CN103031285B - Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof - Google Patents

Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof Download PDF

Info

Publication number
CN103031285B
CN103031285B CN201210535124.0A CN201210535124A CN103031285B CN 103031285 B CN103031285 B CN 103031285B CN 201210535124 A CN201210535124 A CN 201210535124A CN 103031285 B CN103031285 B CN 103031285B
Authority
CN
China
Prior art keywords
uridine
gene
cytidine
pyrimidine
cordyceps sinensis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201210535124.0A
Other languages
Chinese (zh)
Other versions
CN103031285A (en
Inventor
郑裕国
柳志强
吴晖
李邦良
吴玲芳
许静
许峰
薛亚平
袁水金
王鸿艳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Hangzhou Zhongmei Huadong Pharmaceutical Co Ltd
Original Assignee
Zhejiang University of Technology ZJUT
Hangzhou Zhongmei Huadong Pharmaceutical Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT, Hangzhou Zhongmei Huadong Pharmaceutical Co Ltd filed Critical Zhejiang University of Technology ZJUT
Priority to CN201210535124.0A priority Critical patent/CN103031285B/en
Publication of CN103031285A publication Critical patent/CN103031285A/en
Application granted granted Critical
Publication of CN103031285B publication Critical patent/CN103031285B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/52Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to an enzyme from Bailing production bacterium Cordyceps Chinese Hirsutella for synthesizing metabolic pyrimidine nucleotide from pyrimidine nucleoside, a gene for coding the enzyme and application thereof. The enzyme is uridine-cytidine kinase which has more than 90% of homology with amino acid sequence disclosed as SEQ ID NO.1; and the coding gene has more than 90% of homology with nucleotide sequence disclosed as SEQ ID NO.2. The invention researches the metabolic pathway of pyrimidine nucleoside synthesized pyrimidine nucleotide in details in principle. The cloned DNA (deoxyribonucleic acid) comprising the nucleotide sequence provided by the invention can be transformed into engineering bacterium by transduction, conversion and conjugal transfer. By adjusting the expression of the pyrimidine nucleotide biosynthesized gene, the host pyrimidine nucleotide is endowed with high expressivity, thereby providing an effective way for enhancing the yield of the pyrimidine nucleotide and having great application prospects.

