CN107287172B

CN107287172B - Method for producing thymidine phosphorylase by using escherichia coli fermentation

Info

Publication number: CN107287172B
Application number: CN201610227380.1A
Authority: CN
Inventors: 丁雪峰
Original assignee: Nanjing Nuoyun Biotechnology Co ltd
Current assignee: Nanjing Nuoyun Biotechnology Co ltd
Priority date: 2016-04-13
Filing date: 2016-04-13
Publication date: 2021-02-02
Anticipated expiration: 2036-04-13
Also published as: CN107287172A

Abstract

The invention relates to a method for producing thymidine phosphorylase by using escherichia coli fermentation, belonging to the field of bioengineering. The invention can effectively improve the total enzyme activity of unit thalli and effectively reduce the production cost of the intermediate beta-thymidine of the anti-AIDS medicament by expressing the thymidine phosphorylase mutant. The production can be carried out only in a common fermentation workshop (such as an amino acid and vitamin production workshop), special equipment does not need to be purchased, and the method is easy to popularize and apply.

Description

Method for producing thymidine phosphorylase by using escherichia coli fermentation

Technical Field

The invention relates to a method for producing thymidine phosphorylase by using escherichia coli fermentation, belonging to the field of bioengineering.

Background

Thymidine is an important intermediate of medicine raw material and biochemical reagent, and has wide application in research and production in biochemical field. Thymidine is an important raw material for preparing an anti-AIDS drug, namely Azidothymidine (AZT), but the content of the thymidine is required to be more than 98 percent, and the content of 5-methyluridine in the thymidine cannot exceed 0.3 percent. The preparation of thymidine at present mainly comprises two methods, namely chemical synthesis and DNA enzymolysis: the crude thymidine obtained by the chemical synthesis method contains oil, pigment, 5-methyluridine and other thymidine derivatives, and optical isomers are difficult to remove; in the process, a large amount of toxic and harmful organic solvent is also needed, and the process also has danger to environmental pollution. The enzymatic hydrolysis method hydrolyzes natural substances such as RNA or DNA, and the obtained thymidine crude product contains impurities such as deoxyadenosine (dA), deoxycytidine (dC), deoxyguanosine (dG), deoxyinosine (dI) and the like, and the separation and extraction are very complicated.

Thymidine phosphorylase has an important role in the biosynthesis of nucleoside drugs. The synthesized nucleoside medicament is widely applied to the field of medicines, such as HIV reverse transcriptase inhibitors zifudoxine (AZT), dideoxyinosine (ddl), zalcitabine (ddC) and the like for treating AIDS.

The thymidine phosphorylase can specifically act on beta-thymidine to catalyze reversible phosphorylation reaction of beta-thymidine, and can generate deoxyribose-1-phosphate and thymine from beta-thymidine, or generate beta-thymidine from deoxyribose-1-phosphate and thymine.

Disclosure of Invention

The invention aims to obtain a method for producing thymidine phosphorylase by using escherichia coli fermentation, which is suitable for industrial production and comprises the following steps:

(1) selecting a single escherichia coli colony containing an expression vector of SEQ ID NO.3, inoculating the single escherichia coli colony in a first-stage culture medium subjected to autoclaving, and carrying out overnight culture at 30 ℃ at 250 rpm;

(2) inoculating the product obtained in the step (1) into a secondary culture medium subjected to high-pressure sterilization according to an inoculation ratio of 1:100, culturing at 30 ℃ until the OD value of thalli is 5-6, immediately placing the thalli into 25 ℃, shaking, and culturing at 250rpm for 1 hour;

(3) adding IPTG to the product obtained in step (2) to a final concentration of 0.1mM and continuing the cultivation at 25 ℃ and 250rpm for 16 hours;

(4) the culture was centrifuged at 12000g for 20 minutes at 4 ℃ to collect wet cells, which were then further fermented to produce thymidine phosphorylase. .

Wherein the primary culture medium consists of the following substances: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L.

The secondary medium consisted of the following: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L.

Overnight in the above description means 12-16 hours.

After the wet thallus is obtained, the method can also comprise the following steps: the wet bacterial pellet was washed twice with distilled water and the bacterial pellet was collected. The cells obtained in the present invention were stored at-70 ℃.

Wherein, the amino acid sequence coded by the artificial sequence SEQ ID NO.3 is SEQ ID NO: 4, it is a thymidine phosphorylase protein mutant.

The mutant starts from thymidine phosphorylase protein of Escherichia coli MG1655, and is obtained by mutating Leu to Ala at position 10, Ala to Gly at position 209, Phe to Gly at position 210, Ala to Val at position 221 and Ala to Asp at position 413.

