CN103031287B - Cordyceps Chinese Hirsutella nucleoside diphosphokinase, coding gene and application thereof - Google Patents

Abstract

The invention relates to an enzyme from Bailing production bacterium Cordyceps Chinese Hirsutella for synthesizing metabolic (desoxy) pyrimidine nucleoside triphosphate from (desoxy) pyrimidine nucleoside diphosphate, a gene for coding the enzyme and application thereof. The enzyme is nucleoside diphosphokinase which has more than 90% of homology with amino acid sequence disclosed as SEQ ID NO.1; and the coding gene has more than 90% of homology with nucleotide sequence disclosed as SEQ ID NO.2. The invention researches the metabolic pathway of (desoxy) pyrimidine nucleoside diphosphate synthesized (desoxy) pyrimidine nucleoside triphosphate in details in principle. The cloned DNA (deoxyribonucleic acid) comprising the nucleotide sequence provided by the invention can be transformed into engineering bacterium by transduction, conversion and conjugal transfer. By adjusting the expression of the (desoxy) pyrimidine nucleoside triphosphate biosynthesized gene, the host (desoxy) pyrimidine nucleoside triphosphate is endowed with high expressivity, thereby providing an effective way for enhancing the yield of the (desoxy) pyrimidine nucleoside triphosphate and having great application prospects.

Description

Cordyceps sinensis China pilose spore Uridine diphosphate kinase, encoding gene and application thereof

(1) technical field

The present invention relates to the set out Uridine diphosphate kinase (nucleoside-diphosphate kinase) of anabolism triphosphoric acid (deoxidation) pyrimidine nucleoside of participation bisphosphate (deoxidation) pyrimidine nucleoside of producing bacterium Cordyceps sinensis China pilose spore from " hundred make ", the gene of this enzyme of encoding and application thereof.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma and the complex body on larva corpse (comprising stroma and polypide) on lepidopteran (Lepidoptera) Hepialidae insect (Hepialus armoricanus Oberthur) larva.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various feature of meta-bolites and biological activity, at biomedicine field, shows huge application and development prospect.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern, worldwide enjoys high praise.The traditional Chinese medical science thinks, Cordyceps sinensis enters lung kidney two warps, can tonifying lung cloudy, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough phlegm blood, spontaneous sweatings etc., are unique a kind of balance simultaneously, the Chinese medicine that regulates negative and positive.Modern pharmacology confirms, and Cordyceps sinensis has the biological activity widely such as immunomodulatory, antibacterial, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual productions such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the evaluation of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph confirmation, activeconstituents compartment analysis and the mechanism of action, Application and Development.Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, therefore its output is very low, price is high.Wild cordyceps is because factors such as being subject to growing environment restricts, scarcity of resources.Owing to making little progress on artificial culture in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation is produced Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, and not climate, geographical environment and the strict restriction of Chinese caterpillar fungus parasitic conditions is again suitable for large-scale industrialization and produces.The substitute of producing is as also similar to natural cs with drug effect in its composition of mycelium, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, proof is basically identical with natural cs chemical constitution, pharmacological action, can replace natural cs to produce cordyceps product, to make up the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites is all significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, to progressively turning to deeper functional meta-bolites to study by the direct utilization of Chinese caterpillar fungus raw material or crude extract in worm grass product research and development.Chinese caterpillar fungus meta-bolites has been done to a large amount of research both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the research of the representative functional meta-bolites such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL at aspects such as biosynthesizing, pharmacological actions wins initial success.

Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein miazines nucleosides comprises cytidine(C and uridine.Uridine (uracil riboside) claim again uridine (uIidine), and another name is by snow riboside, dihydro-pyrimidin nucleosides, the 1-β-D-ribosyl uridylic of muttering.Cytidine(C (cytosine riboside) has another name called cytidine (cytidine), cytidine, 1-β-D-furans nucleosides cytosine(Cyt).Pyrimidine nucleoside is multiduty nucleosides, can be used as the additive of healthcare products and food.It also becomes the requisite of people's life gradually as beauty treatment and anti-ultraviolet radiation makeup, as medicine, clinical application is in nervus centralis, uropoiesis, metabolism and many-sided disease such as cardiovascular, in the U.S., nucleic acid medicine has shown irreplaceable effect at antiviral, anti-tumor aspect in recent years.