Description

Cordyceps sinensis China pilose spore uridine-cytidine kinases, encoding gene and application thereof
(1) technical field
The present invention relates to a participation pyrimidine nucleoside producing bacterium Cordyceps sinensis China pilose spore from " hundred make " to set out the uridine-cytidine kinases (uridine-cytidine kinase) of anabolism pyrimidine nucleotide, the gene of this enzyme of encoding and application thereof.
(2) background technology
Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in the stroma on lepidopteran (Lepidoptera) Hepialidae insect (Hepialus armoricanus Oberthur) larva and the complex body (comprising stroma and polypide) on larva corpse.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the feature of meta-bolites and diverse biological activities, shows huge application and development prospect at biomedicine field.Cordyceps sinensis extensively, obviously receives much concern with its multiple medicinal efficacy, worldwide enjoys high praise.The traditional Chinese medical science is thought, Cordyceps sinensis enters lung kidney two warp, can tonifying lung cloudy, again can kidney-replenishing, cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, and phthisical cough phlegm blood, spontaneous sweating etc. are unique a kind of Chinese medicine that can balance simultaneously, regulate negative and positive.Modern pharmacology confirms, and Cordyceps sinensis has the biological activity widely such as immunomodulatory, antibacterial, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.
Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And in the actual production such as artificial culture, liquid fermenting, use the Cordyceps fungus in imperfect stage, thus the qualification of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is done a lot of work in Cordyceps Resources investigation, anamorph confirmation, activeconstituents compartment analysis and the mechanism of action, Application and Development.Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.
Natural cs has strict parasitics and special ecotope, therefore its output is very low, and price is high.Wild cordyceps owing to restricting by factors such as growing environments, scarcity of resources.Owing to making little progress on artificial culture in recent years, the research of wild cordyceps surrogate focused mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way solving Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation produces Chinese caterpillar fungus substitute, both can these precious resources of available protecting Chinese caterpillar fungus, and the restriction that climate, geographical environment and Chinese caterpillar fungus parasitic conditions are not strict again, is suitable for industrialization scale operation.The substitute produced is as also similar to natural cs with drug effect in its composition of mycelium, is thus devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, prove with natural cs chemical constitution, pharmacological action basically identical, natural cs can be replaced to produce cordyceps product, to make up the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites is all significantly improved.
In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic techniques, in worm grass product research and development, progressively turn to deeper functional metabolic Study on product by the direct utilization of Chinese caterpillar fungus raw material or crude extract.Large quantifier elimination is done to Chinese caterpillar fungus meta-bolites both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative research of functional metabolic product in biosynthesizing, pharmacological action etc. such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL wins initial success.
Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein miazines nucleosides comprises cytidine(C and uridine.Uridine (uracil riboside), also known as uridine (uIidine), has another name called and to be muttered ribosyl uridylic by snow riboside, dihydro-pyrimidin nucleosides, 1-β-D-.Cytidine(C (cytosine riboside) has another name called cytidine (cytidine), cytidine, 1-β-D-ribofuranosyl cytidine.Pyrimidine nucleoside is multiduty nucleosides, can be used as the additive of healthcare products and food.It also becomes the requisite of people's life gradually as beauty treatment and anti-ultraviolet radiation makeup, as medicine, clinical application is in nervus centralis, uropoiesis, metabolism and many-sided disease such as cardiovascular, in the U.S., nucleic acid medicine shows irreplaceable effect at antiviral, anti-tumor aspect in recent years.
Due to the important physiological action of pyrimidine nucleoside and analogue thereof, domestic and international related microorganism produces the existing a lot of research of miazines nucleosides.But, as the Cordyceps fungus of important anabolism miazines nucleosides, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in Cordyceps fungus miazines nucleosides metabolic pathway of synthesizing.
(3) summary of the invention
The object of the invention is for the above deficiency that exists and the technical issues that need to address, the enzyme of bacterium Cordyceps sinensis China pilose spore anabolism pyrimidine nucleotide is produced to " hundred make " and encoding gene is furtherd investigate, provide " hundred makes " and produce bacterium Cordyceps sinensis China pilose spore participation pyrimidine nucleoside and to set out the enzyme of anabolism pyrimidine nucleotide, encoding gene and application thereof.
The technical solution used in the present invention is:
The invention provides a kind of uridine-cytidine kinases of the anabolism pyrimidine nucleotide that sets out from " hundred make " production bacterium Cordyceps sinensis China pilose spore participation pyrimidine nucleoside, described enzyme has aminoacid sequence more than 90% homology shown in SEQ ID No.1, and preferably its aminoacid sequence is shown in SEQ ID No.1 (being designated as pynF albumen); This enzyme can prepare pyrimidine nucleotide by catalysis pyrimidine nucleoside.Due to the singularity of aminoacid sequence; the fragment of any peptide protein containing aminoacid sequence shown in SEQ ID No.1 or its variant; as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequences homology, more than 90%, all belong to the row of scope.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in aminoacid sequence; Wherein, the conservative property for variant changes, and the amino acid replaced has the structure similar to original acid or chemical property, and as replaced Isoleucine with leucine, variant also can have non-conservation and change, as replaced glycine with tryptophane.
