CN102776162B - Enzyme of cordyceps sinensis hirsutella sinensis anabolic adenylic acid, gene and application of enzyme - Google Patents

Abstract

The invention relates to an enzyme of metabolic adenine nucleotide synthesized by cordyceps sinensis hirsutella sinensis from bailing producing bacteria to participate in adenosine starting, gene coding the enzyme and an application of the enzyme. The adenosine kinase amino acid sequence is shown as SEQ ID No (sequencer identifier number).1, and the coding gene correspondingly has the nucleotide sequence shown as SEQ ID No .2. The metabolic pathway of the adenosine synthesized adenine nucleotide is detailedly studied in the principle aspect, cloning DNA (deoxyribonucleic acid) containing the nucleotide sequence provided by the invention can be used for being transferred into engineering bacteria by transduction, conversion and combination methods, high expression of host adenine nucleotide is given through regulating the adenine nucleotide biosynthetic gene expression, an effective path is provided for the yield increase of the adenine nucleotide, and great application prospects are realized.

Description

Enzyme, gene and the application thereof of Cordyceps sinensis China pilose spore anabolism adenylic acid (AMP)

(1) technical field

The present invention relates to the set out E.C. 2.7.1.20 (adenosine kinase) of anabolism adenine nucleotide of a participation adenosine of producing bacterium Cordyceps sinensis China pilose spore from " hundred make ", the gene of this enzyme of encoding and application thereof.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma on lepidopteran (Lepidoptera) Hepialidae insect (Hepialus armoricanus Oberthur) larva and the complex body (comprising stroma and polypide) on larva corpse.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various feature of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern, worldwide enjoys high praise.The traditional Chinese medical science thinks, Cordyceps sinensis enters lung kidney two warps, can tonifying lung the moon, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough weakness, phthisical cough phlegm blood, spontaneous sweatings etc., are unique a kind of balance simultaneously, the Chinese medicine that regulates negative and positive.Modern pharmacology confirms, and Cordyceps sinensis has the biological activity widely such as immunomodulatory, antibacterial, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual production such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the evaluation of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph confirmation, activeconstituents compartment analysis and the mechanism of action, Application and Development.Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, therefore its output is very low, price is high.Wild cordyceps is because factors such as being subject to growing environment restricts, scarcity of resources.Owing to making little progress on artificial culture in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation is produced Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, and not climate, geographical environment and the strict restriction of Chinese caterpillar fungus parasitic conditions is again suitable for large-scale industrialization and produces.The substitute of producing is as also similar to natural cs with drug effect in its composition of mycelium, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, prove with natural cs chemical constitution, pharmacological action basically identical, can replace natural cs to produce cordyceps product, to make up the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites is all significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, in to worm grass product research and development, progressively turn to deeper functional meta-bolites to study by the direct utilization of Chinese caterpillar fungus raw material or crude extract.Chinese caterpillar fungus meta-bolites is done to a large amount of research both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative functional meta-bolites such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL wins initial success in the research of the aspect such as biosynthesizing, pharmacological action.

Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein purines nucleosides comprises adenosine and guanosine and their precursor species material inosine (inosine) and xanthosine etc.Research shows that adenosine can be used as disease treatment medicine, also can be used for diagnosis of coronary heart disease, and its analogue has antiviral activity and antitumor action; Inosine can be used for the treatment of the diseases such as heart trouble, hepatopathy, leukopenia, thrombocytopenia, optic atrophy and central serous chorioretinopathy, can prevent and remove by the drug-induced side effect to heart or liver of the prevention and cure of schistosomiasis; Guanosine can be used as the synthesis material of many antiviral such as ribavirin, acycloguanosine.

Due to the important physiological action of purine nucleoside and analogue thereof, related microorganism is produced the existing a lot of research of purines nucleosides both at home and abroad.(the Matsui such as Matsui, Sato et al.Mutation of an inosine-producing strain of Bacillus subtilis to DL-methionine sulfoxide resistance for guanosine production[J] .Applied and Environmental Microbiology, 1997,34 (4): 337-341.) inosine production bacterium B.subtilis1411 is carried out to mutagenic treatment and obtain guanosine Producing Strain AG169.In order further to improve production level, the domestic researchist of having is studied (Qian to the genetic background of producing purine nucleoside route of synthesis in bacterium, Cai et al.Analysis of three nucleotide sequences involved in purine nucleotides biosynthesis in inosine and guanosine-producing bacilus subtilis.Acta Microbiologica Sinica, 2003,43 (2): 200-205.).This research has disclosed the part hereditary property of producing bacterium from molecular level, contribute to understand product at gene level and producing the accumulation in bacterium.