Due to the important physiological action of pyrimidine nucleoside and analogue thereof, related microorganism is produced the existing a lot of research of miazines nucleosides both at home and abroad.Yet as the Cordyceps fungus of important anabolism miazines nucleosides, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in Cordyceps fungus miazines nucleosides metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is for the deficiency of above existence and the technical issues that need to address, " hundred make " produced to enzyme and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore anabolism triphosphoric acid (deoxidation) pyrimidine nucleoside and further investigate, the enzyme, encoding gene and the application thereof that provide " hundred make " production bacterium Cordyceps sinensis China pilose spore participation bisphosphate (deoxidation) pyrimidine nucleoside to set out anabolism triphosphoric acid (deoxidation) pyrimidine nucleoside.

The technical solution used in the present invention is:

The present invention relates to a kind ofly from " hundred make ", produce bacterium Cordyceps sinensis China pilose spore and participate in the set out Uridine diphosphate kinase of anabolism triphosphoric acid (deoxidation) pyrimidine nucleoside of bisphosphate (deoxidation) pyrimidine nucleoside, described enzyme has the above homology of aminoacid sequence 90% shown in SEQ ID No.1, and preferably its aminoacid sequence (is designated as pynH albumen) as shown in SEQ ID No.1; This enzyme can be prepared triphosphoric acid (deoxidation) pyrimidine nucleoside by catalysis bisphosphate (deoxidation) pyrimidine nucleoside.Singularity due to aminoacid sequence; any fragment that contains the peptide protein of aminoacid sequence shown in SEQ ID No.1 or its variant; as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology, more than 90%, all belong to the row of protection domain of the present invention.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in aminoacid sequence; Wherein, for the conservative property change of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replaced Isoleucine with leucine, variant also can have non-conservation and change, as replaced glycine with tryptophane.

Uridine diphosphate kinase biocatalysis bisphosphate of the present invention (deoxidation) pyrimidine nucleoside is prepared triphosphoric acid (deoxidation) pyrimidine nucleoside, and reaction equation is:

The invention still further relates to described enzyme and prepare the application in triphosphoric acid (deoxidation) pyrimidine nucleoside at biocatalysis bisphosphate (deoxidation) pyrimidine nucleoside.

Further, described is applied as: the wet thallus that obtains containing the Cordyceps sinensis China pilose spore Uridine diphosphate kinase thalline fermentation culture broken mixed solution after cytoclasis of take is catalyzer, take bisphosphate pyrimidine nucleoside as substrate, in the transformation system that the buffered soln that is 6.5 ~ 8.5 in pH forms, conversion reaction 2 ~ 3h under 30 ℃, 150rpm condition, after reaction finishes, by reacting liquid filtering, get filtrate and be the crude product containing triphosphoric acid pyrimidine nucleoside, described crude product separation and purification obtains triphosphoric acid pyrimidine nucleoside.

Further, the starting point concentration of described substrate is 10g/L, and the volumetric usage of described catalyzer is 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

The preparation method of described catalyzer is: Cordyceps sinensis China pilose spore Uridine diphosphate kinase recombinant bacterium E. coli BL21/pET-28a/pynH is inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (50mg/L) to 37 ℃, 250r/min overnight incubation.Get 1mL culture, transferred in the fresh LB liquid nutrient medium that contains Kan resistance of 50mL 37 ℃, 250r/min are cultured to cell concentration OD600 and are about 0.6～0.8 left and right, to the IPTG inducing culture 8h that adds finite concentration (240mg/ml) in culture, getting inducing culture liquid filters, collect wet thallus, take wet thallus phosphate buffered saline buffer (50mM, pH8.0) 15mL suspension for 0.5g of collection, the thalline mixed solution obtaining after ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min) is as catalysis enzyme.