The present invention relates to described Cordyceps sinensis China pilose spore uridine-cytidine kinases and prepare application in pyrimidine nucleotide at biocatalysis pyrimidine nucleoside.
Further, described is applied as: with the broken mixed solution of the wet thallus obtained containing Cordyceps sinensis China pilose spore uridine-cytidine kinases thalline fermentation culture after cytoclasis for catalyzer, take pyrimidine nucleoside as substrate, be in the transformation system of buffered soln formation of 6.5 ~ 8.5 in pH, at 30 DEG C, conversion reaction 2 ~ 3h under 150rpm condition, after reaction terminates, by reacting liquid filtering, get filtrate and be crude product containing pyrimidine nucleotide, described crude isolate purified acquisition pyrimidine nucleotide.
Further, the starting point concentration of described substrate is 10g/L, and the volumetric usage of described catalyzer is 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.
The path being obtained pyrimidine nucleotide by pyrimidine nucleoside anabolism is shown below:
The preparation method of described catalyzer is: Cordyceps sinensis China pilose spore uridine-cytidine kinases recombinant bacterium E. coli BL21/pET-28a/pynF is inoculated in 5mL and contains in the LB liquid nutrient medium of Kan resistance (50mg/L), 37 DEG C, 250r/min overnight incubation.Get 1mL culture, transferred in 50mL fresh containing the LB liquid nutrient medium of Kan resistance in 37 DEG C, 250r/min is cultured to cell concentration OD600 and is about about 0.6 ~ 0.8, the IPTG inducing culture 8h of finite concentration (240mg/ml) is added in culture, get induction broth to filter, collect wet thallus, wet thallus 0.5g phosphate buffered saline buffer (50mM, pH8.0) 15mL taking collection suspends, and the thalline mixed solution that ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) obtains afterwards is as catalysis enzyme.
The invention still further relates to the kinase whose encoding gene of above-mentioned uridine-cytidine, i.e. uridine-cytidine kinase gene, described gene has nucleotide sequence more than 90% homology shown in SEQ ID No.2, and preferably its nucleotides sequence is classified as shown in SEQ ID No.2 (being designated as pynF gene).Due to the singularity of nucleotide sequence, shown in any SEQ ID NO:2, the variant of polynucleotide, as long as itself and this polynucleotide have more than 90% homology, all belongs to the row of scope.The variant of described polynucleotide refers to a kind of polynucleotide sequence having one or more Nucleotide and change.The variant of these polynucleotide can make raw displacement varient or the varient of non-life, comprises and replaces varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be the replacement of polynucleotide, disappearance or insertion, but can not from the function of peptide protein changing in fact its coding.
The invention still further relates to described gene building and can prepare the genetic engineering bacterium of pyrimidine nucleotide, to expand the output of pyrimidine nucleotide or derivatives thereof by biocatalysis pyrimidine nucleoside.
Further, described is applied as: build the recombinant vectors containing described Cordyceps sinensis China pilose spore uridine-cytidine kinase gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtained carries out inducing culture, and nutrient solution separation and purification obtains containing the kinase whose somatic cells of Cordyceps sinensis China pilose spore uridine-cytidine.
The kinase whose enzyme of Cordyceps sinensis China pilose spore uridine-cytidine of the present invention is lived and is defined as: under optimum condition (30 DEG C), can transform the enzyme amount of 1 micromole's pyrimidine nucleoside in 1 minute.
The bacterial strain of Cordyceps sinensis China pilose spore uridine-cytidine kinases of the present invention and encoding gene thereof can be provided to be China pilose spore (Hirsutella Sinensis) L0106, this culture presevation is in China typical culture collection center, deposit number is CCTCC No:M 2011278, discloses in the patent CN102373190A of previously application.
Main points of the present invention there are provided the nucleotide sequence shown in the aminoacid sequence shown in SEQ ID NO:1 and SEQ ID NO:2, when this aminoacid sequence known and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and related vector, host cell acquisition, be all apparent to those skilled in the art.
Beneficial effect of the present invention is mainly reflected in: the present invention studies in detail pyrimidine nucleoside synthesis pyrimidine nucleotide pathways metabolism principle, the cloned DNA comprising nucleotide sequence provided by the present invention can be used for proceeding in engineering bacteria by the method for transduction, conversion, Conjugative tiansfer, by regulating the expression of pyrimidine nucleotide biosynthesis gene, give the high expression level of host's pyrimidine nucleotide, for the output expanding pyrimidine nucleotide or derivatives thereof provides effective way, there is major application prospect.
(4) accompanying drawing explanation
Fig. 1 is the denaturing formaldehyde gel electrophorogram that " hundred make " produces bacterium Cordyceps sinensis China pilose spore total serum IgE;
Fig. 2 is pyrimidine metabolic pathway annotated map;
Fig. 3 is uridine-cytidine kinase gene pcr amplification product gel electrophoresis figure;
Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;
Fig. 5 is restructuring cloned plasmids pMD18-T/pynF physical map;
Fig. 6 is recombinant expression plasmid pET-28a/pynF building process schematic diagram;
Fig. 7 is recombinant expression plasmid pET-28a/pynF physical map;
Fig. 8 is that uridine-cytidine kinase protein SDS-PAGE schemes.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore
Bacterium source: first gather natural cordyceps from Qinghai, and taken back Hangzhou and carry out separation screening, obtain L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is in China typical culture collection center, deposit number is CCTCC No:M 2011278, discloses in the patent CN102373190A of previously application.
By this strain inoculation in inclined-plane, (this is the liquid formulations before solidification to culture medium prescription, by following proportions well after bevel again) be glucose 2.0%(w/v, 1% represents in 100mL substratum containing 1g, down together), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, magnesium sulfate 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water, cultivates 25 days at 12 ~ 16 DEG C; Then by strain inoculation in fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, magnesium sulfate 0.01%, potassium primary phosphate 0.02%, surplus is water, be placed on shaking table, temperature 12 ~ 16 DEG C is cultivated 25 days, after cultivation terminates aseptically, carries out solid-liquid separation, and solid is placed in sterilized equipment, for subsequent use.