At present, applied purines nucleosides is produced bacterium take subtilis as main, and as the Cordyceps fungus of important anabolism purines nucleosides, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in Cordyceps fungus purines nucleosides metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is for the deficiency of above existence and the technical issues that need to address, " hundred make " produced to enzyme and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore anabolism adenine nucleotide and further investigate, the enzyme, encoding gene and the application thereof that provide " hundred make " production bacterium Cordyceps sinensis China pilose spore participation adenosine to set out anabolism adenine nucleotide.

The technical solution used in the present invention is:

Produce bacterium Cordyceps sinensis China pilose spore from " hundred make " and participate in the set out E.C. 2.7.1.20 of anabolism adenine nucleotide of adenosine, its aminoacid sequence (is designated as punB albumen) as shown in SEQ ID No.1; This enzyme can be prepared adenine nucleotide by catalysis adenosine.

The path that is obtained adenine nucleotide by adenosine anabolism is as follows:

The invention still further relates to described E.C. 2.7.1.20 and prepare the application in adenine nucleotide at biocatalysis adenosine.

The invention still further relates to the encoding gene of above-mentioned E.C. 2.7.1.20, i.e. E.C. 2.7.1.20 gene, its nucleotide sequence (is designated as punB gene) as shown in SEQID No.2.

Described gene can be used for building the genetic engineering bacterium of can biocatalysis adenosine preparing adenine nucleotide, to expand the output of adenine nucleotide or derivatives thereof.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in detail the synthetic adenine nucleotide pathways metabolism of adenosine principle, the cloned DNA that comprises nucleotide sequence provided by the present invention can be used for by transduction, transform, proceeds in engineering bacteria in conjunction with the method shifting, by regulating the expression of adenine nucleotide biosynthesis gene, give the high expression level of host's adenine nucleotide, for the output that expands adenine nucleotide or derivatives thereof provides effective way, there is major application prospect.

(4) accompanying drawing explanation

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is purine metabolism approach annotated map;

Fig. 3 is E.C. 2.7.1.20 gene PCR amplified production gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28b physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/punB physical map;

Fig. 6 is recombinant expression plasmid pET-28b/punB building process schematic diagram;

Fig. 7 is recombinant expression plasmid pET-28b/punB physical map;

Fig. 8 is E.C. 2.7.1.20 protein SDS-PAGE figure.

(5) embodiment

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: first gather natural cordyceps from Qinghai, and taken back Hangzhou and carried out separation screening, obtain L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly disclosing in patent application CN102373190A.

This bacterial classification is inoculated in to inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, prepare afterwards bevel again in following ratio) be glucose 2.0%(w/v, 1% represents to contain 1g in 100mL substratum, Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, magnesium sulfate 0.05%, potassium primary phosphate 0.05%, agar powder 1.0% down together),, surplus is water, cultivates 25 days at 12 ~ 16 ℃; Then bacterial classification is inoculated in to fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, magnesium sulfate 0.01%, potassium primary phosphate 0.02%, surplus is water, be placed on shaking table, 12 ~ 16 ℃ of cultivations of temperature 25 days, under aseptic condition, carry out solid-liquid separation after cultivation finishes, and solid is placed in to aseptic utensil, for subsequent use.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

Extract total RNA with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly add liquid nitrogen to be fully ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mLTRIzol reagent, mix, leave standstill 5min on ice, nucleic acid-protein mixture is separated completely.2) RNA separates: add 0.2mL chloroform, firmly concussion mixes 15s, leaves standstill 2 ~ 3min on ice, 4 ℃, the centrifugal 15min of 12000rpm, and layering, gets upper strata water, approximately 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leave standstill 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm, abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol, will precipitate and hang, leave standstill 10min, 4 ℃, the centrifugal 15min of 7500rpm on ice; Repeat washing step above, then wash one time.5) dissolve RNA: centrifuge tube is placed in and opens wide dry 5 ~ 10min on ice, add appropriate DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

