CN110885812A

CN110885812A - Method for preparing uridylic acid by enzyme method

Info

Publication number: CN110885812A
Application number: CN201911035373.1A
Authority: CN
Inventors: 周浩
Original assignee: Maanshan Weitai Biotechnology Co Ltd; Hangzhou Weitai Bio Pharmaceutical Co Ltd
Current assignee: Maanshan Weitai Biotechnology Co Ltd; Hangzhou Weitai Bio Pharmaceutical Co Ltd
Priority date: 2019-10-29
Filing date: 2019-10-29
Publication date: 2020-03-17

Abstract

The invention belongs to the technical field of biological pharmacy and biochemical engineering, and discloses an enzyme composition for producing uridylic acid and a method for preparing the uridylic acid by an enzyme method. The enzyme composition provided by the invention comprises cytidine deaminase, polyphosphate kinase and uridine-cytidine kinase. The reasonable combination of the three enzymes can efficiently catalyze and prepare uridylic acid. The enzyme composition disclosed by the invention can be recycled, is low in cost, and is energy-saving and environment-friendly. The method for preparing uridylic acid by the enzyme method takes cytidine as a substrate, and the enzyme composition for producing uridylic acid is added, so that the uridylic acid can be safely and reliably prepared at low cost, the cost of the existing route is reduced, the method is suitable for large-scale production, and the use of the uridylic acid in the fields of biological catalysis and medicines is guaranteed.

Description

Method for preparing uridylic acid by enzyme method

Technical Field

The invention belongs to the technical field of biological pharmacy and biochemical engineering, and particularly relates to a method for preparing uridylic acid by an enzyme method.

Background

Uridine Monophosphate (UMP), also known as uridylic acid, is an important intermediate in de novo synthesis of pyrimidine nucleotides in humans and one of the important nucleotides that make up RNA. De novo synthesis of pyrimidine nucleotides in humans is largely regulated by negative feedback from UMP; further UDP (uridine diphosphate) can be produced in vivo.

The sodium salt of uridylic acid, 5' -uridylic acid disodium, can be used as an important intermediate for producing nucleic acid medicines, health-care foods and biochemical reagents, is used for manufacturing uridine diphosphate glucose, uridine triphosphate, poly-adenine uridylic acid and other medicines, and plays an important role in treating various serious diseases.

At present, with the expansion of the application range of uridine triphosphate, uridine tetraphosphate, uridine phosphatase inhibitor and the like in the field of medicine and the application of uridine diphosphate glucose pyrophosphorylase gene, research and development efforts on disodium 5' -uridylate are also increased by domestic and foreign scientific research institutions and enterprises.

The existing production method of uridylic Acid mainly comprises a chemical synthesis method and a Ribonucleic Acid (RNA) degradation method. The chemical method is to dissolve uridine in an acid solution, protect 2 and 3-site hydroxyl groups and then use a toxic POCl3 reagent as a phosphorylation reagent to synthesize uridylic acid, so that the yield of the whole process is high, but the toxic reagent is used in the reaction process, and is high in temperature and pressure, explosive, poor in production safety and easy to cause pollution. RNA degradation is the use of 5' -phosphodiesterase degradation of RNA from yeast cells, the whole process is relatively environmental but product separation is difficult, and cell lysates are difficult to handle.

Disclosure of Invention

In view of the above, the present invention aims to provide a method for preparing uridylic acid by an enzymatic method, which solves the problems of the prior art.

In order to realize the purpose of the invention, the invention adopts the following technical scheme:

an enzyme composition comprises cytidine deaminase, polyphosphate kinase, and uridine-cytidine kinase.

The enzyme composition provided by the invention can be used for enzymatic catalytic synthesis of UMP by reasonably combining three enzymes, namely cytidine deaminase (ccd), uridine-cytidine kinase (UCK) and polyphosphate kinase (ppk).

In some embodiments, the activity of the cytidine deaminase in the enzyme composition is 1000-2000U/L, the activity of the polyphosphate kinase is 600-1000U/L, and the activity of the uridine-cytidine kinase is 1100-1500U/L.

The cytidine deaminase, the polyphosphate kinase and the uridine-cytidine kinase in the enzyme composition can be high-quality purified free enzyme liquid which is obtained by amplifying target fragments through PCR (polymerase chain reaction) by using a genetic engineering technology, is connected with a vector and is transferred into host bacteria, and then induces protein expression and purification. Or immobilized enzyme or immobilized recombinant cells after being immobilized.

The invention also provides a method for preparing uridylic acid by using the enzyme composition.

A method for preparing uridylic acid by enzyme method comprises adding cytidine, sodium hexametaphosphate, ATP, MgCl into pH7.0 phosphate buffer solution₂·6H₂And O, mixing uniformly, adding the enzyme composition, and catalyzing to prepare uridylic acid.