The method disclosed by the invention can effectively improve the total enzyme activity of unit thalli and effectively reduce the production cost of an anti-AIDS drug intermediate beta-thymidine by expressing the thymidine phosphorylase mutant. The production can be carried out only in a common fermentation workshop (such as an amino acid and vitamin production workshop), special equipment does not need to be purchased, and the method is easy to popularize and apply.

Drawings

FIG. 1 is a map of an expression vector of thymidine phosphorylase mutant Seq ID No. 3.

Detailed Description

In order to better explain the invention, the invention is further illustrated below with reference to examples. The instruments and reagents used in the present examples are commercially available products unless otherwise specified.

Example 1

Escherichia coli MG1655 was cultured in LB medium at 37.0 ℃ for 1 day at 180rpm, and the precipitate was collected by centrifugation, and the genomic DNA of Escherichia coli MG1655 was extracted and purified using the Qiaamp Kit (Qiagen, Germany).

PCR amplification of Escherichia coli MG1655 genomic DNA with Pfu high fidelity enzyme

1655TP-F 5’ATGTTTCTCGCACAAGAAATTATTCG 3’

1655TP-R 5’TTATTCGCTGATACGGCGATAGA 3’

Since the GC content of the DNA of E.coli MG1655 was close to 50%, direct amplification was carried out using Pfu high fidelity enzyme. Then, the amplified fragment was treated with Taq polymerase at 72 ℃ for 10 minutes to add base A to the 3' end of the DNA. This was then ligated into a pMD19T-simple (Takara Bao Bio Inc., Beijing) cloning vector, and single clones were picked up and sent to Nanjing Kinsry organisms for sequencing. The DNA sequence obtained by sequencing is SEQ ID NO.1, and the corresponding amino acid sequence is SEQ ID NO. 2.

Example 2

The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in escherichia coli. Meanwhile, five amino acid mutations at the following positions were introduced at the time of synthesis: L10A, A209G, F210G, A221V, A413D, designed by using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /), and ensuring that the Tm difference is controlled within 3 ℃, and the Primer length is controlled within 50base, the following primers are obtained:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 65 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.3, and the corresponding amino acid sequence is SEQ ID NO. 4.

Example 3

Selecting a single escherichia coli colony containing an expression vector of SEQ ID NO.3, and inoculating the single escherichia coli colony in 10ml of an autoclaved culture medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L. The culture was carried out at 30 ℃ and 250rpm overnight. The next day, a 1L triangular flask is taken and inoculated into 100ml of culture medium after autoclaving according to the inoculation ratio of 1: 100: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L. The cells were cultured at 30 ℃ until the OD 5-6 of the cells became zero, and the cells were immediately placed in a flask in a shaker at 25 ℃ and cultured at 250rpm for 1 hour. IPTG was added to a final concentration of 0.1mM and incubation was continued at 25 ℃ for 16 hours at 250 rpm. After completion of the culture, the culture was centrifuged at 12000g at 4 ℃ for 20 minutes to collect wet cells. Then the bacterial pellet is washed twice with distilled water, and the bacterial is collected and preserved at-70 ℃.

Example 4

The activity of the obtained thymidine phosphorylase was assayed by constructing a standard enzyme reaction solution according to the following system: 0.2M potassium phosphate buffer (pH7.4), 25mM thymidine, 1mM EDTA.

10ml of standard enzyme reaction liquid is filled in a 50ml centrifuge tube, and fermentation thalli are added according to the wet thalli amount of 5 percent; and (3) oscillating the reaction solution in a constant-temperature water bath for reaction for 3 hours under the condition of 25 ℃ water bath, and after the reaction is finished, terminating the reaction by placing the reaction solution in boiling water for 10 minutes. Transferring the reaction solution into a centrifuge tube, centrifuging at 12000r/min to remove precipitates, and taking supernate to dilute 100 times by using a diluted NaOH solution. The change in absorbance at 290nm of the diluted supernatant was measured using an ultraviolet spectrophotometer.

The same treatment was carried out as in the treatment of the experimental group described above using the blank solution as a control.

The enzyme activity unit is defined as: the wet bacterial cell amount required for the OD290nm to change by 0.01 within 1min at the pH of 7.4 and the temperature of 25 ℃ is defined as an enzyme activity unit;

the result shows that the thymidine phosphorylase activity containing five mutation sites is 3.60U/mg, while the thymidine phosphorylase activity before mutation is only 0.32U/mg wet thallus, and the enzyme activity is increased by about 10 times.

