CN104120112A - Cordyceps sinensis 3-isopropylmalate dehydrogenase B, as well as encoding genes and application thereof - Google Patents

Abstract

The invention provides 3-isopropylmalate dehydrogenase B for preparing 4-methyl-2-oxoglutaric acid from cordyceps sinensis Hirsutella sinensis and biologically catalyzed 3-isopropylmalate as well as encoding genes and an application thereof. The 3-isopropylmalate dehydrogenase B has an amino acid sequence shown as SEQ ID No.1, and the encoding genes are shown as SEQ ID No.1. Cloning DNA of a nucleotide sequence provided by the invention can be used for being transferred into engineering bacteria through transduction, transformation and combined transfer methods, the host 3-isopropylmalate dehydrogenase B is endowed with high expression by regulating the expression of the 3-isopropylmalate dehydrogenase B genes, an effective path is provided for widening biological application of the 3-isopropylmalate dehydrogenase B, and the 3-isopropylmalate dehydrogenase B has significant application prospects.

Description

Cordyceps sinensis 3-Isopropylmalate dehydrogenase B, encoding gene and application thereof

(1) technical field

The present invention relates to produce from " hundred make " 3-Isopropylmalate dehydrogenase B (3-isopropylmalate dehydrogenase), encoding gene and the application thereof of bacterium Cordyceps sinensis China pilose spore.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma and the complex body on larva corpse (comprising stroma and polypide) on lepidopteran (Lepidoptera) Hepialidae insect (Hepialus armoricanus Oberthur) larva.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various feature of meta-bolites and biological activity, at biomedicine field, shows huge application and development prospect.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern, worldwide enjoys high praise.The traditional Chinese medical science thinks, Cordyceps sinensis enters lung kidney two warps, can tonifying lung cloudy, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough phlegm blood, spontaneous sweatings etc., are unique a kind of balance simultaneously, the Chinese medicine that regulates negative and positive.Modern pharmacology confirms, and Cordyceps sinensis has the biological activity widely such as immunomodulatory, antibacterial, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual productions such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the evaluation of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph confirmation, activeconstituents compartment analysis and the mechanism of action, Application and Development.Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

But, research to 3-Isopropylmalate dehydrogenase B in Cordyceps sinensis China pilose spore is almost blank, and the research of being prepared by 3-Isopropylmalate dehydrogenase B biocatalysis 3-isopropylmolic acid in China pilose spore to the effect of 4-methyl-2-oxopentanoic acid.

3-Isopropylmalate dehydrogenase (IPMDH, EC:1.1.1.85) is a key enzyme in biosynthesizing leucine, is a kind of with NAD ⁺or NADP ⁺for acceptor, act on the oxydo-reductase on donor CH-OH group.The following enzymatic reaction of this kind of enzyme energy catalysis: in fact this reaction is comprised of two steps: that is the product of above-mentioned the first step reaction can react spontaneous decarboxylation generation 4-methyl-2-oxopentanoic acid by second step.

1981, the people such as Tanaka were cloned into a 3-Isopropylmalate dehydrogenase from extreme thermophile bacteria Thermus thermophilus HB8, and with pBR322 as carrier cloning in intestinal bacteria.The colibacillary 3-Isopropylmalate dehydrogenase enzyme work of carrying recombinant plasmid is 7 times of wild type strain.

1986, the people such as Kazuhiro Hamasawa were cloned into a 3-Isopropylmalate dehydrogenase gene from the gene library of Candida utilis, utilize plasmid pYKL30 to be cloned in intestinal bacteria and yeast saccharomyces cerevisiae.The opening code-reading frame size of this gene is 1089bp, 363 amino-acid residues of encoding.Southern is hybridized confirmation, and this fragment is to obtain from three Candida utilis.

1991, the people such as H Kirino have been cloned into a 3-Isopropylmalate dehydrogenase leuB from extreme thermophile bacteria Thermus aquaticus YT-1, and express in intestinal bacteria, it comprises 1035bp, the open reading frame of 344 amino-acid residues of coding.Have 87.0% homology with the nucleotide sequence of the 3-Isopropylmalate dehydrogenase of thermophile bacteria T.thermophilus HB8, aminoacid sequence has 91.3% homology.

1992, Mats deng people, from complementary yeast mutant leu2, be cloned into a 3-Isopropylmalate dehydrogenase gene, the albumen of a 52kDa size of this genes encoding, it has the chloroplast transit peptides of inferring.By protein, imported in chloroplast(id) in vitro, with it while protein cleavage.