The method of the invention uses cytidine as a substrate, and can prepare uridylic acid with low cost, safety and reliability by adding the enzyme composition for producing uridylic acid. The specific reaction formula is as follows:

in some embodiments, the enzymatic method of preparing uridylic acid according to the invention comprises an enzyme composition comprising a cytidine deaminase activity of 1000-2000U/L, a polyphosphate kinase activity of 600-1000U/L, and a uridine-cytidine kinase activity of 1100-1500U/L. In some embodiments, the cytidine deaminase activity is 1000U/L, the polyphosphate kinase activity is 600U/L, and the uridine-cytidine kinase activity is 100U/L. In some embodiments, the cytidine deaminase activity is 2000U/L, the polyphosphate kinase activity is 800U/L, and the uridine-cytidine kinase activity is 1500U/L. In other embodiments, the cytidine deaminase activity is 1500U/L, the polyphosphate kinase activity is 1000U/L, and the uridine-cytidine kinase activity is 1100U/L.

In some embodiments, in the enzymatic method for preparing uridylic acid according to the present invention, the cytidine is present at a final concentration of 16 to 24g/L and hexametaphosphateThe final concentration of sodium is 50-80g/L, the final concentration of ATP is 1-2g/L, and MgCl₂·6H₂The final concentration of O is 8-12 g/L. In some embodiments, the cytidine is at a final concentration of 20g/L, the sodium hexametaphosphate is at a final concentration of 80g/L, the ATP is at a final concentration of 1g/L, and the MgCl is present₂·6H₂The final concentration of O was 10 g/L. In some embodiments, the cytidine is at a final concentration of 16g/L, the sodium hexametaphosphate is at a final concentration of 60g/L, the ATP is at a final concentration of 1g/L, and the MgCl is present₂·6H₂The final concentration of O was 12 g/L. In other embodiments, the cytidine is at a final concentration of 24g/L, the sodium hexametaphosphate is at a final concentration of 50g/L, the ATP is at a final concentration of 2g/L, and the MgCl is at a final concentration of 2g/L₂·6H₂The final concentration of O was 8 g/L.

Preferably, in the method for enzymatically producing uridylic acid according to the present invention, the catalytic reaction is carried out at a reaction temperature of 30 to 35 ℃ at a pH of 7.0 for 10 to 15 hours.

According to the technical scheme, the invention provides an enzyme composition for producing uridylic acid and a method for preparing the uridylic acid by using an enzyme method. The enzyme composition provided by the invention comprises cytidine deaminase, polyphosphate kinase and uridine-cytidine kinase. The reasonable combination of the three enzymes can efficiently catalyze and prepare uridylic acid. The enzyme composition disclosed by the invention can be recycled, is low in cost, and is energy-saving and environment-friendly. The method for preparing uridylic acid by the enzyme method takes cytidine as a substrate, and the enzyme composition for producing uridylic acid is added, so that the uridylic acid can be safely and reliably prepared at low cost, the cost of the existing route is reduced, the method is suitable for large-scale production, and the use of the uridylic acid in the fields of biological catalysis and medicines is guaranteed.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows the cycle activity decreasing curve of immobilized enzyme of example 5, the abscissa shows the number of cycles and the ordinate shows the enzyme activity.

Detailed Description

The invention discloses a method for preparing uridylic acid by an enzyme method. Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and products of the present invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications of the methods described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of the present invention without departing from the spirit and scope of the invention.

The method for measuring the activity of the cytidine deaminase comprises the following steps: cytidine deaminase pynM transformation: adding 10mL of E.coli BL21/pET-28a/pynM ultrasonication bacteria, 0.1g of cytidine or 0.1g of deoxycytidine into a 50mL conversion bottle, carrying out conversion reaction at 30 ℃ and 150r/min for 2-3h, and after the conversion is finished, centrifuging and taking a supernatant for subsequent detection. The detection method comprises the following steps: high performance liquid chromatography is used for quantitatively detecting (deoxy) uridine. Pretreatment: after the transformation liquid is centrifuged, the supernatant is used for high performance liquid chromatography detection through a 0.22 mu m microporous membrane. Conditions are as follows: a chromatographic column: agilent C18 column (4.6 mm. times.250 mm i.d.5 μm); column temperature: 35 ℃; sample introduction volume: 20 mu L of the solution; the flow rate is 1 mL/min; the detection wavelength is 260 nm; mobile phase: a: ultrapure water; b: methanol. Gradient elution: 0min, 15% B, keeping for 3 min; 3.0-3.5min, 15-24% B; 3.5min, keeping 24% for 5 min; 8.5-9.0min, 24-35% B; keeping 35% B for 6 min; 15.0-16.0min, 35-85% B; keeping 85% B for 6 min; 22.0-22.5min, 85% -15% B; 15% B for 5 min. And (3) preparing a standard curve: accurately weighing (deoxy) uridine standard substance with the volume of about 1.00mg-2.00mg and ultra-pure water to constant volume. 6 gradients (1. mu.g/mL, 30. mu.g/mL, 60. mu.g/mL, 90. mu.g/mL, 120. mu.g/mL, 150. mu.g/mL) were prepared for each standard. Samples were then sequentially loaded, 5 replicates for each concentration. A volume of the standard solution with the highest concentration is taken and mixed together, the volume is determined, and then HPLC analysis is carried out on the optimal conditions for (deoxy) uridine detection.