SEQUENCE LISTING

<110> Nanjing Nuo cloud Biotechnology Ltd

<120> method for producing thymidine phosphorylase by using escherichia coli fermentation

<130> 2016

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1323

<212> DNA

<213> Escherichia coli MG1655

<400> 1

atgtttctcg cacaagaaat tattcgtaaa aaacgtgatg gtcatgcgct gagcgatgaa 60

gaaattcgtt tctttatcaa cggtattcgc gacaacacta tctccgaagg gcagattgcc 120

gccctcgcga tgaccatttt cttccacgat atgacaatgc ctgagcgtgt ctcgctgacc 180

atggcgatgc gagattcagg aaccgttctc gactggaaaa gcctgcatct gaatggcccg 240

attgttgata aacactccac cggtggcgtc ggcgatgtga cttcgctgat gttggggccg 300

atggtcgcag cctgcggcgg ctatattccg atgatctctg gtcgcggcct cggtcatact 360

ggcggtacgc tcgacaaact ggaatccatc cctggcttcg acattttccc ggatgacaac 420

cgtttccgcg aaattattaa agacgtcggc gtggcgatta tcggtcagac cagttcactg 480

gctccggctg ataaacgttt ctacgcgacc cgtgatatta ccgcaaccgt ggactccatc 540

ccgctgatca ccgcctctat tctggcgaag aaacttgcgg aaggtctgga cgcgctggtg 600

atggacgtga aagtgggtag cggcgcgttt atgccgacct acgaactctc tgaagccctt 660

gccgaagcga ttgttggcgt ggctaacggc gctggcgtgc gcaccaccgc gctgctcacc 720

gacatgaatc aggtactggc ctccagtgca ggtaacgcgg ttgaagttcg tgaagcggtg 780

cagttcctga cgggtgaata tcgtaacccg cgtctgtttg atgtcacgat ggcgctgtgc 840

gtggagatgc tgatctccgg caaactggcg aaagatgacg ccgaagcgcg cgcgaaattg 900

caggcggtgc tggacaacgg taaagcggca gaagtctttg gtcgtatggt agcggcacaa 960

aaaggcccga ccgacttcgt tgagaactac gcgaagtatc tgccgacagc gatgctgacg 1020

aaagcagtct atgctgatac cgaaggtttt gtcagtgaaa tggatacccg cgcgctgggg 1080

atggcagtgg ttgcaatggg cggcggacgc cgtcaggcat ctgacaccat cgattacagc 1140

gtcggcttta ctgatatggc gcgtctgggc gaccaggtag acggtcagcg tccgctggcg 1200

gttatccacg cgaaagacga aaacaactgg caggaagcgg cgaaagcggt gaaagcggca 1260

attaaacttg ccgataaagc accggaaagc acaccaactg tctatcgccg tatcagcgaa 1320

taa 1323

<210> 2

<211> 440

<212> PRT

<213> Escherichia coli str. K-12 substr. MG1655

<400> 2

Met Phe Leu Ala Gln Glu Ile Ile Arg Lys Lys Arg Asp Gly His Ala

1 5 10 15

Leu Ser Asp Glu Glu Ile Arg Phe Phe Ile Asn Gly Ile Arg Asp Asn

20 25 30

Thr Ile Ser Glu Gly Gln Ile Ala Ala Leu Ala Met Thr Ile Phe Phe

35 40 45

His Asp Met Thr Met Pro Glu Arg Val Ser Leu Thr Met Ala Met Arg

50 55 60

Asp Ser Gly Thr Val Leu Asp Trp Lys Ser Leu His Leu Asn Gly Pro

65 70 75 80

Ile Val Asp Lys His Ser Thr Gly Gly Val Gly Asp Val Thr Ser Leu

85 90 95

Met Leu Gly Pro Met Val Ala Ala Cys Gly Gly Tyr Ile Pro Met Ile

100 105 110

Ser Gly Arg Gly Leu Gly His Thr Gly Gly Thr Leu Asp Lys Leu Glu

115 120 125

Ser Ile Pro Gly Phe Asp Ile Phe Pro Asp Asp Asn Arg Phe Arg Glu

130 135 140

Ile Ile Lys Asp Val Gly Val Ala Ile Ile Gly Gln Thr Ser Ser Leu

145 150 155 160

Ala Pro Ala Asp Lys Arg Phe Tyr Ala Thr Arg Asp Ile Thr Ala Thr

165 170 175

Val Asp Ser Ile Pro Leu Ile Thr Ala Ser Ile Leu Ala Lys Lys Leu

180 185 190

Ala Glu Gly Leu Asp Ala Leu Val Met Asp Val Lys Val Gly Ser Gly

195 200 205

Ala Phe Met Pro Thr Tyr Glu Leu Ser Glu Ala Leu Ala Glu Ala Ile

210 215 220