2011, the people such as Sikdar cloned and have obtained a 3-Isopropylmalate dehydrogenase gene from the genome of paddy rice, and the opening code-reading frame of this gene 389 amino acid of encoding, corresponding to the protein of about 41.2kD.The aminoacid sequence of 3-Isopropylmalate dehydrogenase and the 3-Isopropylmalate dehydrogenase aminoacid sequence height homology of plant and bacterial origin in this paddy rice source.

But, in ncbi database, also retrieve the gene-correlation information less than 3-Isopropylmalate dehydrogenase B in China pilose spore at present at present.

(3) summary of the invention

The present invention seeks to deficiency and the technical issues that need to address for above existence, " hundred make " production bacterium Cordyceps sinensis China pilose spore 3-Isopropylmalate dehydrogenase B is prepared to 4-methyl-2-oxopentanoic acid at biocatalysis 3-isopropylmolic acid and further investigate, a kind of 3-Isopropylmalate dehydrogenase B, encoding gene and the application thereof that provide " hundred make " to produce bacterium Cordyceps sinensis China pilose spore.

The technical solution used in the present invention is:

The invention provides a kind of 3-Isopropylmalate dehydrogenase B for preparing 4-methyl-2-oxopentanoic acid from Cordyceps sinensis China pilose spore participation biocatalysis 3-isopropylmolic acid, its aminoacid sequence (is designated as isoB albumen) as shown in SEQ ID No.1.

SEQ ID No.1 sequence is as follows: MATVQSDLFK PAKFGGKYTV TLIPGDGIGA EVAESVKTVF KADNVPVEWE QIAVSGLDEA GSGRTDEAFR ESVASLKRNK LGLKGILHTP ISRSGHQSFN VAMRQELDIY ASISLIKNMP GYETRHRGVD LCIIRENTEG EYSGLEHQSV PGVVESLKII TRAKSERIAR FAFAFALANG RQKVTCIHKA NIMKLADGLF RNTFHAVAKE YPTLEVNDMI VDNASMQAVS RPQQFDVMVM PNLYGGILSN IGAALVGGPG IVPGCNRARD MPVFEPACRH VGLDIKGKDQ ANPTAMVLSG SMLLRHLGLD DPANRISKAM Y*

Singularity due to aminoacid sequence; any fragment that contains the peptide protein of aminoacid sequence shown in SEQ ID NO.1 or its variant; as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology, more than 90%, all belong to the row of protection domain of the present invention.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in aminoacid sequence; Wherein, for the conservative property change of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replaced Isoleucine with leucine, variant also can have non-conservation and change, as replaced glycine with tryptophane.

The invention still further relates to described 3-Isopropylmalate dehydrogenase B and prepare the application in 4-methyl-2-oxopentanoic acid at biocatalysis 3-isopropylmolic acid.The path that obtains corresponding 4-methyl-2-oxopentanoic acid through the catalysis of 3-Isopropylmalate dehydrogenase B by 3-isopropylmolic acid is as follows:

Specifically, described 3-Isopropylmalate dehydrogenase B prepares being applied as in 4-methyl-2-oxopentanoic acid at biocatalysis 3-isopropylmolic acid: with the phosphate buffered saline buffer (50mM for wet thallus obtaining through inducing culture containing Cordyceps sinensis 3-Isopropylmalate dehydrogenase B recombinant bacterial strain, pH8.0) suspend, after ultrasonication, broken mixed solution is centrifugal, getting supernatant liquor is catalyzer, the 3-isopropylmolic acid aqueous solution of take is substrate, the cozymase (being NADH) of take is cosubstrate, in the natural Tris-HCl damping fluid of pH, 37 ℃, under 150rpm condition, react, after reaction finishes, reaction solution is centrifugal, get supernatant liquor and obtain the mixed solution that contains 4-methyl-2-oxopentanoic acid, mixed solution separation and purification is obtained to 4-methyl-2-oxopentanoic acid, the method of described separation and purification is operation known in this field, conventionally adopts affinity chromatography method, described mixed solution adopts high performance liquid chromatography to detect product in mixed solution, moving phase: V (acetonitrile): V[pH3.0 (0.86%) phosphoric acid triethylamine]=55:45, wavelength 237nm, column temperature: 25 ℃, flow 1mL/min, sampling volume: 20uL, solvent: acetonitrile, chromatographic column: Diamonsul250mm * 4.6mm C18 post, instrument: Shimadzu LC-20AT high performance liquid chromatograph.