The method for measuring the activity of the polyphosphate kinase comprises the following steps: the enzyme reaction system and the reaction conditions are as follows: 100mM Tris-HCl (pH8.0), 20mM MgCl2, 1mM AMP, 1mM sodium hexametaphosphate, reacted at 30 ℃ for 15min, boiled in boiling water for 5min to inactivate the enzyme, centrifuged, and the supernatant was passed through a membrane. Detecting ATP content by HPLC, specifically C18HPLC column (250 mm × 4.6 mm); mobile phase: aqueous triethylamine phosphate solution (with a phosphoric acid content of 0.6% (v/v), pH adjusted to 6.6 with triethylamine): methanol 90: 10; an ultraviolet detector with the wavelength of 254nm, the column temperature of 30 ℃, the flow rate of 1mL/min and the sample injection amount of 20 mu L.

The method for measuring the enzyme activity of the uridine-cytidine kinase comprises the following steps: uridine-cytidine kinase pynF transformation system: e.coli BL21/pET-28a/pynF 10mL and 0.1g cytidine (or 0.1g uridine) are added into a 50mL transformation bottle, and then transformation reaction is carried out for 2-3h at 30 ℃ and 150r/min, and after the transformation is finished, the supernatant is centrifuged for later detection. The detection method comprises the following steps: and (3) quantitatively detecting the pyrimidine nucleotide accumulation condition by using a high performance liquid chromatography. Pretreatment: after the transformation liquid is centrifuged, the supernatant is used for high performance liquid chromatography detection through a 0.22 mu m microporous membrane. Conditions are as follows: a chromatographic column: agilent C18 column (4.6 mm. times.250 mm i.d.5 μm); column temperature: 35 ℃; sample introduction volume: 20 mu L of the solution; the flow rate is 1 mL/min; the detection wavelength is 260 nm; mobile phase: a: ultrapure water; b: methanol. Gradient elution: 0min, 15% B, keeping for 3 min; 3.0-3.5min, 15-24% B; 3.5min, keeping 24% for 5 min; 8.5-9.0min, 24-35% B; keeping 35% B for 6 min; 15.0-16.0min, 35-85% B; keeping 85% B for 6 min; 22.0-22.5min, 85% -15% B; 15% B for 5 min. And (3) preparing a standard curve: accurately weighing each nucleotide (uridylic acid, cytidylic acid) standard, about 1.00-2.00 mg, and diluting with ultrapure water to constant volume. 6 gradients (1. mu.g/mL, 30. mu.g/mL, 60. mu.g/mL, 90. mu.g/mL, 120. mu.g/mL, 150. mu.g/mL) were prepared for each standard. Samples were then sequentially loaded, 5 replicates for each concentration. And mixing a certain volume of standard solution with the highest concentration, fixing the volume, and analyzing the optimal conditions for pyrimidine nucleotide detection by HPLC.

In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products, and all of them are commercially available. Wherein the formula of the seed culture medium is 10g/L of peptone, 5g/L of yeast powder and 10g/L of NaCl10 g. The fermentation medium formula comprises 10g/L of peptone, 5g/L of yeast powder, 8g/L of NaCl, 10g/L of glycerol, 1.2g/L of monopotassium phosphate, 1.8g/L of monopotassium phosphate and 1g/L of magnesium sulfate.

Example 1 preparation of UMP-producing enzyme

3 pairs of amplification primers were designed based on the sequences of the three enzyme genes. Extracting Escherichia coli (Escherichia coli) strain genome DNA, using the Escherichia coli strain genome DNA as a template, carrying out PCR amplification on cytidine deaminase (ccc) and polyphosphate kinase (PPK1) gene fragments, and respectively connecting the cytidine deaminase (ccc) and the polyphosphate kinase (PPK1) gene fragments to a pET28a vector (purchased from Novagene company); genomic DNA of Lactobacillus bulgaricus (Lactobacillus bulgaricus) was extracted, and a uridine-cytidine kinase (UCK) gene fragment was PCR-amplified using the extracted genomic DNA as a template and ligated to a pET28a vector (available from Novagene). After the three gene fragments are successfully connected and correctly sequenced, the three gene fragments are respectively transferred into E.coli BL21(DE3) strain (Shanghai Diego Biotechnology Co., Ltd.).