Val Gly Val Ala Asn Gly Ala Gly Val Arg Thr Thr Ala Leu Leu Thr

225 230 235 240

Asp Met Asn Gln Val Leu Ala Ser Ser Ala Gly Asn Ala Val Glu Val

245 250 255

Arg Glu Ala Val Gln Phe Leu Thr Gly Glu Tyr Arg Asn Pro Arg Leu

260 265 270

Phe Asp Val Thr Met Ala Leu Cys Val Glu Met Leu Ile Ser Gly Lys

275 280 285

Leu Ala Lys Asp Asp Ala Glu Ala Arg Ala Lys Leu Gln Ala Val Leu

290 295 300

Asp Asn Gly Lys Ala Ala Glu Val Phe Gly Arg Met Val Ala Ala Gln

305 310 315 320

Lys Gly Pro Thr Asp Phe Val Glu Asn Tyr Ala Lys Tyr Leu Pro Thr

325 330 335

Ala Met Leu Thr Lys Ala Val Tyr Ala Asp Thr Glu Gly Phe Val Ser

340 345 350

Glu Met Asp Thr Arg Ala Leu Gly Met Ala Val Val Ala Met Gly Gly

355 360 365

Gly Arg Arg Gln Ala Ser Asp Thr Ile Asp Tyr Ser Val Gly Phe Thr

370 375 380

Asp Met Ala Arg Leu Gly Asp Gln Val Asp Gly Gln Arg Pro Leu Ala

385 390 395 400

Val Ile His Ala Lys Asp Glu Asn Asn Trp Gln Glu Ala Ala Lys Ala

405 410 415

Val Lys Ala Ala Ile Lys Leu Ala Asp Lys Ala Pro Glu Ser Thr Pro

420 425 430

Thr Val Tyr Arg Arg Ile Ser Glu

435 440

<210> 3

<211> 1323

<212> DNA

<213> Artificial sequence

<400> 3

atgttcctgg ctcaggaaat catccgtaaa aaacgtgacg gtcacgctct gtctgacgaa 60

gaaatccgtt tcttcatcaa cggtatccgt gacaacacca tctctgaagg tcagatcgct 120

gctctggcta tgaccatctt cttccacgac atgaccatgc cggaacgtgt ttctctgacc 180

atggctatgc gtgactctgg taccgttgct gactggaaat ctctgcacct gaacggtccg 240

atcgttgaca aacactctac cggtggtgtt ggtgacgtta cctctctgat gctgggtccg 300

atggttgctg cttgcggtgg ttacatcccg atgatctctg gtcgtggtct gggtcacacc 360

ggtggtaccc tggacaaact ggaatctatc ccgggtttcg acatcttccc ggacgacaac 420

cgtttccgtg aaatcatcaa agacgttggt gttgctatca tcggtcagac ctcttctctg 480

gctccggctg acaaacgttt ctacgctacc cgtgacatca ccgctaccgt tgactctatc 540

ccgctgatca ccgcttctat cctggctaaa aaactggctg aaggtctgga cgctctggtt 600

atggacgtta aagttggttc tggtggtggt atgccgacct acgaactgtc tgaagctctg 660

gttgaagcta tcgttggtgt tgctaacggt gctggtgttc gtaccaccgc tctgctgacc 720

gacatgaacc aggttctggc ttcttctgct ggtaacgctg ttgaagttcg tgaagctgtt 780

cagttcctga ccggtgaata ccgtaacccg cgtctgttcg acgttaccat ggctctgtgc 840

gttgaaatgc tgatctctgg taaactggct aaagacgacg ctgaagctcg tgctaaactg 900

caggctgttc tggacaacgg taaagctgct gaagttttcg gtcgtatggt tgctgctcag 960

aaaggtccga ccgacttcgt tgaaaactac gctaaatacc tgccgaccgc tatgctgacc 1020

aaagctgttt acgctgacac cgaaggtttc gtttctgaaa tggacacccg tgctctgggt 1080

atggctgttg ttgctatggg tggtggtcgt cgtcaggctt ctgacaccat cgactactct 1140

gttggtttca ccgacatggc tcgtctgggt gaccaggttg acggtcagcg tccgctggct 1200

gttatccacg ctaaagacga aaacaactgg caggaagacg ctaaagctgt taaagctgct 1260

atcaaactgg ctgacaaagc tccggaatct accccgaccg tttaccgtcg tatctctgaa 1320

taa 1323

<210> 4

<211> 440

<212> PRT

<213> Artificial sequence

<400> 4

Met Phe Leu Ala Gln Glu Ile Ile Arg Lys Lys Arg Asp Gly His Ala

1 5 10 15

Leu Ser Asp Glu Glu Ile Arg Phe Phe Ile Asn Gly Ile Arg Asp Asn

20 25 30

Thr Ile Ser Glu Gly Gln Ile Ala Ala Leu Ala Met Thr Ile Phe Phe

35 40 45

His Asp Met Thr Met Pro Glu Arg Val Ser Leu Thr Met Ala Met Arg