Embodiment 2: " hundred make " produces the extraction of bacterium Cordyceps sinensis China pilose spore total serum IgE
Total serum IgE is extracted with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly adding liquid nitrogen is fully ground to Powdered, be dispensed in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mixing, leaves standstill 5min on ice, nucleic acid-protein mixture is separated completely.2) RNA is separated: add 0.2mL chloroform, firmly concussion mixing 15s, and leave standstill 2 ~ 3min on ice, 4 DEG C, the centrifugal 15min of 12000rpm, layering, gets upper strata aqueous phase, about 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leaving standstill 10min on ice, 4 DEG C, the centrifugal 10min of 12000rpm, abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol, hangs precipitation, leaves standstill 10min on ice, 4 DEG C, the centrifugal 15min of 7500rpm; Repeat washing step above, then wash one time.5) RNA is dissolved: be placed in by centrifuge tube and open wide dry 5 ~ 10min on ice, add appropriate DEPC water dissolution.
Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample
After extracting sample total serum IgE, with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer and mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, Article 1 cDNA chain is synthesized with hexabasic base random primer (random hexamers), then Article 2 cDNA chain is synthesized, do end reparation after adding EB buffer solution elution through QiaQuick PCR kit purifying, add polyA and connect sequence measuring joints again, then clip size selection is carried out with agarose gel electrophoresis, finally carry out pcr amplification, the sequencing library Illumina GA IIx built up checks order.The raw image data obtained that checks order is converted into sequence data through base calling, i.e. raw data or raw reads.Only containing the reads of adaptor sequence in removing primitive sequencer reads, standby with subsequent analysis.
Embodiment 4: " hundred make " production bacterium Cordyceps sinensis China pilose spore RNA is short reads sequence assembling
Use short reads composite software SOAPdenovo(Li, Zhu et al. De novo assembly of human genomes with massively parallel short read sequencing [J]. Genome Res, 2010,20:265-272.) do transcript profile and from the beginning assemble.First the reads with certain length overlap is linked to be the longer Contig fragment not containing N by SOAPdenovo.Then Contig is returned in reads comparison, determine from the distance between the different Contig of same transcript and these Contig by paired-end reads, these Contig connect together by SOAPdenovo, and middle unknown nucleotide sequence N represents, so just obtains Scaffold.Utilize paired-end reads to do filling-up hole process to Scaffold further, finally obtain containing N minimum, the Unigene sequence that two ends can not extend again.Finally, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done blastx comparison (evalue<0.00001), get the sequence direction that the best albumen of comparison result determines Unigene.If the comparison result between different sink is contradictory, then press nr, Swiss-Prot, the priority of KEGG and COG determines the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al. ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences [J]. In Proceedings of 9th InternationalConference on Intelligent Systems for Molecular Biology. AAAIPress, Menlo Park, CA, pp. 1999, 138-148.) predict its coding region and determine the direction of sequence.For determining that the Unigene in sequence direction provides the sequence in its direction from 5' to 3', for determining the sequence that the Unigene in sequence direction provides composite software and obtains.
Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation
Functional annotation information provides the protein function annotation of Unigene, Pathway annotation, COG functional annotation and Gene Ontology(GO) functional annotation.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue<0.00001), obtain the albumen with given Unigene with highest serial similarity, thus obtain the protein function annotation information of this Unigene.The Pathway annotation of Unigene can be obtained further according to KEGG annotation information.Compared by Unigene and COG database, the function that prediction Unigene is possible also does function statistic of classification to it.According to nr annotation information, use Blast2GO software (Conesa, Gotz et al. Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research [J]. Bioinformatics, 2005,21 (18): 3674-3676.) the GO annotation information of Unigene is obtained.After obtaining the GO annotation of each Unigene, with WEGO software (Ye, Fang et al. WEGO:a web tool for plotting GO annotations [J]. Nucleic Acids Research, 2006,34:293-297.) GO functional classification statistics is done, from the gene function distribution characteristics being macroscopically familiar with these species to all Unigene.
Embodiment 6: " hundred make " is produced bacterium Cordyceps sinensis China pilose spore pyrimidine nucleotide pathways metabolism and analyzed
Fig. 2 is the pyrimidine metabolic (map00240) in KEGG pathways metabolism annotation, the enzyme annotated is that " hundred make " detected produces bacterium Cordyceps sinensis China pilose spore pyrimidine metabolic pathway relevant enzymes, as can be seen from the figure, uridine-cytidine kinases 1 Unigene from pyrimidine nucleoside synthesis pyrimidine nucleotide is detected.By the ORF Finder software on-line checkingi in NCBI, have found the open reading frame (SEQ ID No.2) of this gene and obtain corresponding protein sequence (SEQ ID No.1).
Embodiment 7: " hundred make " produces bacterium Cordyceps sinensis China pilose spore uridine-cytidine kinase gene design of primers
Use GENE RUNNER primer-design software according to predicting the gene open proofreading dna primers obtained, uridine-cytidine the kinase gene of bacterium China pilose spore anabolism pyrimidine nucleotide is produced for clone's " hundred make ", primer by Shanghai Sheng Gong biotechnology company limited synthesize, primer sequence as follows listed by:
PynF gene: forward primer 5 ' AGCGAATTCATGGATATTGAGACACCCTG 3 '
Reverse primer 5 ' ATTAAGCTTTCACCCGTGGTCGACAAGCACC 3 '
PynF mrna length is 300bp
Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA first chain
After the method first provided according to embodiment 1 turns out sutella sinensis fermented mycelium, the method provided according to embodiment 2 again carries out the extraction of total serum IgE to China pilose spore, carry out by following the synthesis that " hundred make " produces bacterium Cordyceps sinensis China pilose spore cDNA first chain, for follow-up each gene clone experiment after obtaining total serum IgE.
Adopt PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription synthesis cDNA first chain from Total RNA, experimental procedure is as follows:
1) in Microtube pipe, following mixed solution is prepared.
2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, and can improve reverse transcription reaction efficiency, so carry out sex change, annealing reaction in PCR instrument, condition setting is as follows:
65℃,5 min
3) annealing terminates the rear centrifugal several seconds mixed solution of template ribonucleic acid/primer etc. is gathered in bottom Microtube pipe.
4) in above-mentioned Microtube pipe, following inverse transcription reaction liquid is prepared.
5) in PCR instrument, reverse transcription reaction is carried out by following condition.
42℃ 15~30 min
70℃ 15 min
Generalized case, a PolyA structure is had at eukaryote mRNA 3 ' end, the quantity of A base is not at ten to hundreds of etc., utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, take mRNA as templated synthesis cDNA first chain, the present invention adopts the sequence in the dT region developed alone by TaKaRa (providing in PrimeScript 1st Strand cDNA Synthesis Kit) to be primer, if the mRNA integrity obtained is better, cDNA first chain of all zymoprotein encoding genes in species so can be obtained by process of reverse-transcription.
Embodiment 9: " hundred make " produces the detection of the clone of bacterium Cordyceps sinensis China pilose spore anabolism pyrimidine nucleotide functional gene uridine-cytidine kinases pynF gene, expression and protein vigor
The pcr amplification of 1, uridine-cytidine kinases pynF gene
With cDNA first chain obtained in embodiment 8 for template, pynF gene primer with synthesis in embodiment 7: 5 ' AGC GAA TTC ATG GAT ATT GAG ACA CCC TG 3 ', 5 ' ATT AAG CTT TCA CCC GTG GTC GAC AAG CAC C 3 ' carries out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:
Pfu pcr amplification reaction system:
Pfu DNA Ploymerase pcr amplification condition:
2, uridine-cytidine kinases pynF gene PCR product detected through gel electrophoresis
Concrete detection method is: 1) make it be uniformly dissolved the sepharose microwave-oven-heating of prepare 0.9%; 2) get 15mL gel, when gel is cooled to about 50 DEG C, add 1 μ L staining fluid Gold view, pour into after mixing on treatments of Electrophoretic Slab Gels, after removing bubble, insert point sample comb; 3), after gel sets, the careful point sample that takes out is combed, and offset plate is put into electrophoresis chamber (loading wells one end is near the negative pole of electrophoresis chamber), adds TAE electrophoretic buffer in electrophoresis chamber; 4) get 5 μ L samples and then add 6 × Loading Buffer 1.5 μ L and ddH 2o 4 μ L uses liquid-transfering gun loading after mixing, and applied sample amount is 10 μ L; 5) connect the supply lead between electrophoresis chamber and electrophoresis apparatus, just very red, negative pole is black; 6) power-on, start electrophoresis, maximum voltage is no more than 5 V/cm; 7) electrophoresis can be stopped when sample ran 2/3 of offset plate; 8), after cutting off the electricity supply, gel taken out and puts into the observation of gel imaging instrument, take pictures.
The size of transcript profile order-checking prediction uridine-cytidine kinases pynF gene is 300bp, and agarose gel electrophoresis result (Fig. 3) shows that Successful amplification has gone out uridine-cytidine kinases pynF gene.
3, uridine-cytidine kinases pynF gene PCR product add base A process and purifying
Because Pfu archaeal dna polymerase PCR primer end is flush end, connect so just can be used for carrier T also need to carry out adding base A process, purifying after glue reclaims after.It is as follows that glue recovery product adds base A system:
In PCR instrument, 72 DEG C add A base 20 min, finally purify with AxyPrep PCR cleaning agents box.
The connection of 4, uridine-cytidine kinases pynF gene and cloning vector
Cloning vector pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), its physical map is shown in Fig. 4, uridine-cytidine kinases pynF gene is connected construction recombination plasmid pMD18-T/pynF with cloning vector, and physical map is shown in Fig. 5, linked system and condition of contact as follows.
Linked system:
Condition of contact: 16 DEG C, 16h; Deactivation: 65 DEG C, 15min.
The conversion of 5, uridine-cytidine kinases recombinant plasmid pMD18-T/pynF
Recombinant plasmid pMD18-T/pynF is proceeded to the recombinant bacterium E. coli JM109/pMD18-T/pynF building in intestinal bacteria E. coli JM109 and carry uridine-cytidine kinases pynF gene.Concrete steps are: 1) go in competent cell E. coli JM109 by 10 μ L reaction systems, ice bath 30min; 2) thermal shock: 42 DEG C, 90s; 3) ice bath: 2-3min; 4) 800 μ L liquid LB are added, 37 DEG C, 250rpm, 1h; 5) spread plate (containing Amp resistance); 6) 37 DEG C of incubator overnight incubation.
The screening of the positive recombinant bacterium of 6, uridine-cytidine kinases E. coli JM109/pMD18-T/pynF
Bacterium colony PCR can extract genomic dna, and directly with the DNA exposed after thalline pyrolysis for template carries out pcr amplification, whether the method is easy and simple to handle, quick, can Rapid identification bacterium colony be positive bacterium colony containing object plasmid.First bacterium colony, adds in the 1.5mL centrifuge tube containing 50 μ L sterilized waters with toothpick picking list bacterium colony, boiling water bath 30min, then centrifugal using supernatant as template, carries out pcr amplification, and PCR program setting is Taq enzyme amplification general procedure.The agarose gel electrophoresis of 0.9% is finally adopted to detect bacterium colony PCR primer.
The order-checking of 7, uridine-cytidine kinases recombinant plasmid pMD18-T/pynF
After the positive recombinant bacterium LB liquid medium overnight incubation that bacterium colony PCR is detected, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is completed by Sani bio tech ltd, Shanghai.Through sequence verification, sequence SEQ ID No.2 has recombinated in pMD18-T/pynF.
The structure of 8, uridine-cytidine kinases recombinant expression plasmid pET-28a/pynF