Wherein, the sequence of cytidine deaminase (ccd) is ATGCATCCACGTTTTCAAACCGCTTTTGCCCAACTTGCGGATAACTTGCAATCTGCACTGGAACCTATTCTGGCAGACAAGTACTTCCCCGCTTTGTTGACCGGGGAGCAAGTCTCATCGCTGAAGAGCGCAACGGGGCTGGACGAAGACGCGCTGGCATTCGCACTACTTCCGCTGGCGGCGGCCTGTGCGCGTACGCCATTGTCGAATTTTAATGTTGGCGCAATTGCGCGCGGTGTGAGCGGAACCTGGTATTTCGGTGCCAATATGGAATTTATTGGTGCGACAATGCAGCAAACCGTTCATGCCGAACAAAGCGCGATCAGCCACGCCTGGTTGAGTGGTGAAAAAGCGCTTGCAGCCATCACCGTTAACTACACGCCTTGTGGTCACTGCCGTCAGTTTATGAATGAACTGAACAGCGGTCTGGATCTGCGTATTCATCTGCCGGGCCGCGAGGCACACGCGCTGCGTGACTATCTGCCAGATGCCTTTGGGCCGAAAGATCTGGAGATTAAAACGCTGCTGATGGACGAACAGGATCACGGCTATGCGCTGACGGGTGATGCGCTTTCTCAGGCAGCGATTGCGGCGGCAAACCGTTCGCACATGCCTTACAGTAAGTCGCCAAGCGGTGTCGCGCTGGAATGTAAAGACGGTCGTATTTTCAGTGGCAGCTACGCTGAAAACGCCGCATTCAACCCGACTCTGCCACCGTTGCAGGGAGCGTTAATTCTGTTGAATCTCAAGGGTTATGATTACCCGGATATCCAGCGCGCGGTTCTGGCAGAAAAAGCCGATGCGCCGTTGATTCAGTGGGATGCCACCTCCGCAACGCTGAAAGCTCTCGGCTGTCACAGTATCGACCGAGTGCTTCTCGCTTAA; the sequence of the amplification primer is ccd-F:5 '-3': agtcgcatcatATGCATCCACGTTTTCAAACC, the restriction enzyme cutting site is markedThe point NdeI; ccd-R3 '-5': gcgccgataGAATTCTTAAGCGAGAAGCACTCGGTCG, the restriction site EcoRI is underlined.