50 55 60

Asp Ser Gly Thr Val Ala Asp Trp Lys Ser Leu His Leu Asn Gly Pro

65 70 75 80

Ile Val Asp Lys His Ser Thr Gly Gly Val Gly Asp Val Thr Ser Leu

85 90 95

Met Leu Gly Pro Met Val Ala Ala Cys Gly Gly Tyr Ile Pro Met Ile

100 105 110

Ser Gly Arg Gly Leu Gly His Thr Gly Gly Thr Leu Asp Lys Leu Glu

115 120 125

Ser Ile Pro Gly Phe Asp Ile Phe Pro Asp Asp Asn Arg Phe Arg Glu

130 135 140

Ile Ile Lys Asp Val Gly Val Ala Ile Ile Gly Gln Thr Ser Ser Leu

145 150 155 160

Ala Pro Ala Asp Lys Arg Phe Tyr Ala Thr Arg Asp Ile Thr Ala Thr

165 170 175

Val Asp Ser Ile Pro Leu Ile Thr Ala Ser Ile Leu Ala Lys Lys Leu

180 185 190

Ala Glu Gly Leu Asp Ala Leu Val Met Asp Val Lys Val Gly Ser Gly

195 200 205

Gly Gly Met Pro Thr Tyr Glu Leu Ser Glu Ala Leu Val Glu Ala Ile

210 215 220

Val Gly Val Ala Asn Gly Ala Gly Val Arg Thr Thr Ala Leu Leu Thr

225 230 235 240

Asp Met Asn Gln Val Leu Ala Ser Ser Ala Gly Asn Ala Val Glu Val

245 250 255

Arg Glu Ala Val Gln Phe Leu Thr Gly Glu Tyr Arg Asn Pro Arg Leu

260 265 270

Phe Asp Val Thr Met Ala Leu Cys Val Glu Met Leu Ile Ser Gly Lys

275 280 285

Leu Ala Lys Asp Asp Ala Glu Ala Arg Ala Lys Leu Gln Ala Val Leu

290 295 300

Asp Asn Gly Lys Ala Ala Glu Val Phe Gly Arg Met Val Ala Ala Gln

305 310 315 320

Lys Gly Pro Thr Asp Phe Val Glu Asn Tyr Ala Lys Tyr Leu Pro Thr

325 330 335

Ala Met Leu Thr Lys Ala Val Tyr Ala Asp Thr Glu Gly Phe Val Ser

340 345 350

Glu Met Asp Thr Arg Ala Leu Gly Met Ala Val Val Ala Met Gly Gly

355 360 365

Gly Arg Arg Gln Ala Ser Asp Thr Ile Asp Tyr Ser Val Gly Phe Thr

370 375 380

Asp Met Ala Arg Leu Gly Asp Gln Val Asp Gly Gln Arg Pro Leu Ala

385 390 395 400

Val Ile His Ala Lys Asp Glu Asn Asn Trp Gln Glu Asp Ala Lys Ala

405 410 415

Val Lys Ala Ala Ile Lys Leu Ala Asp Lys Ala Pro Glu Ser Thr Pro

420 425 430

Thr Val Tyr Arg Arg Ile Ser Glu

435 440

Claims

1. A method for producing thymidine phosphorylase by using escherichia coli fermentation is characterized in that: the method comprises the following steps:

(2) inoculating the product obtained in the step (1) into an autoclaved secondary culture medium according to an inoculation ratio of 1:100, culturing at 30 ℃ until the OD value of thalli is 5-6, immediately placing the thalli into 25 ℃, shaking, and culturing at 250rpm for 1 hour;

(4) centrifuging the culture solution at 4 ℃ at 12000g for 20 minutes, collecting wet thalli, and then utilizing the thalli to further ferment to produce thymidine phosphorylase; after the wet thalli is obtained, the method also comprises the following steps: the wet cell precipitate was washed twice with distilled water and the cells were collected.

2. The method of claim 1, further comprising: wherein the primary culture medium consists of the following substances: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin added to 50 mg/L.

3. The method of claim 1, further comprising: the secondary medium consisted of the following: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L.