) thermal shock: 42 DEG C, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 DEG C, 250rpm, 1h; 5) spread plate (containing Amp resistance); 6) 37 DEG C of incubator overnight incubation.

6, the screening of the positive recombinant bacterium of stearyl-coenzyme A desaturase E. coli JM109/pMD18-T/unsD

Bacterium colony PCR can extract genomic dna, and directly carry out pcr amplification taking the DNA that exposes after thalline pyrolysis as template, the method is easy and simple to handle, quick, can Rapid identification bacterium colony whether be the positive bacterium colony that contains object plasmid, transform in qualification comparatively common.In experiment, carry out bacterium colony PCR by being inoculated into single bacterium colony corresponding in liquid nutrient medium, to verify whether proceed to goal gene.First, add and contain in the 1.5mL centrifuge tube of 50 μ L sterilized waters with toothpick picking list bacterium colony, boiling water bath 30min, then centrifugal using supernatant as template, carry out pcr amplification, PCR program setting is Taq enzymatic amplification general procedure.Finally adopt 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of stearyl-coenzyme A desaturase recombinant plasmid pMD18-T/unsD

After the positive recombinant bacterium liquid LB culture medium culturing that bacterium colony PCR is detected is spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is completed by Sani bio tech ltd, Shanghai.

8, the structure of stearyl-coenzyme A desaturase recombinant expression plasmid pET-28a/unsD

Experiment is the principle at expression in escherichia coli according to foreign gene, and expression vector pET-28a and stearyl-coenzyme A desaturase unsD gene restriction enzyme site comparison situation, determine EcoR I and Hind III double enzyme site, and recombination bacillus coli E. coli JM109/pMD18-T/unsD has been carried out to the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.Through sequence verification, sequence SEQID No.2 has recombinated to recombinant plasmid pET-28a/unsD.

The recombinant plasmid pMD18-T/unsD of stearyl-coenzyme A desaturase unsD gene and expression vector pET-28a use respectively EcoR I/Hind III restriction enzyme 37 DEG C respectively enzyme cut process 6h, it is as follows that enzyme is cut system:

EcoR I/Hind III double digestion system:

Enzyme is cut and is finished rear 65 DEG C of deactivation 15min, then respectively with Axygen DNA gel recovery test kit reclaim, purifying.

Stearyl-coenzyme A desaturase unsD gene and expression vector pET-28a spend the night with 16 DEG C of connections of T4 ligase enzyme after double digestion, purifying again, build recombinant expression plasmid pET-28a/unsD, its building process is shown in Fig. 8, builds the recombinant expression plasmid pET-28a/unsD collection of illustrative plates obtaining and sees Fig. 9.Linked system is composed as follows:

Linked system:

9, the conversion of stearyl-coenzyme A desaturase recombinant expression plasmid pET-28a/unsD and the screening of positive monoclonal

The expression plasmid heat shock building is converted in E. coli BL21 Host Strains, is then applied on the LB agar plate that contains kantlex (Kan) resistance 37 DEG C of overnight incubation.Random choose list bacterium colony from flat board, carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of stearyl-coenzyme A desaturase recombinant bacterium E. coli BL21/pET-28a/unsD

Be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance 37 DEG C, 250r/min overnight incubation by being accredited as positive mono-clonal.Get 1mL culture, in the LB liquid nutrient medium that contains Kan resistance in 50mL of being transferred, 37 DEG C, 250r/min are cultured to cell concentration OD600 and are about 0.6～0.8 left and right.In culture, add respectively certain density IPTG inducing culture 8h.Collecting thalline surveys for electrophoretic analysis and enzyme biopsy.

11, stearyl-coenzyme A desaturase recombinant bacterium E. coli BL21/pET-28a/unsD expression product SDS-PAGE analyzes

With the recombinant bacterium that proceeds to the E. coli BL21 bacterium of empty carrier and do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium after IPTG inducing culture certain hour, get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in 50 μ L distilled water, add 50 μ L sample-loading buffers, after mixing, boil 10min, carry out SDS-PAGE electrophoretic analysis, " A " swimming lane in Figure 10 be stearyl-coenzyme A desaturase unsD(that recombinant bacterium E. coli BL21/pET-28a/unsD expresses through its aminoacid sequence of sequence verification as shown in SEQ ID No.1) SDS-PAGE figure.

12, the protein-active of stearyl-coenzyme A desaturase recombinant bacterium E. coli BL21/pET-28a/unsD detects

Enzyme liquid preparation: take recombinant bacterium E. coli BL21/pET-28a/unsD phosphate buffered saline buffer (50mM, pH8.0) 15mL suspension for 0.5g of collection, ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min).

Stearyl-coenzyme A desaturase unsD transformation system: transform in bottle and add E. coliBL21/pET-28a/unsD ultrasonication thalline 10mL, 0.1g stearyl-coenzyme A at 50mL, 30 DEG C, 150r/min conversion, after conversion finishes, centrifuging and taking supernatant is standby with subsequent detection.

Detection method: GC conditions: 30m × 0.32mm × 0.25mm fused-silica capillary column; 190 DEG C of post initial temperature post initial temperature, insulation 1min, is warming up to 230 DEG C with 6 DEG C/min, then constant temperature; 250 DEG C of vaporizer temperature; Carrier gas is high-purity He (99.999%); Before post, press 62.6KPa; Flow rate of carrier gas 1.4mL/min; Sample size 1 μ L; Splitting ratio 60:1.Mass spectrum condition: ion source is EI source; 230 DEG C of ion source temperatures; 150 DEG C of quadrupole temperature; Electron energy 70eV; 260 DEG C of interface temperature; Solvent delay 2min; Mass range 10-550u.

Detect and calculate through above-mentioned chromatographic condition, draw to draw a conclusion: the high specific enzyme of the expressed stearyl-coenzyme A desaturase of stearyl-coenzyme A desaturase recombinant bacterium E. coli BL21/pET-28a/unsD live (Specific Activity) be 0.8 mol/min/mg, substrate conversion efficiency is 81.24%.

Claims (5)

1. participate in a stearyl-coenzyme A desaturase for stearyl-coenzyme A anabolism oleyl coenzyme A, its aminoacid sequence is as shown in SEQ ID No.1.

2. stearyl-coenzyme A desaturase as claimed in claim 1 is prepared the application in oleyl coenzyme A at biocatalysis stearyl-coenzyme A.

3. the gene of stearyl-coenzyme A desaturase described in coding claim 1.

4. gene as claimed in claim 3, is characterized in that described gene nucleotide series is as shown in SEQ ID No.2.

5. gene as claimed in claim 4 is in the application building in the genetic engineering bacterium of can biocatalysis stearyl-coenzyme A preparing oleyl coenzyme A.