Extract after sample total RNA, use with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer that mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, with the synthetic Article 1 cDNA chain of hexabasic base random primer (random hexamers), then synthetic Article 2 cDNA chain, do end reparation, add polyA and connect sequence measuring joints through QiaQuickPCR test kit purifying and after adding EB buffer solution elution again, then carry out clip size selection with agarose gel electrophoresis, finally carry out pcr amplification, the sequencing library of building up checks order with Illumina GAIIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains adaptor sequence in primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo(Li, Zhu et al.De novo assembly of human genomes with massively parallel short read sequencing[J] .Genome Res, 2010,20:265-272.) transcribe group and from the beginning assemble.First SOAPdenovo is linked to be the reads with certain length overlap the longer Contig fragment that does not contain N.Then reads is compared back to Contig, determine from the distance between different Contig and these Contig of same transcript by paired-end reads, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads to do filling-up hole processing to Scaffold, finally obtain containing N minimum, the Unigene sequence that two ends can not extend again.Finally, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done to blastx and compare (evalue<0.00001), get the best albumen of comparison result and determine the sequence direction of Unigene.If the comparison result between different sink is contradictory, press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al.ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J] .In Proceedings of 9th International Conference on Intelligent Systems for Molecular Biology.AAAIPress, Menlo Park, CA, pp.1999, 138-148.) predict its coding region and determine the direction of sequence.For the Unigene that can determine sequence direction provide its from 5 ' to the sequence of 3 ' direction, provide for the Unigene that cannot determine sequence direction the sequence that composite software obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function annotation, Pathway annotation, COG functional annotation and the Gene Ontology(GO of Unigene) functional annotation.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue<0.00001), obtain thering is the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.Can further obtain the Pathway annotation of Unigene according to KEGG annotation information.Unigene and COG database are compared, and the function that prediction Unigene is possible is also done function statistic of classification to it.According to nr annotation information, use Blast2GO software (Conesa, Gotz et al.Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J] .Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.Obtain after the GO annotation of each Unigene, with WEGO software (Ye, Fang et al.WEGO:a web tool for plotting GO annotations[J] .Nucleic Acids Research, 2006,34:293-297.) all Unigene are done to GO functional classification statistics, be familiar with the gene function distribution characteristics of these species from macroscopic view.

Embodiment 6: " hundred make " produced bacterium Cordyceps sinensis China pilose spore adenine nucleotide pathways metabolism and analyzed

Fig. 2 is the purine metabolism (map00230) in KEGG pathways metabolism annotation, the enzyme having annotated is that " hundred make " that detected produces bacterium Cordyceps sinensis China pilose spore purine metabolism approach relevant enzymes, as can be seen from the figure, detected from 1 Unigene of E.C. 2.7.1.20 of the synthetic adenine nucleotide of adenosine.Detect online by the ORF Finder software in NCBI, found out the open reading frame (SEQ ID No.2) of this gene and obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces the design of bacterium Cordyceps sinensis China pilose spore E.C. 2.7.1.20 gene primer

The gene open reading frame DNA sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, produce the E.C. 2.7.1.20 gene of bacterium China pilose spore anabolism adenine nucleotide for clone's " hundred make ", primer is synthetic by Shanghai Sheng Gong biotechnology company limited, and primer sequence is listed as follows:

PunB gene: forward primer 5 ' ATTGAATTCATGCTGTCTCACTCGCGGTTAG 3 '

Reverse primer 5 ' ATTAAGCTTCTAACATTCGGCGCACGCG 3 '

PunB mrna length is 324bp

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

The method first providing according to embodiment 1 is turned out after sutella sinensis fermented mycelium, the method providing according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain by following after total RNA, for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) in Microtube pipe, prepare following mixed solution.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the annealing of the specificity of reverse transcription primer and template, can improve reverse transcription reaction efficiency, so carry out sex change, annealing reaction on PCR instrument, condition setting is as follows:

65℃，5min

4℃

3) annealing finishes the mixed solution that the rear centrifugal several seconds makes template ribonucleic acid/primer etc. and is gathered in Microtube pipe bottom.

4) in above-mentioned Microtube pipe, prepare following inverse transcription reaction liquid.

5) on PCR instrument, carry out reverse transcription reaction by following condition.

42℃15～30min

70℃15min

4℃

Generalized case, there is a PolyA structure at eukaryote mRNA 3 ' end, the quantity of A base ten to hundreds of not etc., utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, synthetic cDNA the first chain take mRNA as template, the sequence (providing in PrimeScript 1st Strand cDNA Synthesis Kit) in the dT region of being developed alone by TaKaRa is provided in the present invention is primer, if the mRNA integrity obtaining is better, can obtain so cDNA first chain of all zymoprotein encoding genes in species by reverse transcription process.Embodiment 9: " hundred make " produces the detection of clone, expression and the protein vigor of bacterium Cordyceps sinensis China pilose spore anabolism adenine nucleotide functional gene E.C. 2.7.1.20 punB gene

1, the pcr amplification of E.C. 2.7.1.20 punB gene

Take cDNA the first chain of obtaining in embodiment 8 as template, carry out Pfu archaeal dna polymerase pcr amplification reaction with punB gene primer synthetic in embodiment 75 ' ATT GAA TTC ATG CTG TCT CAC TCG CGG TTA G3 ', 5 ' ATT AAG CTT CTA ACA TTC GGC GCA CGC G3 '

2, E.C. 2.7.1.20 punB gene PCR product gel electrophoresis detection

The size of transcribing group order-checking prediction E.C. 2.7.1.20 punB gene is divided into 324bp, and agarose gel electrophoresis result shows successfully to have amplified E.C. 2.7.1.20 punB gene, and actual size is in the same size with prediction, sees Fig. 3.

3, the base A that adds of E.C. 2.7.1.20 punB gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier also need to add base A processing, purifying after glue reclaims after.

4, being connected of E.C. 2.7.1.20 punB gene and cloning vector

E.C. 2.7.1.20 punB gene is connected to construction recombination plasmid pMD18-T/punB with cloning vector, physical map is shown in Fig. 5.

5, the conversion of E.C. 2.7.1.20 recombinant plasmid pMD18-T/punB

Recombinant plasmid pMD18-T/punB is proceeded in intestinal bacteria E.coli JM109 and to build the recombinant bacterium E.coli JM109/pMD18-T/punB that carries respectively E.C. 2.7.1.20 punB gene.

6, the screening of the positive recombinant bacterium of E.C. 2.7.1.20 E.coli JM109/pMD18-T/punB

Single bacterium colony is carried out to bacterium colony PCR, to verify whether proceed to goal gene.Bacterium colony PCR experiment flow: add and contain in the 1.5mL centrifuge tube of 50 μ L sterilized waters with toothpick picking list bacterium colony, boiling water bath 30min, then centrifugal using supernatant as template, carry out pcr amplification, concrete reaction system is as follows, and PCR program setting is Taq enzymatic amplification general procedure.Finally adopt 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of E.C. 2.7.1.20 recombinant plasmid pMD18-T/punB

After the positive recombinant bacterium liquid LB culture medium culturing that bacterium colony PCR is detected is spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is completed by Sani bio tech ltd, Shanghai.

8, the structure of E.C. 2.7.1.20 recombinant expression plasmid pET-28b/punB

Experiment is the principle at expression in escherichia coli according to foreign gene, and expression vector pET-28b and E.C. 2.7.1.20 punB gene restriction enzyme site comparison situation, determine EcoR I and Hind III double enzyme site, and recombination bacillus coli E.coli JM109/pMD18-T/punB has been carried out to the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.

The recombinant plasmid pMD18-T/punB of E.C. 2.7.1.20 punB gene and expression vector pET-28b with EcoR I/Hind III restriction enzyme 37 ℃ respectively enzyme cut process 6h.

Enzyme is cut and is finished rear 65 ℃ of deactivation 15min, then respectively with Axygen DNA gel recovery test kit reclaim, purifying.