The sequence of polyphosphate kinase (PPK1) is ATGGGTCAGGAAAAGCTATACATCGAAAAAGAGCTCAGTTGGTTATCGTTCAATGAACGCGTGCTTCAGGAAGCGGCGGACAAATCTAACCCGCTGATTGAAAGGATGCGTTTCCTGGGGATCTATTCCAATAACCTTGATGAGTTCTATAAAGTCCGCTTCGCTGAACTGAAGCGACGCATCATTATTAGCGAAGAACAAGGCTCCAACTCTCATTCCCGCCATTTACTGGGCAAAATTCAGTCCCGGGTGCTGAAAGCCGATCAGGAATTCGACGGCCTCTACAACGAGCTATTGCTGGAGATGGCGCGCAACCAGATCTTCCTGATTAATGAACGCCAGCTCTCCGTCAATCAACAAAACTGGCTGCGTCATTATTTTAAGCAGTATCTGCGTCAGCACATTACGCCGATTTTAATCAATCCTGACACTGACTTAGTGCAGTTCCTGAAAGATGATTACACCTATCTGGCGGTGGAAATTATCCGTGGCGATACCATCCGTTACGCGCTGCTGGAGATCCCATCAGATAAAGTGCCGCGCTTTGTGAATTTACCGCCAGAAGCGCCGCGTCGACGCAAGCCGATGATTCTTCTGGATAACATTCTGCGTTACTGCCTTGATGATATTTTCAAAGGCTTCTTTGATTATGACGCGCTGAATGCCTATTCAATGAAGATGACCCGCGATGCCGAATACGATTTAGTGCATGAGATGGAAGCCAGCCTGATGGAGTTGATGTCTTCCAGTCTCAAGCAGCGTTTAACTGCTGAGCCGGTGCGTTTTGTTTATCAGCGCGATATGCCCAATGCGCTGGTTGAAGTGTTACGCGAAAAACTGACTATTTCCCGCTACGACTCCATCGTCCCCGGCGGTCGTTATCATAATTTTAAAGACTTTATTAATTTCCCCAATGTCGGCAAAGCCAATCTGGTGAACAAACCACTGCCGCGTTTACGCCATATTTGGTTTGATAAAGCCCAGTTCCGCAATGGTTTTGATGCCATTCGCGAACGCGATGTGTTGCTCTATTATCCTTATCACACCTTTGAGCATGTGCTGGAACTGCTGCGTCAGGCTTCGTTCGACCCGAGCGTACTGGCGATTAAAATTAACATTTACCGCGTGGCGAAAGATTCACGCATCATCGACTCGATGATCCACGCCGCACATAACGGTAAGAAAGTCACCGTGGTGGTTGAGTTACAGGCGCGTTTCGACGAAGAAGCCAACATTCACTGGGCGAAGCGCCTGACCGAAGCAGGCGTGCACGTTATCTTCTCTGCGCCGGGGCTGAAAATTCACGCCAAACTGTTCCTGATTTCACGTAAAGAAAACGGTGAAGTGGTGCGTTATGCACACATCGGGACCGGGAACTTTAACGAAAAAACCGCGCGTCTTTATACTGACTATTCGTTGCTGACCGCCGATGCGCGCATCACCAACGAAGTACGGCGGGTATTTAACTTTATTGAAAACCCATACCGTCCGGTGACATTTGATTATTTAATGGTATCGCCGCAAAACTCCCGCCGCCTATTGTATGAAATGGTGGACCGCGAGATCGCCAACGCGCAGCAAGGGCTGCCCAGTGGTATCACCCTGAAGCTAAATAACCTTGTCGATAAAGGCCTGGTTGATCGTCTGTATGCGGCCTCCAGCTCCGGCGTACCGGTTAATCTGCTGGTTCGCGGAATGTGTTCGCTGATCCCCAATCTGGAAGGCATTAGCGACAACATTCGTGCCATCAGTATTGTTGACCGTTACCTTGAACATGACCGGGTTTATATTTTTGAAAATGGCGGCGATAAAAAGGTCTACCTTTCTTCCGCCGACTGGATGACGCGCAATATTGATTATCGTATTGAAGTGGCGACGCCGCTGCTCGATCCGCGCCTGAAGCAGCGGGTACTGGACATCATCGACATATTGTTCAGCGATACGGTCAAAGCACGTTATATCGATAAAGAACTCAGTAATCGCTACGTTCCCCGCGGCAATCGCCGCAAAGTACGGGCGCAGTTGGCGATTTATGACTACATCAAATCACTCGAACAACCTGAATAA, respectively; the sequence of the amplification primer is ppk1-F5 '-3': gagtcacatATGGGTCAGGAAAAGCTATAC, drawing a line as an enzyme cutting site NdeI; ppk1-R:3 '-5': agtcgaagaattcTTATTCAGGTTGTTCGAGTG, the restriction site EcoRI is underlined.

The sequence of uridine-cytidine kinase (UCK) is ATGGCTAAGCAGAAACCACTCGTCATTGGGATTGCCGGGGGGTCAGGCTCAGGAAAGACGACAGTCTCCAAAGAAATCAGCAAGCGCCTGCCAGCTGACCGGGTACTCATTCTGACTGAAGATGCTTACTACAACGACAATTCAGCCCTCAGCATGGATGAACGCAAGAAGATCAACTACGACCATCCCAATGCTTACGACACTGACCTCTTGATTGAGCAGCTGCAGGACCTGCTGGATGGCAAGGCAATTGAAATGCCGACCTACAACTTCAACATCCTCTCCCGGGCCAAGGACACTATTCATGTTGAGCCAGCCGACATCATCATCCTGGAAGGGATCCTGGTTTTGGCTACAGAAGAATTGCGGGAGTTCATGGACATCAAGCTTTTTGTCGACTCTGACGACGACATCCGCTTCATCCGCCGCTTGCAGCGGGACACCCAGGAACGGGGCCGGTCAATCGACTGGATCATCTCCCAGTACTTGGCTACGGTTAAACCAAGCTACAACCAGTTCGTTGAGCCAAGCAAGAAGTATGCCGACATCATCATCCCCCAGGGTGGGGAAAACCAAGTGGCCATCGACATGGTCTCCTCAAAGCTCTTGTCTATTATCAACGGCTAA; the sequence of the amplification primer is uck-F:5 '-3' CGGAATTCATGGCTAAGCAGAAAC, cutting the restriction enzyme cutting site EcoRI; uck-R:3 '-5' CCGCTCGAGTTAGCCGTTGATA, the cleavage site XhoI is underlined.

Inoculating the strain into a seed culture medium under an aseptic condition, inoculating the strain into a 5L fermentation culture medium fermentation tank after the strain is cultured to a logarithmic growth phase, inoculating the strain into a 50L fermentation culture medium fermentation tank after the strain is continuously cultured to the logarithmic growth phase, adding 1mMIPTG (millipore size transfer) after the strain is cultured for 5 hours, inducing the strain at 25 ℃ for 20 hours, and centrifugally collecting the strain.