The invention still further relates to the encoding gene of above-mentioned enzyme, i.e. Uridine diphosphate kinase gene, described gene has the above homology of nucleotide sequence 90% shown in SEQ ID No.2, and preferably its nucleotide sequence (is designated as pynH gene) as shown in SEQ ID No.2.Due to the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO:2, as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide changes that has.The variant of these polynucleotide can make raw displacement varient or the varient of non-life, comprises and replaces varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from not changing in fact the function of the peptide protein of its coding.

Described gene can be used for building the genetic engineering bacterium of can biocatalysis bisphosphate (deoxidation) pyrimidine nucleoside preparing triphosphoric acid (deoxidation) pyrimidine nucleoside, to expand the output of triphosphoric acid (deoxidation) pyrimidine nucleoside or derivatives thereof.

Further, described is applied as: build the recombinant vectors that contains described Cordyceps sinensis China pilose spore Uridine diphosphate kinase gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtaining carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells that contains Cordyceps sinensis China pilose spore Uridine diphosphate kinase.

The enzyme work of Uridine diphosphate kinase of the present invention is defined as: under optimum condition (30 ℃), can transform the enzyme amount of 1 micromole's bisphosphate (deoxidation) pyrimidine nucleoside in 1 minute.

The bacterial strain that Cordyceps sinensis China pilose spore Uridine diphosphate kinase of the present invention and encoding gene thereof can be provided is China pilose spore (Hirsutella Sinensis) L0106, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, in the patent CN102373190A of previously application, discloses.

Main points of the present invention have been to provide the nucleotide sequence shown in the aminoacid sequence shown in SEQ ID NO:1 and SEQ ID NO:2, the in the situation that of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, be all apparent to those skilled in the art.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in detail synthetic triphosphoric acid (deoxidation) the pyrimidine nucleoside pathways metabolism of bisphosphate (deoxidation) pyrimidine nucleoside principle, the cloned DNA that comprises nucleotide sequence provided by the present invention can be used for by transduction, transform, in conjunction with the method shifting, proceed in engineering bacteria, by regulating the expression of triphosphoric acid (deoxidation) pyrimidine nucleoside biosynthesis gene, give the high expression level of host's triphosphoric acid (deoxidation) pyrimidine nucleoside, for expanding the output of triphosphoric acid (deoxidation) pyrimidine nucleoside or derivatives thereof, provide effective way, there is major application prospect.

(4) accompanying drawing explanation

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is pyrimidine metabolic approach annotated map;

Fig. 3 is Uridine diphosphate kinase gene PCR amplified production gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/pynH physical map;

Fig. 6 is recombinant expression plasmid pET-28a/pynH building process schematic diagram;

Fig. 7 is recombinant expression plasmid pET-28a/pynH physical map;

Fig. 8 is Uridine diphosphate kinase protein SDS-PAGE figure.

(5) embodiment

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: first gather natural cordyceps from Qinghai, and taken back Hangzhou and carried out separation screening, obtained L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, in the patent CN102373190A of previously application, discloses.

This bacterial classification is inoculated in to inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, in following ratio, prepare afterwards bevel again) be glucose 2.0%(w/v, 1% represents to contain 1g in 100mL substratum, Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, magnesium sulfate 0.05%, potassium primary phosphate 0.05%, agar powder 1.0% down together),, surplus is water, at 12 ~ 16 ℃, cultivates 25 days; Then bacterial classification is inoculated in to fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, magnesium sulfate 0.01%, potassium primary phosphate 0.02%, surplus is water, be placed on shaking table, 12 ~ 16 ℃ of cultivations of temperature 25 days, under aseptic condition, carry out solid-liquid separation after cultivation finishes, and solid is placed in to aseptic utensil, standby.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

With TRIzol reagent, extract total RNA, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly add liquid nitrogen to be fully ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mix, standing 5min, makes nucleic acid-protein mixture completely separated on ice.2) RNA is separated: add 0.2mL chloroform, firmly concussion mixes 15s, standing 2 ~ 3min on ice, and 4 ℃, the centrifugal 15min of 12000rpm, layering, gets upper strata water, approximately 600 μ L.3) RNA precipitation: add 500 μ L Virahols, at standing 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm, abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol, will precipitate and hang, standing 10min on ice, 4 ℃, the centrifugal 15min of 7500rpm; Repeat washing step above, then wash one time.5) dissolve RNA: centrifuge tube is placed in and opens wide dry 5 ~ 10min on ice, add appropriate DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

Extract after the total RNA of sample, use with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer that mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, with the synthetic article one cDNA chain of hexabasic base random primer (random hexamers), then synthesize second cDNA chain, through QiaQuick PCR test kit purifying and after adding EB buffer solution elution, do end reparation, add polyA and connect sequence measuring joints again, then with agarose gel electrophoresis, carry out clip size selection, finally carry out pcr amplification, the sequencing library of building up checks order with Illumina GA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains adaptor sequence in primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo(Li, Zhu et al. De novo assembly of human genomes with massively parallel short read sequencing [J]. Genome Res, 2010,20:265-272.) transcribe group and from the beginning assemble.First SOAPdenovo is linked to be the reads with certain length overlap longer not containing the Contig fragment of N.Then reads is compared back to Contig, by paired-end reads, determine from the different Contig of same transcript and the distance between these Contig, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads to do filling-up hole to Scaffold and process, finally obtain containing N minimum, the Unigene sequence that two ends can not extend again.Finally, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done to blastx and compare (evalue<0.00001), get the sequence direction that the best albumen of comparison result is determined Unigene.If the comparison result between different sink is contradictory, press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al. ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J]. In Proceedings of 9th InternationalConference on Intelligent Systems for Molecular Biology. AAAIPress, Menlo Park, CA, pp. 1999, 138-148.) predict the direction of its coding region definite sequence.For the Unigene that can determine sequence direction, provide its sequence from 5' to 3' direction, for the Unigene that cannot determine sequence direction, provide the sequence that composite software obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function annotation, Pathway annotation, COG functional annotation and the Gene Ontology(GO of Unigene) functional annotation.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue<0.00001), obtain thering is the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.According to KEGG annotation information, can further obtain the Pathway annotation of Unigene.Unigene and COG database are compared, and the function that prediction Unigene is possible is also done function statistic of classification to it.According to nr annotation information, use Blast2GO software (Conesa, Gotz et al. Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J]. Bioinformatics, 2005,21 (18): the GO annotation information that 3674-3676.) obtains Unigene.Obtain after the GO annotation of each Unigene, with WEGO software (Ye, Fang et al. WEGO:a web tool for plotting GO annotations[J]. Nucleic Acids Research, 2006,34:293-297.) all Unigene are done to GO functional classification statistics, from macroscopic view, be familiar with the gene function distribution characteristics of these species.

Embodiment 6: " hundred make " produced bacterium Cordyceps sinensis China pilose spore triphosphoric acid (deoxidation) pyrimidine nucleoside pathways metabolism and analyzed

Fig. 2 is the pyrimidine metabolic (map00240) in KEGG pathways metabolism annotation, the enzyme having annotated is that " hundred make " that detected produces bacterium Cordyceps sinensis China pilose spore pyrimidine metabolic approach relevant enzymes, as can be seen from the figure, 1 Unigene of Uridine diphosphate kinase from the synthetic triphosphoric acid of bisphosphate (deoxidation) pyrimidine nucleoside (deoxidation) pyrimidine nucleoside detected.By the ORF Finder software in NCBI, detect online, found out the open reading frame (SEQ ID No.2) of this gene and obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces the design of bacterium Cordyceps sinensis China pilose spore Uridine diphosphate kinase gene primer

The gene open reading frame DNA sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, for clone's " hundred make ", produce the Uridine diphosphate kinase gene of bacterium China pilose spore anabolism triphosphoric acid (deoxidation) pyrimidine nucleoside, primer is synthetic by Shanghai Sheng Gong biotechnology company limited, and primer sequence is listed as follows:

PynH gene: forward primer 5 ' ATAGAATTCATGTGCTCCTTGGAGGGGTGG 3 '

Reverse primer 5 ' AGCAAGCTTTCACTCCCAATTCAAACTCGC 3 '

PynH mrna length is 216bp

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

The method first providing according to embodiment 1 is turned out after sutella sinensis fermented mycelium, the method providing according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain by following, being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain after total RNA, for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) in Microtube pipe, prepare following mixed solution.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the annealing of the specificity of reverse transcription primer and template, can improve reverse transcription reaction efficiency, so carry out sex change, annealing reaction on PCR instrument, condition setting is as follows:

65℃，5 min

3) annealing finishes the mixed solution that the rear centrifugal several seconds makes template ribonucleic acid/primer etc. and is gathered in Microtube pipe bottom.

4) in above-mentioned Microtube pipe, prepare following inverse transcription reaction liquid.

5) on PCR instrument, by following condition, carry out reverse transcription reaction.

42℃ 15～30 min

70℃ 15 min

Generalized case, at eukaryote mRNA 3 ' end, there is a PolyA structure, the quantity of A base ten to hundreds of not etc., utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, take mRNA as synthetic cDNA the first chain of template, the sequence (providing in PrimeScript 1st Strand cDNA Synthesis Kit) in the dT region of being developed alone by TaKaRa is provided in the present invention is primer, if the mRNA integrity obtaining is better, by reverse transcription process, can obtain so cDNA first chain of all zymoprotein encoding genes in species.

Embodiment 9: " hundred make " produces the detection of clone, expression and the protein vigor of bacterium Cordyceps sinensis China pilose spore anabolism triphosphoric acid (deoxidation) pyrimidine nucleoside functional gene Uridine diphosphate kinase pynH gene

1, the pcr amplification of Uridine diphosphate kinase pynH gene

CDNA the first chain obtaining in embodiment 8 of take is template, with pynH gene primer synthetic in embodiment 7: 5 ' ATA GAA TTC ATG TGC TCC TTG GAG GGG TGG 3 ', 5 ' AGC AAG CTT TCA CTC CCA ATT CAA ACT CGC 3 ' carry out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2, Uridine diphosphate kinase pynH gene PCR product gel electrophoresis detection

Concrete detection method is: 1) with microwave-oven-heating, it is uniformly dissolved 0.9% the sepharose preparing; 2) get 15mL gel, when gel is cooled to 50 ℃ of left and right, add 1 μ L staining fluid Gold view, after mixing, pour on treatments of Electrophoretic Slab Gels, remove and insert point sample comb after bubble; 3) after gel solidifies, carefully take out point sample comb, offset plate is put into electrophoresis chamber (one end, point sample hole is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add TAE electrophoretic buffer; 4) get 5 μ L samples and then add 6 * Loading Buffer, 1.5 μ L and ddH ₂after O 4 μ L mix, using liquid-transfering gun loading, applied sample amount is 10 μ L; 5) connect the supply lead between electrophoresis chamber and electrophoresis apparatus, just very red, negative pole is black; 6) power-on, starts electrophoresis, and maximum voltage is no more than 5 V/cm; 7) when sample ran offset plate 2/3 time can stop electrophoresis; 8), after cutting off the electricity supply, gel taken out and put into the observation of gel imaging instrument, take pictures.

The size of transcribing group order-checking prediction Uridine diphosphate kinase pynH gene is 216bp, and agarose gel electrophoresis result (Fig. 3) shows successfully to have amplified Uridine diphosphate kinase pynH gene.

3, the base A that adds of Uridine diphosphate kinase pynH gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier also need to add base A processing, purifying after glue reclaims after.It is as follows that glue recovery product adds base A system:

In PCR instrument, 72 ℃ add A base 20 min, finally with AxyPrep PCR cleaning agents box, purify.

4, Uridine diphosphate kinase pynH gene and cloning vector is connected

Cloning vector pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), its physical map is shown in Fig. 4, Uridine diphosphate kinase pynH gene is connected to construction recombination plasmid pMD18-T/pynH with cloning vector, physical map is shown in Fig. 5, and linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 ℃, 16h; Deactivation: 65 ℃, 15min.

5, the conversion of Uridine diphosphate kinase recombinant plasmid pMD18-T/pynH

Recombinant plasmid pMD18-T/pynH is proceeded in intestinal bacteria E. coli JM109 and to build the recombinant bacterium E. coli JM109/pMD18-T/pynH that carries Uridine diphosphate kinase pynH gene.Concrete steps are: 1) 10 μ L reaction systems are gone in competent cell E. coli JM109 to ice bath 30min; 2) thermal shock: 42 ℃, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 ℃, 250rpm, 1h; 5) spread plate (containing Amp resistance); 6) 37 ℃ of incubator overnight incubation.

6, the screening of the positive recombinant bacterium of Uridine diphosphate kinase E. coli JM109/pMD18-T/pynH

Bacterium colony PCR can extract genomic dna, and directly take the DNA that exposes after thalline pyrolysis, carries out pcr amplification as template, and whether the method is easy and simple to handle, quick, can Rapid identification bacterium colony be the positive bacterium colony that contains object plasmid.First bacterium colony, adds containing in the 1.5mL centrifuge tube of 50 μ L sterilized waters with toothpick picking list bacterium colony, and boiling water bath 30min is then centrifugally usingd supernatant as template, carries out pcr amplification, and PCR program setting is Taq enzymatic amplification general procedure.Finally adopt 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of Uridine diphosphate kinase recombinant plasmid pMD18-T/pynH

After the detected positive recombinant bacterium liquid LB culture medium culturing of bacterium colony PCR is spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is completed by Sani bio tech ltd, Shanghai.Through sequence verification, sequence SEQ ID No.2 recombinates to pMD18-T/pynH.

8, the structure of Uridine diphosphate kinase recombinant expression plasmid pET-28a/pynH

Experimental basis foreign gene is in the principle of expression in escherichia coli, and expression vector pET-28a and Uridine diphosphate kinase pynH gene restriction enzyme site comparison situation, determined EcoR I and Hind III double enzyme site, and recombination bacillus coli E. coli JM109/pMD18-T/pynH has been carried out to the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.

The recombinant plasmid pMD18-T/pynH of Uridine diphosphate kinase pynH gene and expression vector pET-28a with EcoR I/Hind III restriction enzyme 37 ℃ respectively enzyme cut and process 6h, it is as follows that enzyme is cut system:

EcoR I/Hind III double digestion system:

Enzyme is cut and is finished rear 65 ℃ of deactivation 15min, then respectively with Axygen DNA gel recovery test kit reclaim, purifying.

Uridine diphosphate kinase pynH gene and expression vector pET-28a spend the night with 16 ℃ of connections of T4 ligase enzyme after double digestion, purifying again, build recombinant expression plasmid pET-28a/pynH, its building process is shown in Fig. 6, builds the recombinant expression plasmid pET-28a/pynH collection of illustrative plates obtaining and sees Fig. 7.Linked system is composed as follows:

Linked system:

9, the conversion of Uridine diphosphate kinase recombinant expression plasmid pET-28a/pynH and the screening of positive monoclonal

The expression plasmid heat shock building is converted in E. coli BL21 Host Strains, is then applied on the LB agar plate that contains kantlex (Kan) resistance (50mg/L) 37 ℃ of overnight incubation.Random choose list bacterium colony from flat board, carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of Uridine diphosphate kinase recombinant bacterium E. coli BL21/pET-28a/pynH

By being accredited as positive mono-clonal, be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (50mg/L) 37 ℃, 250r/min overnight incubation.Get 1mL culture, in the LB liquid nutrient medium that contains Kan resistance in 50mL of being transferred, 37 ℃, 250r/min are cultured to cell concentration OD600 and are about 0.6～0.8 left and right.To the IPTG inducing culture 8h that adds respectively finite concentration (240mg/L) in culture.Collecting thalline surveys for electrophoretic analysis and enzyme biopsy.