E.C. 2.7.1.20 punB gene and expression vector pET-28b spend the night with 16 ℃ of connections of T4 ligase enzyme after double digestion, purifying again, build recombinant expression plasmid pET-28b/punB, its building process is shown in Fig. 6, builds the E.C. 2.7.1.20 recombinant expression plasmid pET-28b/punB collection of illustrative plates obtaining and sees Fig. 7.

9, the conversion of E.C. 2.7.1.20 recombinant expression plasmid pET-28b/punB and the screening of positive monoclonal

Respectively two the E.C. 2.7.1.20 recombinant expression plasmid pET-28b/punB heat shock building is converted in E.coliBL21 Host Strains, is then applied on the LB agar plate that contains kantlex (Kan) resistance 37 ℃ of overnight incubation.Random choose list bacterium colony from flat board, carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of E.C. 2.7.1.20 recombinant bacterium E.coli BL21/pET-28b/punB

Be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance 37 ℃, 250r/min overnight incubation by being accredited as positive mono-clonal.Get 1mL culture, in the LB liquid nutrient medium that contains Kan resistance in 50mL of being transferred, 37 ℃, 250r/min are cultured to cell concentration OD600 and are about 0.6～0.8 left and right.In culture, add respectively certain density IPTG inducing culture 8h.Collecting thalline surveys for electrophoretic analysis and enzyme biopsy.

11, E.C. 2.7.1.20 recombinant bacterium E.coli BL21/pET-28b/punB expression product SDS-PAGE analyzes

With the recombinant bacterium that proceeds to the E.coli BL21 bacterium of empty carrier and do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium after IPTG inducing culture certain hour, get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in 50 μ L distilled water, add 50 μ L sample-loading buffers, after mixing, boil 10min, carry out SDS-PAGE electrophoretic analysis, Fig. 8 is the SDS-PAGE figure of the E.C. 2.7.1.20 albumen punB of recombinant bacterium E.coli BL21/pET-28b/punB expression.

12, the protein-active of E.C. 2.7.1.20 recombinant bacterium E.coli BL21/pET-28b/punB detects

Enzyme liquid preparation: take E.C. 2.7.1.20 recombinant bacterium E.coli BL21/pET-28b/punB phosphate buffered saline buffer (50mM, pH7.0) 15mL suspension for 0.5g of collection, ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min).

E.C. 2.7.1.20 punB transformation system: transform in bottle and add BL21/pET-28b/punB ultrasonication liquid 10mL, 1% adenosine, 1%ATP, 2.5mM MgCl at 50mL ₂, 30 ℃, 150r/min conversion, after conversion finishes, centrifuging and taking supernatant is standby with subsequent detection.

Detection method: reversed-phase high-performance liquid chromatography detection by quantitative adenine nucleotide.Condition: chromatographic column, μ BondapakC ₁₈10 μ m, 125A, 4.6 × 300mm; Moving phase: water, glacial acetic acid, TBAH and methyl alcohol mix with certain proportion, carries out suction filtration with 0.45 μ m organic phase film before using, and ultrasonic degassing 5min; Detect wavelength 254nm; Sampling volume 10 μ L.Prepare respectively the gradient mass concentration of adenine nucleotide standard model 1-10000 μ g/mL, drawing standard curve.

After conversion finishes, by conversion fluid, in the centrifugal 25min of 14000rpm, with 0.45 μ m filtering with microporous membrane, filtrate is for reversed phase ion pair chromatography analysis.Finally recording adenine nucleotide yield is 65%.

Claims (5)

1. from the E.C. 2.7.1.20 of the participation adenosine anabolism adenine nucleotide of Cordyceps sinensis China pilose spore, its aminoacid sequence is as shown in SEQ ID No.1.

2. E.C. 2.7.1.20 as claimed in claim 1 is prepared the application in adenine nucleotide at biocatalysis adenosine.

3. the gene of E.C. 2.7.1.20 described in coding claim 1.

4. gene as claimed in claim 3, is characterized in that the nucleotide sequence of described gene is as shown in SEQ ID No.2.

5. the gene as described in claim 3 or 4 is in the application building in the genetic engineering bacterium of can biocatalysis adenosine preparing adenine nucleotide.

Images