The harvested thalli are respectively subjected to ultrasonic or high-pressure homogenization and crushing, then the supernatant is centrifugally collected and purified by a nickel ion affinity column, and the high-quality purified enzyme is obtained.

Preparation of immobilized production enzymes or cells: 4.0 g of polyethylene glycol are dissolved in 45m1 of water, 6.0 g of polyvinyl alcohol (PVA) are added and the temperature is raised to 90-95 ℃ for dissolution. After the polyvinyl alcohol is completely dissolved, the temperature is reduced to 25-30 ℃, recombinant cells or purified enzyme is added, the mixture is uniformly mixed, a disposable straw is used for sucking the mixed solution, the mixed solution is injected on a plane to form a disc shape, and the disc shape is subjected to warm bath for 1 hour at the temperature of 30 ℃. The solution was then transferred to a 0.1M sodium sulfate solution for stabilization for 2-3 hours, filtered off and washed twice with sterile water and placed in phosphate buffer for further use.

Using the above method for determining enzyme activity, lmg/ml cytidine deaminase, polyphosphate kinase and uridine-cytidine kinase enzyme solutions were detected with activities of about 1030U, 200U and 340U, respectively, where 1 activity unit (U) is defined as the amount of enzyme required to completely convert 1 μm of substrate to product in 1 minute.

Example 2 preparation of UMP Using free enzyme

100g of substrate cytidine, 400g of sodium hexametaphosphate, ATP5g and MgCl₂·6H₂O50 g, added to 5L of phosphate buffer solution with pH7.0, stirred uniformly, and adjusted to pH 7.0. Adding cytidine deaminase into the reaction solution: 1000U/L, 600U/L of polyphosphate kinase and 1200U/L of uridine-cytidine kinase, wherein the pH is kept at 7.0 during the reaction, the reaction temperature is 30-35 ℃, and after 10 hours of reaction, the UMP production amount in the reaction supernatant is 23.5g/L, the purity is 70 percent and the cytidine conversion rate is 85 percent through HPLC detection.

HPLC detection conditions: octadecylsilane chemically bonded silica is used as a filling agent, a mobile phase A is tetrabutylammonium hydrogen phosphate, a mobile phase B is acetonitrile, the detection wavelength is 260nm, the flow rate is 1ml/min, the column temperature is 30 ℃, and the elution procedure is shown in Table 1.

TABLE 1 elution procedure

Time (min)	Mobile phase A (%)	Mobile phase B (%)
			0.01	95	5
5	75	25
			6	75	25
6.5	95	5
			10	95	5

And (3) performing ion exchange chromatography, concentration, crystallization and drying on the filtered and collected supernatant through macroporous strongly basic anion exchange resin to obtain the finished UMP117g with the purity of 99 percent and the total yield of 78 percent.

Example 3 preparation of UMP Using immobilized cells

Substrate cytidine 80g, sodium hexametaphosphate 300g, ATP5g, MgCl₂·6H₂O60g, added into 5L phosphate buffer solution with pH7.0, stirred evenly, and adjusted to pH 7.0. Adding immobilized cells of each enzyme into the reaction solution, wherein the activities are cytidine deaminase: 2000U/L, 800U/L of polyphosphate kinase and 1500U/L of uridine-cytidine kinase, wherein the pH is controlled to be 7.0 during the reaction, and the reaction temperature is 30-35 ℃. After 15 hours of reaction, the amount of UMP produced in the reaction supernatant was 16.4g/L, the cytidine conversion was 75%, and the purity was 53% as determined by HPLC. HPLC detection conditions were the same as in example 2.

And (3) performing ion exchange chromatography, concentration, crystallization and drying on the filtered and collected supernatant through macroporous strongly basic anion exchange resin to obtain the finished UMP82g with the purity of 98 percent and the total yield of 68 percent.

Example 4 preparation of UMP Using immobilized enzyme

120g of substrate cytidine, 250g of sodium hexametaphosphate, ATP10g and MgCl₂·6H₂O40 g, added to 5L of phosphate buffer solution pH7.0, stirred well, and adjusted to pH 7.0. Adding each immobilized enzyme into the reaction liquid, wherein the activity is cytidine deaminase: 1500U/L, polyphosphate kinase: 1000U/L, uridine-cytidine kinase: 1100U/L, the pH was controlled to be 7.0 during the reaction, and the reaction temperature was 30-35 ℃. After the reaction for 13 hours, the amount of UMP produced in the reaction supernatant was 27.2g/L, the cytidine conversion was 83%, and the purity was 65% by HPLC. HPLC detection conditions were the same as in example 2.

And (3) performing ion exchange chromatography, concentration, crystallization and drying on the filtered and collected supernatant through macroporous strongly basic anion exchange resin to obtain the finished UMP136g product with the purity of 98.6 percent and the total yield of 75 percent.