Experimental basis foreign gene is in the principle of expression in escherichia coli, and expression vector pET-28a and uridine-cytidine kinases pynF gene restriction enzyme site comparison situation, determine EcoR I and Hind III double enzyme site, and the cultivation of liquid LB test tube shaker, recombinant plasmid extraction are carried out to recombination bacillus coli E. coli JM109/pMD18-T/pynF.
The recombinant plasmid of uridine-cytidine kinases pynF gene and expression vector pET-28a EcoR I/Hind III restriction enzyme 37 DEG C respectively enzyme cut process 6h, it is as follows that enzyme cuts system:
EcoR I/Hind III double digestion system:
Enzyme is cut and is terminated rear 65 DEG C of deactivation 15min, then respectively with Axygen DNA gel recovery test kit carry out reclaiming, purifying.
Uridine-cytidine kinases pynF gene and expression vector pET-28a connect with T4 ligase enzyme 16 DEG C again and spend the night after double digestion, purifying, build recombinant expression plasmid pET-28a/pynF, its building process is shown in Fig. 6, builds the recombinant expression plasmid pET-28a/pynF collection of illustrative plates obtained and sees Fig. 7.Linked system is composed as follows:
Linked system:
9, the uridine-conversion of cytidine kinases recombinant expression plasmid pET-28a/pynF and the screening of positive monoclonal
By heat-shock transformed in E. coli BL21 Host Strains for the expression plasmid built, be then applied on the LB agar plate containing kantlex (Kan) resistance (50mg/L), 37 DEG C of overnight incubation.From flat board, random choose list bacterium colony, carries out pcr amplification with the primer of each functional gene, selects positive colony.
The abduction delivering of 10, uridine-cytidine kinases recombinant bacterium E. coli BL21/pET-28a/pynF
The mono-clonal being accredited as the positive is inoculated in 5mL to be contained in the LB liquid nutrient medium of Kan resistance (50mg/L), 37 DEG C, 250r/min overnight incubation.Get 1mL culture, transferred in 50mL to contain in the LB liquid nutrient medium of Kan resistance (50mg/L) 37 DEG C, 250r/min is cultured to cell concentration OD600 and is about about 0.6 ~ 0.8.The IPTG inducing culture 8h of finite concentration (240mg/L) is added respectively in culture.Collect wet thallus for electrophoretic analysis and Enzyme activity assay.
11, uridine-cytidine kinases recombinant bacterium E. coli BL21/pET-28a/pynF expression product SDS-PAGE analyzes
With the E. coli BL21 bacterium proceeding to empty carrier and do not add inductor IPTG recombinant bacterium in contrast.Be accredited as positive recombinant bacterium after IPTG inducing culture 8h, get 0.5mL Induced cultures, collected by centrifugation thalline, be resuspended in 50 μ L distilled water, add 50 μ L sample-loading buffers, boil 10min after mixing, carry out SDS-PAGE electrophoretic analysis, " C " swimming lane in Fig. 8 be recombinant bacterium E. coli BL21/pET-28a/pynF express uridine-cytidine kinase protein pynF(through its aminoacid sequence of sequence verification for shown in SEQ ID No.1) SDS-PAGE figure.
The protein-active of 12, uridine-cytidine kinases recombinant bacterium E. coli BL21/pET-28a/pynF detects
Prepared by enzyme liquid: take the recombinant bacterium E. coli BL21/pET-28a/pynF wet thallus 0.5g(dry weight 0.1g that described method 10 is collected) use phosphate buffered saline buffer (50mM, pH8.0) 15mL to suspend respectively, ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) is as catalysis enzyme.
Uridine-cytidine kinases pynF transformation system: transform in bottle at 50mL and add E. coli BL21/pET-28a/pynF ultrasonication thalline 10mL, 0.1g cytidine (or 0.1g uridine), 30 DEG C, 150r/min conversion reaction 2-3h, after conversion terminates, centrifuging and taking supernatant is standby with subsequent detection.
Detection method: high performance liquid chromatography detection by quantitative pyrimidine nucleotide accumulation situation.Pre-treatment: after conversion fluid is centrifugal, supernatant liquor is crossed 0.22 μm of microporous membrane and is detected for high performance liquid chromatography.Condition: chromatographic column: Agilent C18 post (4.6mm × 250mm i.d.5 μm); Column temperature: 35 DEG C; Sampling volume: 20 μ L; Flow velocity 1mL/min; Determined wavelength 260nm; Moving phase: A: ultrapure water; B: methyl alcohol.Gradient elution: 0min, 15%B, keeps 3min; 3.0-3.5min, 15-24%B; 3.5min, 24% keeps 5min; 8.5-9.0min, 24-35%B; 35%B keeps 6min; 15.0-16.0min, 35-85%B; 85%B keeps 6min; 22.0-22.5min, 85%-15%B; 15%B keeps 5min.
The making of typical curve: accurately take each ucleotides (uridylic acid, cytidylic acid) standard substance, about 1.00mg-2.00mg, ultrapure water constant volume.6 gradients (1 μ g/mL, 30 μ g/mL, 60 μ g/mL, 90 μ g/mL, 120 μ g/mL, 150 μ g/mL) prepared by each standard substance.Then loading successively, each concentration repeats for 5 times.After the reference liquid getting certain volume maximum concentration mixes, constant volume, then HPLC analyzes the optimal conditions that pyrimidine nucleotide detects.
Detect through above-mentioned chromatographic condition and calculate, we draw to draw a conclusion: the uridine-cytidine kinase whose high specific enzyme expressed by uridine-cytidine kinases recombinant bacterium E. coli BL21/pET-28a/pynF lives (Specific Activity) for living maximum than enzyme in 200mol/min/mg(cytidine and uridine).Substrate conversion efficiency is respectively 75% and 83%.
SEQUENCE LISTING
<110> Zhejiang Polytechnical University, Zhongmei Huadong Pharmaceutical Co., Ltd. Hangzhou
<120> Cordyceps sinensis China pilose spore uridine-cytidine kinases, encoding gene and application thereof
<130>
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 100
<212> PRT
<213> Hirsutella Sinensis
<400> 1
Met Asp Ile Glu Thr Pro Cys Gly His Ser Tyr Gln Gly Leu Lys Ser
1 5 10 15
Lys Gly Glu Val Ser Ala Val Ile Val Leu Arg Gly Gly Ser Ala Leu
20 25 30
Glu Pro Ala Leu Arg Lys Thr Ile Pro Asp Cys Arg Thr Gly Arg Leu
35 40 45
Leu Ile Gln Ser Asp Tyr Ser Thr Gly Glu Pro Glu Leu His Tyr Leu
50 55 60
Arg Leu Pro Asp Asp Ile His Arg His Glu Ser Val Leu Leu Leu Asp
65 70 75 80
Thr Gln Met Ala Ser Gly Gly Ala Ala Leu Met Ala Val Gln Val Leu
85 90 95
Val Asp His Gly
100
<210> 2
<211> 300
<212> DNA
<213> Hirsutella Sinensis
<400> 2
atggatattg agacaccctg tggacacagc taccaaggac tgaaatcaaa gggagaagtc 60
agtgccgtga ttgtgctccg tggaggctcg gcacttgaac cggcactccg gaagacgata 120
ccagattgcc gcacagggcg cctcctgata cagtcggatt actcgacggg cgagccggaa 180
ctgcactact tgaggctgcc ggacgacatt cacaggcacg agagcgtgct gctgctggac 240
acgcaaatgg ccagtggcgg agcggccctg atggcagtgc aggtgcttgt cgaccacggg 300