The preparation method of described catalyzer is: the recombinant bacterial strain containing 3-Isopropylmalate dehydrogenase B is inoculated in the LB liquid nutrient medium that contains Kan resistance (final concentration 50 μ g/ml) to 37 ℃, 250r/min overnight incubation.Get 1mL culture, transferred in the LB liquid nutrient medium that (volumetric concentration inoculum size is 2%) contain Kan resistance (final concentration 50 μ g/ml) in 50mL, 37 ℃, 250r/min are cultured to cell concentration OD600 and are about 0.6～0.8 left and right, to the IPTG inducing culture 8h that adds finite concentration (final concentration 0.05mmol/L) in culture, collect wet thallus, wet thallus is stopped under 1s condition to ultrasonication 3 times at power 40%, broken 1s, each 5min, get cytoclasis mixed solution centrifugal, get supernatant liquor and be catalyzer.

Yi Ge unit of enzyme activity (U) is defined as: 3-Isopropylmalate dehydrogenase B is under 37 ℃ of conditions, and 1min catalysis 3-isopropylmolic acid generates the required enzyme amount of 4-methyl-2-oxopentanoic acid of 1 μ mol.

The concentration of the described substrate 3-isopropylmolic acid aqueous solution is 0.1M, the starting point concentration of described substrate is 0.02M, the volumetric usage of described catalyzer with ultrasonication before wet thallus quality count 10g/L (final concentration), the final concentration of described cozymase is 0.01g/L.

The invention still further relates to the gene of the described 3-Isopropylmalate dehydrogenase B of coding.Concrete, the nucleotide sequence of described gene (is designated as isoB gene, isoB genes encoding isoB albumen) as shown in SEQ ID No.2.

Due to the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO.2, as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide changes that has.The variant of these polynucleotide can make raw displacement varient or the varient of non-life, comprises and replaces varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from not changing in fact the function of the peptide protein of its coding.

The application of described coding 3-Isopropylmalate dehydrogenase B gene in building the genetic engineering bacterium of can biocatalysis 3-isopropylmolic acid preparing 4-methyl-2-oxopentanoic acid, to expand the application of 3-Isopropylmalate dehydrogenase B, be specially: build the recombinant vectors that contains described 3-Isopropylmalate dehydrogenase B gene, described recombinant vectors is converted in intestinal bacteria (preferably E.coli BL21 (DE3)), the recombination engineering bacteria obtaining carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells that contains 3-Isopropylmalate dehydrogenase B gene.

Main points of the present invention have been to provide the nucleotide sequence shown in the aminoacid sequence shown in SEQ ID NO.1 and SEQ ID NO.2, the in the situation that of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, be all apparent to those skilled in the art.

The bacterial strain that Cordyceps sinensis 3-Isopropylmalate dehydrogenase B of the present invention and encoding gene thereof can be provided is China pilose spore (Hirsutella sinensis) L0106, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M2011278, in the patent CN102373190A of previously application, discloses.

Beneficial effect of the present invention is mainly reflected in: the process that the present invention prepares 4-methyl-2-oxopentanoic acid to 3-Isopropylmalate dehydrogenase B biocatalysis 3-isopropylmolic acid in China pilose spore principle studies in detail, provide " hundred make " to produce 3-Isopropylmalate dehydrogenase B and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore, the cloned DNA of nucleotide sequence provided by the present invention can be used for by transduction, transform, in conjunction with the method shifting, proceed in engineering bacteria, by regulating the expression of proteolytic ferment gene, give the high expression level of host's 3-Isopropylmalate dehydrogenase B, for expanding the biologic applications of 3-Isopropylmalate dehydrogenase B, provide effective way, there is major application prospect.

(4) accompanying drawing explanation

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is the catalytic process annotated map at leucine pathways metabolism and 3-Isopropylmalate dehydrogenase place;

Fig. 3 is 3-Isopropylmalate dehydrogenase B gene PCR amplified production gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/isoB physical map;

Fig. 6 is recombinant expression plasmid pET-28a/isoB building process schematic diagram;

Fig. 7 is recombinant expression plasmid pET-28a/isoB physical map;

Fig. 8 is the SDS-PAGE figure of 3-Isopropylmalate dehydrogenase B albumen.

(5) embodiment

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: first gather natural cordyceps from Qinghai, and taken back Hangzhou and carried out separation screening, obtained L0106 bacterial strain, and be China pilose spore (Hirsutella sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M2011278, in the patent CN102373190A of previously application, discloses.

This bacterial classification is inoculated in to inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, in following ratio, prepare afterwards bevel again) be: glucose 2.0% (w/v, 1% represents to contain 1g in 100mL substratum, lower with), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, magnesium sulfate 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water; At 12～16 ℃, cultivate 25 days; Then bacterial classification is inoculated in to fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, magnesium sulfate 0.01%, potassium primary phosphate 0.02%, and surplus is water; Be placed on shaking table, 12～16 ℃ of cultivations of temperature 25 days, under aseptic condition, carry out solid-liquid separation, and solid are placed in to aseptic utensil after cultivation finishes, standby.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

With TRIzol reagent, extract total RNA, step is specially:

1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly add liquid nitrogen to be fully ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mix, standing 5min, makes nucleic acid-protein mixture completely separated on ice.

2) RNA is separated: add 0.2mL chloroform, firmly concussion mixes 15s, standing 2～3min on ice, and 4 ℃, the centrifugal 15min of 12000rpm, layering, gets upper strata water, approximately 600 μ L.

3) RNA precipitation: add 500 μ L Virahols, at standing 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm, abandon supernatant.

4) RNA washing: add 1mL75% (v/v) ethanol, will precipitate and hang, standing 10min on ice, 4 ℃, the centrifugal 15min of 7500rpm; Repeat washing step above, then wash one time.

5) dissolve RNA: centrifuge tube is placed in and opens wide dry 5～10min on ice, add appropriate DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

Extract after the total RNA of sample, use the enrichment with magnetic bead mRNA with Oligo (dT).Add fragmentation buffer that mRNA is broken into short-movie section (200～700bp), take mRNA as template, with the synthetic article one cDNA chain of hexabasic base random primer (random hexamers), then synthesize second cDNA chain, through QiaQuick PCR test kit purifying and after adding EB buffer solution elution, do end reparation, add polyA and connect sequence measuring joints again, then with agarose gel electrophoresis, carry out clip size selection, finally carry out pcr amplification, the sequencing library of building up checks order with Illumina GA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains adaptor sequence in primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo (Li, Zhu et al.De novo assembly of human genomes with massively parallel short read sequencing[J] .Genome Res, 2010,20:265-272.) transcribe group and from the beginning assemble.First SOAPdenovo is linked to be the reads with certain length overlap longer not containing the Contig fragment of N.Then reads is compared back to Contig, by paired-end reads, determine from the different Contig of same transcript and the distance between these Contig, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads to do filling-up hole to Scaffold and process, finally obtain containing N minimum, the Unigene sequence that two ends can not extend again.Finally, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done to blastx and compare (evalue<0.00001), get the sequence direction that the best albumen of comparison result is determined Unigene.If the comparison result between different sink is contradictory, press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than software ESTScan (Iseli for Unigene, Jongeneel et al.ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J] .In Proceedings of9th International Conference on Intelligent Systems for Molecular Biology.AAAIPress, Menlo Park, CA, pp.1999, 138-148.) predict the direction of its coding region definite sequence.For the Unigene that can determine sequence direction, provide its sequence from 5' to 3' direction, for the Unigene that cannot determine sequence direction, provide the sequence that composite software obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function annotation, Pathway annotation, COG functional annotation and Gene Ontology (GO) functional annotation of Unigene.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG (evalue<0.00001), obtain thering is the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.According to KEGG annotation information, can further obtain the Pathway annotation of Unigene.Unigene and COG database are compared, and the function that prediction Unigene is possible is also done function statistic of classification to it.According to nr annotation information, use Blast2GO software (Conesa, Gotz et al.Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J] .Bioinformatics, 2005,21 (18): the GO annotation information that 3674-3676.) obtains Unigene.Obtain after the GO annotation of each Unigene, with WEGO software (Ye, Fang et al.WEGO:a web tool for plotting GO annotations[J] .Nucleic Acids Research, 2006,34:293-297.) all Unigene are done to GO functional classification statistics, from macroscopic view, be familiar with the gene function distribution characteristics of these species.