Example 5 detection of Activity of immobilized enzyme or immobilized cell

The immobilized enzymes or immobilized cells of the three enzymes for UMP production can be recycled, and the three immobilized enzymes for UMP production are mixed according to the mass ratio of 1:1:1 and subjected to 20 times of circulating reaction for follow-up detection according to the known method for measuring the enzyme activity described in the prior art, and the result is shown in FIG. 1.

The results showed that the enzyme activity of the three production immobilized enzymes of UMP gradually decreased with the increase in the number of cycles. The reaction was cycled 20 times and enzyme activity was only reduced by about 25%. The enzymatic activity of the three immobilized enzymes for UMP production is also reduced by only about 20-25% when stored at 4 ℃ for more than one month.

Furthermore, the activity of the immobilized cells of the three production enzymes of UMP decreases only by 20-25% with increasing cycle number or prolonged storage time at 4 ℃.

Sequence listing

<110> Hangzhou Weitai biological pharmaceutical Co Ltd

Maanshan Weitai Biotech Ltd

<120> method for preparing uridylic acid by enzyme method

<130>MP1918557

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>885

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgcatccac gttttcaaac cgcttttgcc caacttgcgg ataacttgca atctgcactg 60

gaacctattc tggcagacaa gtacttcccc gctttgttga ccggggagca agtctcatcg 120

ctgaagagcg caacggggct ggacgaagac gcgctggcat tcgcactact tccgctggcg 180

gcggcctgtg cgcgtacgcc attgtcgaat tttaatgttg gcgcaattgc gcgcggtgtg 240

agcggaacct ggtatttcgg tgccaatatg gaatttattg gtgcgacaat gcagcaaacc 300

gttcatgccg aacaaagcgc gatcagccac gcctggttga gtggtgaaaa agcgcttgca 360

gccatcaccg ttaactacac gccttgtggt cactgccgtc agtttatgaa tgaactgaac 420

agcggtctgg atctgcgtat tcatctgccg ggccgcgagg cacacgcgct gcgtgactat 480

ctgccagatg cctttgggcc gaaagatctg gagattaaaa cgctgctgat ggacgaacag 540

gatcacggct atgcgctgac gggtgatgcg ctttctcagg cagcgattgc ggcggcaaac 600

cgttcgcaca tgccttacag taagtcgcca agcggtgtcg cgctggaatg taaagacggt 660

cgtattttca gtggcagcta cgctgaaaac gccgcattca acccgactct gccaccgttg 720

cagggagcgt taattctgtt gaatctcaag ggttatgatt acccggatat ccagcgcgcg 780

gttctggcag aaaaagccga tgcgccgttg attcagtggg atgccacctc cgcaacgctg 840

aaagctctcg gctgtcacag tatcgaccga gtgcttctcg cttaa 885

<210>2

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

agtcgcatca tatgcatcca cgttttcaaa cc 32

<210>3

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcgcgataga attcttaagc gagaagcact cggtcg 36

<210>4

<211>2067

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgggtcagg aaaagctata catcgaaaaa gagctcagtt ggttatcgtt caatgaacgc 60