Claims (7)

1. Cordyceps sinensis China pilose spore uridine-cytidine kinases, is characterized in that the aminoacid sequence of described enzyme is for shown in SEQ ID No.1.
2. Cordyceps sinensis China pilose spore uridine-cytidine kinases prepares the application in pyrimidine nucleotide at biocatalysis pyrimidine nucleoside as claimed in claim 1.
3. apply as claimed in claim 2, it is characterized in that described being applied as: with the broken mixed solution of the wet thallus obtained containing Cordyceps sinensis China pilose spore uridine-cytidine kinases thalline fermentation culture after cytoclasis for catalyzer, take pyrimidine nucleoside as substrate, be in the transformation system of buffered soln formation of 6.5 ~ 8.5 in pH, at 30 DEG C, conversion reaction 2 ~ 3h under 150rpm condition, after reaction terminates, by reacting liquid filtering, get filtrate and be crude product containing pyrimidine nucleotide, described crude isolate purified acquisition pyrimidine nucleotide.
4. apply as claimed in claim 3, it is characterized in that the starting point concentration of described substrate is 10g/L, the volumetric usage of described catalyzer is 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.
5. to encode the gene of enzyme described in claim 1, it is characterized in that the nucleotides sequence of described gene is classified as shown in SEQ ID No.2.
6. gene is building and can prepare application in the genetic engineering bacterium of pyrimidine nucleotide by biocatalysis pyrimidine nucleoside as claimed in claim 5.
7. apply as claimed in claim 6, it is characterized in that described being applied as: build the recombinant vectors containing described Cordyceps sinensis China pilose spore uridine-cytidine kinase gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtained carries out inducing culture, and nutrient solution separation and purification obtains containing the kinase whose somatic cells of Cordyceps sinensis China pilose spore uridine-cytidine.
CN201210535124.0A 2012-12-10 2012-12-10 Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof Active CN103031285B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210535124.0A CN103031285B (en) 2012-12-10 2012-12-10 Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210535124.0A CN103031285B (en) 2012-12-10 2012-12-10 Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN103031285A CN103031285A (en) 2013-04-10
CN103031285B true CN103031285B (en) 2014-12-17