11, Uridine diphosphate kinase recombinant bacterium E. coli BL21/pET-28a/pynH expression product SDS-PAGE analyzes

With the recombinant bacterium that proceeds to the E. coli BL21 bacterium of empty carrier and do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium after IPTG inducing culture certain hour (8h), get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in 50 μ L distilled water, add 50 μ L sample-loading buffers, after mixing, boil 10min, carry out SDS-PAGE electrophoretic analysis, it is shown in SEQ ID No.1 through its aminoacid sequence of sequence verification that " C " swimming lane in Fig. 8 is the Uridine diphosphate kinase albumen pynH(that recombinant bacterium E. coli BL21/pET-28a/pynH expresses) SDS-PAGE figure.

12, the protein-active of Uridine diphosphate kinase recombinant bacterium E. coli BL21/pET-28a/pynH detects

Enzyme liquid preparation: the recombinant bacterium E. coli BL21/pET-28a/pynH wet thallus 0.5g(dry weight 0.1g that takes collection) use respectively phosphate buffered saline buffer (50mM, pH8.0) 15mL to suspend, ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min) is as catalysis enzyme.

Uridine diphosphate kinase pynH transformation system: transform in bottle and add E. coli BL21/pET-28a/pynH ultrasonication thalline 10mL, 0.1g uridine diphosphate (UDP) or 0.1g cytidine diphosphate (CDP) or 0.1g bisphosphate deoxyuridine or 0.1g dCDP or 0.1g thymine deoxyriboside diphosphate, dTDP at 50mL, 30 ℃, 150r/min transform 2 ~ 3h, after conversion finishes, centrifugal respectively, get respectively supernatant standby with subsequent detection.

Detection method: high performance liquid chromatography detection by quantitative pyrimidine nucleoside.Pre-treatment: after conversion fluid is centrifugal, supernatant liquor is crossed 0.22 μ m microporous membrane and detected for high performance liquid chromatography.Condition: chromatographic column: Agilent C18 post (4.6mm * 250mm i.d.5 μ m); Column temperature: 35 ℃; Sampling volume: 20 μ L; Flow velocity 1mL/min; Detect wavelength 260nm; Moving phase: A: ultrapure water; B: methyl alcohol.Gradient elution: 0min, 15%B, keeps 3min; 3.0-3.5min, 15-24%B; 3.5min, 24% keeps 5min; 8.5-9.0min, 24-35%B; 35%B keeps 6min; 15.0-16.0min, 35-85%B; 85%B keeps 6min; 22.0-22.5min, 85%-15%B; 15%B keeps 5min.

The making of typical curve: accurately take each ucleosides standard substance (uridine triphosphate, cytidine, Deoxycytidine triphosphate, dCTP, dTTP), about 1.00mg-2.00mg, ultrapure water constant volume.Each standard substance preparation 6 gradients (1 μ g/mL, 30 μ g/mL, 60 μ g/mL, 90 μ g/mL, 120 μ g/mL, 150 μ g/mL).Then loading successively, each concentration repeats for 5 times.After the reference liquid of getting certain volume maximum concentration mixes, constant volume, then HPLC analyzes the optimal conditions that pyrimidine nucleoside detects.

Through above-mentioned chromatographic condition, detect and calculate, we draw to draw a conclusion: the high specific enzyme (Specific Activity) alive of the Uridine diphosphate kinase that Uridine diphosphate kinase recombinant bacterium E. coli BL21/pET-28a/pynH is expressed is that ratio enzyme maximum in 400mol/min/mg(uridine diphosphate (UDP), cytidine diphosphate (CDP), bisphosphate deoxyuridine, dCDP and thymine deoxyriboside diphosphate, dTDP is lived), substrate conversion efficiency is respectively 87%, 75%, 80%, 84% and 79%.