gtgcttcagg aagcggcgga caaatctaac ccgctgattg aaaggatgcg tttcctgggg 120

atctattcca ataaccttga tgagttctat aaagtccgct tcgctgaact gaagcgacgc 180

atcattatta gcgaagaaca aggctccaac tctcattccc gccatttact gggcaaaatt 240

cagtcccggg tgctgaaagc cgatcaggaa ttcgacggcc tctacaacga gctattgctg 300

gagatggcgc gcaaccagat cttcctgatt aatgaacgcc agctctccgt caatcaacaa 360

aactggctgc gtcattattt taagcagtat ctgcgtcagc acattacgcc gattttaatc 420

aatcctgaca ctgacttagt gcagttcctg aaagatgatt acacctatct ggcggtggaa 480

attatccgtg gcgataccat ccgttacgcg ctgctggaga tcccatcaga taaagtgccg 540

cgctttgtga atttaccgcc agaagcgccg cgtcgacgca agccgatgat tcttctggat 600

aacattctgc gttactgcct tgatgatatt ttcaaaggct tctttgatta tgacgcgctg 660

aatgcctatt caatgaagat gacccgcgat gccgaatacg atttagtgca tgagatggaa 720

gccagcctga tggagttgat gtcttccagt ctcaagcagc gtttaactgc tgagccggtg 780

cgttttgttt atcagcgcga tatgcccaat gcgctggttg aagtgttacg cgaaaaactg 840

actatttccc gctacgactc catcgtcccc ggcggtcgtt atcataattt taaagacttt 900

attaatttcc ccaatgtcgg caaagccaat ctggtgaaca aaccactgcc gcgtttacgc 960

catatttggt ttgataaagc ccagttccgc aatggttttg atgccattcg cgaacgcgat 1020

gtgttgctct attatcctta tcacaccttt gagcatgtgc tggaactgct gcgtcaggct 1080

tcgttcgacc cgagcgtact ggcgattaaa attaacattt accgcgtggc gaaagattca 1140

cgcatcatcg actcgatgat ccacgccgca cataacggta agaaagtcac cgtggtggtt 1200

gagttacagg cgcgtttcga cgaagaagcc aacattcact gggcgaagcg cctgaccgaa 1260

gcaggcgtgc acgttatctt ctctgcgccg gggctgaaaa ttcacgccaa actgttcctg 1320

atttcacgta aagaaaacgg tgaagtggtg cgttatgcac acatcgggac cgggaacttt 1380

aacgaaaaaa ccgcgcgtct ttatactgac tattcgttgc tgaccgccga tgcgcgcatc 1440

accaacgaag tacggcgggt atttaacttt attgaaaacc cataccgtcc ggtgacattt 1500

gattatttaa tggtatcgcc gcaaaactcc cgccgcctat tgtatgaaat ggtggaccgc 1560

gagatcgcca acgcgcagca agggctgccc agtggtatca ccctgaagct aaataacctt 1620

gtcgataaag gcctggttga tcgtctgtat gcggcctcca gctccggcgt accggttaat 1680

ctgctggttc gcggaatgtg ttcgctgatc cccaatctgg aaggcattag cgacaacatt 1740

cgtgccatca gtattgttga ccgttacctt gaacatgacc gggtttatat ttttgaaaat 1800

ggcggcgata aaaaggtcta cctttcttcc gccgactgga tgacgcgcaa tattgattat 1860

cgtattgaag tggcgacgcc gctgctcgat ccgcgcctga agcagcgggt actggacatc 1920

atcgacatat tgttcagcga tacggtcaaa gcacgttata tcgataaaga actcagtaat 1980

cgctacgttc cccgcggcaa tcgccgcaaa gtacgggcgc agttggcgat ttatgactac 2040

atcaaatcac tcgaacaacc tgaataa 2067

<210>5

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gagtcacata tgggtcagga aaagctatac 30

<210>6

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

agtcgaagaa ttcttattca ggttgttcga gtg 33

<210>7

<211>627

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

atggctaagc agaaaccact cgtcattggg attgccgggg ggtcaggctc aggaaagacg 60

acagtctcca aagaaatcag caagcgcctg ccagctgacc gggtactcat tctgactgaa 120

gatgcttact acaacgacaa ttcagccctc agcatggatg aacgcaagaa gatcaactac 180

gaccatccca atgcttacga cactgacctc ttgattgagc agctgcagga cctgctggat 240

ggcaaggcaa ttgaaatgcc gacctacaac ttcaacatcc tctcccgggc caaggacact 300

attcatgttg agccagccga catcatcatc ctggaaggga tcctggtttt ggctacagaa 360

gaattgcggg agttcatgga catcaagctt tttgtcgact ctgacgacga catccgcttc 420

atccgccgct tgcagcggga cacccaggaa cggggccggt caatcgactg gatcatctcc 480

cagtacttgg ctacggttaa accaagctac aaccagttcg ttgagccaag caagaagtat 540

gccgacatca tcatccccca gggtggggaa aaccaagtgg ccatcgacat ggtctcctca 600

aagctcttgt ctattatcaa cggctaa 627

<210>8

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

cggaattcat ggctaagcag aaac 24

<210>9

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ccgctcgagt tagccgttga ta 22

Claims

1. An enzyme composition comprises cytidine deaminase, polyphosphate kinase, and uridine-cytidine kinase.

2. The enzyme composition according to claim 1, wherein the activity of cytidine deaminase is 1000-2000U/L, the activity of polyphosphate kinase is 600-1000U/L, and the activity of uridine-cytidine kinase is 1100-1500U/L.

3. The enzyme composition according to claim 1 or 2, wherein the cytidine deaminase, polyphosphate kinase and uridine-cytidine kinase are free enzyme solutions, immobilized enzymes or immobilized recombinant cells.

4. A method for preparing uridylic acid by enzyme method comprises adding cytidine, sodium hexametaphosphate, ATP, MgCl into pH7.0 phosphate buffer solution₂·6H₂O, mixing, adding the enzyme composition of any one of claims 1 to 3, and catalyzingAnd (4) preparing uridylic acid.

5. The method of claim 4, wherein the cytidine is at a final concentration of 16-24g/L, the sodium hexametaphosphate is at a final concentration of 50-80g/L, the ATP is at a final concentration of 1-2g/L, and the MgCl is at₂·6H₂The final concentration of O is 8-12 g/L.

6. The method of claim 5, wherein the catalytic reaction is carried out at pH7.0 and at a temperature of 30-35 ℃ for 10-15 hours.