Embodiment 6: the analysis of leucine pathways metabolism and 3-Isopropylmalate dehydrogenase B effect

Fig. 2 is catalytic step and the process annotated map at leucine pathways metabolism and 3-Isopropylmalate dehydrogenase B place, first, pyruvic acid is synthetic (S)-2-acetylactis under the katalysis of acetolactate synthase, then under the effect of Ketol-acid Reductoisomerase, synthesize 3-hydroxyl-3 methyl-2-Oxobutyric acid, after 5 step catalyzed reactions, generate (2R, 3S)-3-isopropylmolic acid, under the katalysis of 3-Isopropylmalate dehydrogenase B, generate 4-methyl-2-oxopentanoic acid, finally under the effect of leucine dehydrogenase, catalysis generates L-Leu.From China pilose spore, transcribe the Unigene that 3-Isopropylmalate dehydrogenase B detected group order-checking and annotation information.By the ORF Finder software in NCBI, detect online, found out the open reading frame (SEQ ID No.2) of this gene and obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces the design of bacterium Cordyceps sinensis China pilose spore 3-Isopropylmalate dehydrogenase B gene primer

Each gene open reading frame DNA sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, for clone's " hundred make ", produce the leucic 3-Isopropylmalate dehydrogenase B of bacterium China pilose spore anabolism gene, primer is synthetic by Sani bio tech ltd, Shanghai, and primer sequence is listed as follows:

IsoB gene: forward primer 5 ' AGAGAATTCATGGCGACGGTGCAGTCGGA3 '

Reverse primer 5 ' ATAGCGGCCGCTTAGTACATGGCCTTGGAG3 '

IsoB mrna length is 966bp.

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

The method first providing according to embodiment 1 is turned out after sutella sinensis fermented mycelium, the method providing according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain by following, being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain after total RNA, for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) in Microtube pipe, prepare following mixed solution.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the annealing of the specificity of reverse transcription primer and template, can improve reverse transcription reaction efficiency, so carry out sex change, annealing reaction on PCR instrument, condition setting is as follows:

65℃，5min

3) annealing finishes the mixed solution that the rear centrifugal several seconds makes template ribonucleic acid/primer etc. and is gathered in Microtube pipe bottom.

4) in above-mentioned Microtube pipe, prepare following inverse transcription reaction liquid.

5) on PCR instrument, by following condition, carry out reverse transcription reaction.

42℃ 15～30min

70℃ 15min

Generalized case, at eukaryote mRNA 3 ' end, there is a PolyA structure, the quantity of A base ten to hundreds of not etc., utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, take mRNA as synthetic cDNA the first chain of template, the sequence (providing in PrimeScript1st Strand cDNA Synthesis Kit) in the dT region of being developed alone by TaKaRa is provided in the present invention is primer, if the mRNA integrity obtaining is better, by reverse transcription process, can obtain so cDNA first chain of all zymoprotein encoding genes in species.Embodiment 9: " hundred make " produces the detection of clone, expression and the protein vigor of bacterium Cordyceps sinensis China pilose spore 3-Isopropylmalate dehydrogenase B gene

1, the pcr amplification of 3-Isopropylmalate dehydrogenase B gene

CDNA the first chain obtaining in embodiment 8 of take is template, with 3-Isopropylmalate dehydrogenase B gene primer synthetic in embodiment 7: 5 ' AGAGAATTCATGGCGACGGTGCAGTCGGA3 ' and 5 ' ATAGCGGCCGCTTAGTACATGGCCTTGGAG3 ' carry out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2,3-Isopropylmalate dehydrogenase B gene PCR product gel electrophoresis detection

Concrete detection method is:

1) with microwave-oven-heating, it is uniformly dissolved 0.9% the sepharose preparing;

2) get 15mL gel, when gel is cooled to 50 ℃ of left and right, add 1 μ L staining fluid Gold view, after mixing, pour on treatments of Electrophoretic Slab Gels, remove and insert point sample comb after bubble;

3) after gel solidifies, carefully take out point sample comb, offset plate is put into electrophoresis chamber (one end, point sample hole is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add TAE electrophoretic buffer;

4) get 5 μ L samples (being the pcr amplification product that step 1 obtains), then add 6 * Loading Buffer1.5 μ L and ddH ₂it is 10 μ L that O4 μ L uses liquid-transfering gun loading, applied sample amount after mixing;

5) connect the supply lead between electrophoresis chamber and electrophoresis apparatus, just very red, negative pole is black;

6) power-on, starts electrophoresis, and maximum voltage is no more than 5V/cm;

7) when sample ran offset plate 2/3 time can stop electrophoresis;

8) after cutting off the electricity supply, gel is taken out, put into gel imaging instrument and observe, take pictures.

Transcribe group order-checking, the size of prediction 3-Isopropylmalate dehydrogenase B gene is 966bp, and agarose gel electrophoresis result shows successfully to have amplified 3-Isopropylmalate dehydrogenase B gene, and size is about 1000bp.Fig. 3 is that " hundred make " produces bacterium China pilose spore 3-Isopropylmalate dehydrogenase B functional gene PCR product gel electrophorogram.

3, the base A that adds of 3-Isopropylmalate dehydrogenase B gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier also need to add base A processing, purifying after glue reclaims after.It is as follows that glue recovery product adds base A system:

In PCR instrument, 72 ℃ add A base 20min, finally with AxyPrep PCR cleaning agents box, purify.

4,3-Isopropylmalate dehydrogenase B gene and cloning vector is connected

Cloning vector pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), its physical map is shown in Fig. 4,3-Isopropylmalate dehydrogenase B gene after step 3 purifying is connected with cloning vector, construction recombination plasmid pMD18-T/isoB, physical map is shown in Fig. 5, and linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 ℃, 16h; Deactivation: 65 ℃, 15min.

5, the conversion of 3-Isopropylmalate dehydrogenase B recombinant plasmid pMD18-T/isoB

Recombinant plasmid pMD18-T/isoB is proceeded in intestinal bacteria E.coli JM109, structure carries the recombinant bacterium E.coli JM109/pMD18-T/isoB of 3-Isopropylmalate dehydrogenase B gene, concrete steps are: 1) 10 μ L reaction systems (being the connection product that step 4 obtains) are gone in competent cell E.coli JM109 to ice bath 30min; 2) thermal shock: 42 ℃, 90s; 3) ice bath: 2～3min; 4) add 800 μ L LB liquid nutrient mediums, 37 ℃, 250rpm, 1h; 5) coating LB dull and stereotyped (containing Amp resistance, final concentration 50 μ g/ml); 6) 37 ℃ of incubator overnight incubation.

LB liquid nutrient medium forms: Tryptones 10g/L, and yeast extract 5g/L, sodium-chlor 5g/L, solvent is water, pH nature; LB flat board is LB liquid nutrient medium+final concentration 15g/L agar.

6, the screening of the positive recombinant bacterium of 3-Isopropylmalate dehydrogenase B E.coli JM109/pMD18-T/isoB

Bacterium colony PCR can extract genomic dna, and directly take the DNA that exposes after thalline pyrolysis, carry out pcr amplification as template, the method is easy and simple to handle, quick, can Rapid identification bacterium colony whether be the positive bacterium colony that contains object plasmid, transform in identifying comparatively common.In experiment, by being inoculated into single bacterium colony corresponding in liquid nutrient medium, carry out bacterium colony PCR, to verify whether proceed to goal gene.First, with toothpick picking list bacterium colony, add containing in the 1.5mL centrifuge tube of 50 μ L sterilized waters, boiling water bath 30min, then centrifugal, using supernatant as template, carry out pcr amplification, PCR program setting is Taq enzymatic amplification general procedure.Finally adopt 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of 3-Isopropylmalate dehydrogenase B recombinant plasmid pMD18-T/isoB

To the detected positive recombinant bacterium LB liquid nutrient medium of bacterium colony PCR, after 37 ℃, 150rpm overnight incubation, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is completed by Sani bio tech ltd, Shanghai.Through sequence verification, sequence SEQ ID No.2 recombinates to pMD18-T/isoB.

8, the structure of 3-Isopropylmalate dehydrogenase B recombinant expression plasmid pET-28a/isoB

Experimental basis foreign gene is in the principle of expression in escherichia coli, and expression vector pET-28a and 3-Isopropylmalate dehydrogenase B gene restriction enzyme site comparison situation, determined EcoR I/Not I double enzyme site for isoB, and recombination bacillus coli E.coli JM109/pMD18-T/isoB has been carried out to the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.

The recombinant plasmid pMD18-T/isoB of 3-Isopropylmalate dehydrogenase B gene and expression vector pET-28a use respectively EcoR I/Not I restriction enzyme 37 ℃ respectively enzyme cut and process 6h, it is as follows that enzyme is cut system:

EcoR I/Not I double digestion system:

Enzyme is cut after end, and then 65 ℃ of deactivation 15min reclaim with Axygen DNA gel respectively that test kit reclaims, purifying.

3-Isopropylmalate dehydrogenase B gene and expression vector pET-28a spend the night with 16 ℃ of connections of T4 ligase enzyme after double digestion, purifying again, build recombinant expression plasmid pET-28a/isoB, its building process is shown in Fig. 6, builds the recombinant expression plasmid pET-28a/isoB collection of illustrative plates obtaining and sees Fig. 7.Linked system is composed as follows:

Linked system:

9, the conversion of 3-Isopropylmalate dehydrogenase B recombinant expression plasmid and the screening of positive monoclonal

The expression plasmid heat shock building is converted in E.coli BL21 (DE3) Host Strains, is then applied on the LB flat board that contains kantlex (Kan) resistance (final concentration 50 μ g/ml) 37 ℃ of overnight incubation.Random choose list bacterium colony from flat board, carries out pcr amplification with 3-Isopropylmalate dehydrogenase B gene primer synthetic in step 7, selects positive colony.

10, the abduction delivering of 3-Isopropylmalate dehydrogenase B recombinant bacterium

By being accredited as positive mono-clonal, be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (final concentration 50 μ g/ml) 37 ℃, 250r/min overnight incubation.Get 1mL culture, transferred in the LB liquid nutrient medium that contains Kan resistance (final concentration 50 μ g/ml) in 50mL, 37 ℃, 250r/min are cultured to cell concentration OD600 and are about 0.6～0.8 left and right.To the IPTG inducing culture 8h that adds respectively finite concentration (final concentration 0.05mmol/L) in culture.Collecting thalline surveys for electrophoretic analysis and enzyme biopsy.

11,3-Isopropylmalate dehydrogenase B recombinant bacterium expression product SDS-PAGE analyzes

With the recombinant bacterium that proceeds to E.coli BL21 (DE3) bacterium of empty carrier and do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium after IPTG inducing culture 7h, get 0.5mL inducing culture thing, centrifugal, collect thalline, be resuspended in 50 μ L distilled water, add 50 μ L sample-loading buffers, after mixing, boil 10min, carry out SDS-PAGE electrophoretic analysis, " A " swimming lane in Fig. 8 is the SDS-PAGE figure of e. coli bl21 (DE3) ghost, " B " swimming lane is that recombinant bacterium E.coli BL21 (DE3)/pET-28a adds the SDS-PAGE figure after IPTG induction, " C " swimming lane is the contrast SDS-PAGE figure that recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB does not add IPTG, " D " swimming lane is the SDS-PAGE figure of recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB abduction delivering.Show to contain in recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB 3-Isopropylmalate dehydrogenase B (through its aminoacid sequence of sequence verification as shown in SEQ ID No.1).

12, the protein vigor of 3-Isopropylmalate dehydrogenase B recombinant bacterium detects

Enzyme liquid preparation: take recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB2g that step 10 is collected, with phosphate buffered saline buffer (50mM, pH8.0) 100mL, suspend, high pressure cracker (model FS-600, Shanghai Sheng Xi ultrasonic instrument company limited) at power 40%, broken 1s, stop broken 3 times (35Kpa) under 1s condition, each 5min, the centrifugal thalline of removing, collects supernatant liquor and obtains crude enzyme liquid 84.2ml.

3-Isopropylmalate dehydrogenase B transformation system: prepare a clean 50mL and transform bottle, add respectively E.coli BL21 (DE3)/pET-28a/isoB crude enzyme liquid 2mL, the 3-isopropylmolic acid aqueous solution 1mL of 0.1M, the cozymase 1mL of Tris-HCl damping fluid (pH7.0) 1mL and 0.05g/L.Under 37 ℃, 150rpm condition, react 1h, after reaction finishes, reaction solution is centrifugal, get the content that supernatant liquor detects 4-methyl-2-oxopentanoic acid.

High performance liquid chromatography detects the content of product 4-methyl-2-oxopentanoic acid, moving phase: V (acetonitrile): V[pH3.0 (0.86%) phosphoric acid triethylamine]=55:45, wavelength 237nm, column temperature: 25 ℃, flow 1mL/min; Sampling volume: 20uL, solvent: acetonitrile, chromatographic column: Diamonsul250mm * 4.6mm C18 post, instrument: Shimadzu LC-20AT high performance liquid chromatograph.

Yi Ge unit of enzyme activity (U) is defined as: 3-Isopropylmalate dehydrogenase B is under 37 ℃ of conditions, and 1min catalysis 3-isopropylmolic acid generates the required enzyme amount of 4-methyl-2-oxopentanoic acid of 1 μ mol.

Detect blank that 3-Isopropylmalate dehydrogenase B enzyme lives and be and boil the crude enzyme liquid of inactivation after 20min and substitute enzyme liquid.In addition, under similarity condition, also detected the vigor of the crude enzyme liquid after E.coli BL21 (DE3) and E.coli BL21 (DE3)/pET-28a induction, 3-Isopropylmalate dehydrogenase B enzyme all do not detected and live.

The protein content that utilizes Xylene Brilliant Cyanine G method to record in 3-Isopropylmalate dehydrogenase B crude enzyme liquid is 0.285mg/mL, by Bandscan software, crude enzyme liquid band content in SDS-PAGE is analyzed, 3-Isopropylmalate dehydrogenase B accounts for 16.5% of total protein, therefore participate in the 3-Isopropylmalate dehydrogenase B of catalyzed reaction, is 0.285mg/mL * 2mL * 0.165=0.094mg.According to enzyme, live and define, the high specific enzyme work of 3-Isopropylmalate dehydrogenase B is: 81.4 μ mol/ (0.094mg * 60min)=14.4 μ mo1/mg/min=14.4U/mg.Therefore, the high specific enzyme of the 3-Isopropylmalate dehydrogenase B that above-mentioned 3-Isopropylmalate dehydrogenase B recombinant bacterium is expressed is lived as 25.8U/mg, and the transformation efficiency of above-mentioned reaction is 81.4%.Than enzyme calculation formula alive, be: than the Tot Prot of enzyme work=enzyme work/enzyme.Transformation efficiency calculation formula is: transformation efficiency=(starting point concentration-equilibrium concentration)/starting point concentration.

Claims (9)

1. a Cordyceps sinensis 3-Isopropylmalate dehydrogenase B, is characterized in that the aminoacid sequence of described desaturase B is as shown in SEQ ID No.1.

2. Cordyceps sinensis 3-Isopropylmalate dehydrogenase B as claimed in claim 1 prepares the application in 4-methyl-2-oxopentanoic acid at biocatalysis 3-isopropylmolic acid.

3. application as claimed in claim 2, it is characterized in that described being applied as: the wet thallus obtaining through inducing culture containing 3-Isopropylmalate dehydrogenase B recombinant bacterial strain with Cordyceps sinensis suspends with pH8.0 phosphate buffered saline buffer, after ultrasonication, broken mixed solution is centrifugal, getting supernatant liquor is catalyzer, the 3-isopropylmolic acid aqueous solution of take is substrate, take cozymase as cosubstrate, in Tris-HCl damping fluid, 37 ℃, under 150rpm condition, react, after reaction finishes, reaction solution is centrifugal, get supernatant liquor and obtain the mixed solution containing 4-methyl-2-oxopentanoic acid, by mixed solution separation and purification, obtain 4-methyl-2-oxopentanoic acid.

4. application as claimed in claim 3, it is characterized in that: described substrate 3-isopropylmolic acid concentration of aqueous solution is 0.1M, in described reaction system, the starting point concentration of substrate is 0.02M, the volumetric usage of described catalyzer with ultrasonication before wet thallus quality count 0.01g/L, the final concentration of described cozymase is 10g/L.

5. application as claimed in claim 3, it is characterized in that described catalyzer prepared as follows: the recombinant bacterial strain containing 3-Isopropylmalate dehydrogenase B is inoculated in the LB liquid nutrient medium containing the Kan resistance of final concentration 50 μ g/ml, 37 ℃, 250r/min overnight incubation, get culture, with the inoculum size of volumetric concentration 2%, transfer in the LB liquid nutrient medium that contains final concentration 50 μ g/ml Kan resistances, 37 ℃, it is 0.6～0.8 that 250r/min is cultured to cell concentration OD600, to the IPTG inducing culture 8h that adds final concentration 0.05mmol/L in culture, collect wet thallus, by wet thallus at power 40%, broken 1s stops ultrasonication under 1s condition, get cytoclasis mixed solution centrifugal, get supernatant liquor and be catalyzer.

6. the gene of 3-Isopropylmalate dehydrogenase B described in the claim 1 of encoding.

7. encoding gene as claimed in claim 6, is characterized in that the nucleotide sequence of described encoding gene is as shown in SEQ ID No.2.

8. the application of the encoding gene as described in claim 6 or 7 in building the genetic engineering bacterium of can biocatalysis 3-isopropylmolic acid preparing 4-methyl-2-oxopentanoic acid.

9. application as claimed in claim 8, it is characterized in that described being applied as: build the recombinant vectors that contains described 3-Isopropylmalate dehydrogenase B gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtaining carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells that contains 3-Isopropylmalate dehydrogenase B gene.