SEQUENCE LISTING

<110> Zhejiang Polytechnical University, Zhongmei Huadong Pharmaceutical Co., Ltd. Hangzhou

<120> Cordyceps sinensis China pilose spore Uridine diphosphate kinase, encoding gene and application thereof

<130>

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 80

<212> PRT

<213> Hirsutella Sinensis

<400> 1

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg

20 25 30

Gly Ser Glu Phe Val Asp Glu Asn Gly Gly Val Ala Ala Met Thr Pro

35 40 45

Gly Ala Gly Ala Pro Asp Gly Tyr Val Pro Lys Thr Lys Val Leu Ala

50 55 60

Gly Glu Asp Ala Glu Met Lys Glu Glu Val Glu Glu Asn Gly Ala Gln

65 70 75 80

<210> 2

<211> 243

<212> DNA

<213> Hirsutella Sinensis

<400> 2

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atggctagca tgactggtgg acagcaaatg ggtcgcggat ccgaattcgt cgacgaaaat 120

ggcggcgtcg ccgccatgac gccgggggcc ggtgcgccgg atggctacgt gcccaagaca 180

aaggtcttgg ccggcgagga tgcggagatg aaggaggagg ttgaggagaa cggagcgcag 240

tga 243

Claims (8)

1. a Cordyceps sinensis China pilose spore Uridine diphosphate kinase, the aminoacid sequence that it is characterized in that described enzyme is shown in SEQ ID No.1.

2. Cordyceps sinensis China pilose spore Uridine diphosphate kinase is prepared the application in triphosphoric acid pyrimidine nucleoside at biocatalysis bisphosphate pyrimidine nucleoside as claimed in claim 1.

3. application as claimed in claim 2, is characterized in that described being applied as: with Cordyceps sinensis China pilose spore Uridine diphosphate kinase recombinant bacterium e.colithe broken mixed solution of the wet thallus that BL21/pET-28a/pynH fermentation culture obtains after cytoclasis is catalyzer, take bisphosphate pyrimidine nucleoside as substrate, in the transformation system that the buffered soln that is 6.5～8.5 in pH forms, conversion reaction 2～3h under 30 ℃, 150rpm condition, after reaction finishes, by reacting liquid filtering, to get filtrate and be the crude product containing triphosphoric acid pyrimidine nucleoside, described crude product separation and purification obtains triphosphoric acid pyrimidine nucleoside; Described Cordyceps sinensis China pilose spore Uridine diphosphate kinase recombinant bacterium e.colithe construction process of BL21/pET-28a/pynH is: Cordyceps sinensis China pilose spore Uridine diphosphate kinase gene pynH is building up in expression plasmid pET-28a, obtains recombinant expression plasmid pET-28a/pynH, then recombinant expression plasmid is transformed to intestinal bacteria e.colibL21, obtains Cordyceps sinensis China pilose spore Uridine diphosphate kinase recombinant bacterium e.colibL21/pET-28a/pynH, the nucleotides sequence of described Cordyceps sinensis China pilose spore Uridine diphosphate kinase gene pynH is classified as shown in SEQ ID No.2.

4. application as claimed in claim 3, the starting point concentration that it is characterized in that described substrate is 10g/L, the volumetric usage of described catalyzer is 100mL/g substrate, in described catalyzer cell concentration take broken before the amount metering of dry mycelium be 6.7mg/mL.

5. the gene of enzyme described in the claim 1 of encoding.

6. gene as claimed in claim 5, is characterized in that the nucleotides sequence of described gene is classified as shown in SEQ ID No.2.

7. the application of gene in building the genetic engineering bacterium of can biocatalysis bisphosphate pyrimidine nucleoside preparing triphosphoric acid pyrimidine nucleoside as described in one of claim 5～6.

8. application as claimed in claim 7, it is characterized in that described being applied as: build the recombinant vectors that contains described Cordyceps sinensis China pilose spore Uridine diphosphate kinase gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtaining carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells that contains Cordyceps sinensis China pilose spore Uridine diphosphate kinase.