Family

ID=48018686

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210535124.0A Active CN103031285B (en) 2012-12-10 2012-12-10 Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof

Country Status (1)

Country Link
CN (1) CN103031285B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110885812A (en) * 2019-10-29 2020-03-17 杭州唯泰生物药业有限公司 Method for preparing uridylic acid by enzyme method

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109161536B (en) * 2018-08-20 2022-04-08 天津科技大学 Enzyme preparation for preparing uridylic acid and method for preparing uridylic acid by enzyme catalysis
CN112126592B (en) * 2020-08-06 2022-06-14 浙江工业大学 Hirsutella sinensis mutant strain and application thereof in nucleoside production

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1478886A (en) * 2003-06-14 2004-03-03 安徽林苑虫草研究所 Chinese beimao spore liquid culture fermentationi technology
CN102373190A (en) * 2011-09-09 2012-03-14 浙江工业大学 Relevant enzymes for preparing mannitol by performing anabolism on Chinese caterpillar fungus and hirsutella sinensis, gene and application thereof
CN102690796A (en) * 2012-05-28 2012-09-26 浙江工业大学 Enzyme synthesized by Chinese caterpillar fungus hirsutella sinensis to metabolize guanine nucleotide and genes and application of enzyme

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1478886A (en) * 2003-06-14 2004-03-03 安徽林苑虫草研究所 Chinese beimao spore liquid culture fermentationi technology
CN102373190A (en) * 2011-09-09 2012-03-14 浙江工业大学 Relevant enzymes for preparing mannitol by performing anabolism on Chinese caterpillar fungus and hirsutella sinensis, gene and application thereof
CN102690796A (en) * 2012-05-28 2012-09-26 浙江工业大学 Enzyme synthesized by Chinese caterpillar fungus hirsutella sinensis to metabolize guanine nucleotide and genes and application of enzyme

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110885812A (en) * 2019-10-29 2020-03-17 杭州唯泰生物药业有限公司 Method for preparing uridylic acid by enzyme method

Also Published As

Publication number Publication date
CN103031285A (en) 2013-04-10

Similar Documents

Publication Publication Date Title
CN103031285B (en) Cordyceps Chinese Hirsutella uridine-cytidine kinase, coding gene and application thereof
CN103031295B (en) Cordyceps cytidine deaminase, coding gene and application thereof
CN103710315B (en) From the long-chain-acyl-CoA synthetase of Cordyceps sinensis, gene and application
CN102747057B (en) Cordyceps sinensis hirsutella sinensis purine anabolism enzyme, gene thereof, and application thereof
CN103031286B (en) Cordyceps Chinese Hirsutella uridylate-cytidylate kinase, coding gene and application thereof
CN103031287B (en) Cordyceps Chinese Hirsutella nucleoside diphosphokinase, coding gene and application thereof
CN103045574B (en) Cordyceps sinensis hirsutella sinensis uridylic acid synthetase, as well as coding gene and application thereof
CN103045557B (en) Cordyceps sinensis China pilose spore nucleosidetriphosphate pyrophosphatase, encoding gene and application
CN103045573B (en) Cordyceps sinensis cytosine deaminase, coding gene and application thereof
CN103031280B (en) Cordyceps sinensis CTP synthetic enzyme, encoding gene and application thereof
CN103031296B (en) Cordyceps sinensis dCMP (Deoxycytidine Monophosphate) deaminase, encoding gene and application of cordyceps sinensis dCMP deaminase
CN103031284B (en) Cordyceps thymidylate synthetase, coding gene and application thereof
CN102978177B (en) Cordyceps sinensis delta-5-desaturase used in anabolism of eicosapentaenoic acid, and gene and application thereof
CN103031288A (en) Cordyceps Chinese Hirsutella 5&#39;-nucleotidase, coding gene and application thereof
CN103031281B (en) Cordyceps Chinese Hirsutella carbamyl phosphate synthetase, coding gene and application thereof
CN102690801A (en) Enzyme for synthesizing and metabolizing inosine monophosphate of Cordyceps sinensis(Berk.)Sacc. Hirsutella sinensis and application thereof
CN103074311B (en) Enzyme of Cordyceps hirsutella sinensis for synthesis of acetic acid, and gene and application thereof
CN103013946B (en) Cordyceps sinensis hexadecane coenzyme A hydrolytic enzyme, gene and applications of hydrolytic enzyme and gene
CN104651324A (en) CTP (Cytidine Triphosphate) synthetase of cordyceps sinensis, coding gene and application of CTP synthetase
CN103045556A (en) Cordyceps sinensis dTMP kinases, coding gene and application thereof
CN102965351B (en) Cordyceps sinensis omega-6 fatty acid-dehydrogenase, gene and application of gene
CN102776162B (en) Enzyme of cordyceps sinensis hirsutella sinensis anabolic adenylic acid, gene and application of enzyme
CN102965350B (en) Cordyceps sinensis stearoyl-CoA desaturase, gene and application of gene
CN102703396A (en) Enzyme from Cordyceps sinensis Hirsutella sinensis for participating in anabolism to obtain xanthylic acid and application of enzyme
CN103045550A (en) Cordyceps sinensis hirsutella sinensis dihydroorotate oxidase, coding gene and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant