CN107287256B - Method for synthesizing L-2-piperidinecarboxylic acid by whole-cell catalysis - Google Patents

Abstract

The invention belongs to the technical field of biocatalysis, and particularly relates to a method for synthesizing L-2-piperidinecarboxylic acid by whole-cell catalysis. The method for synthesizing the L-2-piperidinecarboxylic acid by whole-cell biocatalysis disclosed by the invention is characterized in that L-lysine hydrochloride is used as a substrate, and L-2-piperidinecarboxylic acid is prepared by biocatalysis by adding nicotinamide adenine dinucleotide and a recombinant host bacterium containing an Arenimonas donghaensis DSM 18148 protein encoding gene, or a recombinant host bacterium containing a Pseudomonas veronii CIP104663 protein encoding gene or a recombinant host bacterium containing a Streptomyces hirsutus ATCC 19091 protein encoding gene. Thereby overcoming the problems of high cost, rigorous conditions, low conversion rate, high energy consumption and large pollution of the existing chemical synthesis method. Meanwhile, the biological catalysis system disclosed by the invention has the advantages of high enzyme activity efficiency, short reaction time and high ee value of the target product.

Description

Method for synthesizing L-2-piperidinecarboxylic acid by whole-cell catalysis

Technical Field

The invention belongs to the technical field of biocatalysis, and particularly relates to a method for synthesizing L-2-piperidinecarboxylic acid by whole-cell catalysis.

Background

The L-2-piperidinecarboxylic acid is a naturally-occurring non-protein amino acid, is an important chiral drug intermediate, can be used for preparing rapamycin, an antitumor agent VX-710, an immunosuppressant FK506, piperidine alkaloid and the like, and has high industrial application value. The existing main production method is chemical synthesis and has the defects of low yield, high energy consumption, high pollution and the like. While the ee value is difficult to control.

Fujii et al accumulated 3.9g/L of the product in 159 hours using an engineered E.coli strain that recombinantly expressed L-lysine-6-aminotransferase and dihydropyrrole-5-carboxylate reductase. Subsequent additions of lysP lysine permease and yeiE resulted in a maximum accumulation of 16g/L at 111 hours. The scheme has the main problems of overlong reaction time, too little product generation amount, too high actual production cost and difficulty in scale-up production.

Yasushi Tani et al realizes the conversion from DL-lysine to L-2-piperidinecarboxylic acid by coexpressing four proteins, namely LysR, rAIP, DpkA, GDH and the like, and the conversion rate of the product reaches 87.4% in 46 hours, but the disadvantages of great difficulty in strain construction, poor repeatability and the like exist in the coexpression of a plurality of proteins.

Ying and the like utilize escherichia coli containing a pipA gene as a whole-cell catalyst, and optimize NAD concentration, reaction temperature, reaction pH, addition of metal ions, addition of an expression active agent and the like, so that the final product can reach 17.25 g/L. The low pipA enzyme activity in this protocol resulted in the use of an excess of whole cells (OD 200), low substrate concentration (lysine 25g/L) and required batch additions of substrate to complete the reaction. These factors lead to problems such as excessive cost in scale-up production.

Disclosure of Invention

In view of the problems in the prior art, the invention aims to develop a high-efficiency biocatalytic system, so as to improve the substrate dosage, shorten the reaction time and obtain a product with a high ee value.

In order to achieve the above object, the invention adopts the following technical scheme:

a method for synthesizing L-2-piperidinecarboxylic acid by whole-cell biocatalysis comprises taking L-lysine hydrochloride or L-lysine as substrate, adding nicotinamide adenine dinucleotide and recombinant host bacteria, and preparing L-2-piperidinecarboxylic acid by biocatalysis; wherein the recombinant host bacterium is any one of a recombinant host bacterium containing an Arenimonas donghaensis DSM 18148 protein encoding gene, a recombinant host bacterium containing a Pseudomonas veronii CIP104663 protein encoding gene or a recombinant host bacterium containing a Streptomyces hirsutus ATCC 19091 protein encoding gene. Wherein the recombinant host bacterium is Escherichia coli.

Further, the reaction was carried out in a pH8.0 potassium phosphate buffer solution.

Preferably, the reaction temperature is from 20 ℃ to 30 ℃.

Also, we preferably disclose that the reaction is carried out on a shaker at a shaker speed of 180 rpm.

Finally, we disclose wherein the concentration of the recombinant host bacterium is from 50g/L to 150 g/L.

The method for synthesizing the L-2-piperidinecarboxylic acid by whole-cell catalysis disclosed by the invention overcomes the problems of high cost, harsh conditions, low conversion rate, high energy consumption and large pollution of the conventional chemical synthesis method. Meanwhile, the biological catalysis system disclosed by the invention has the advantages of high enzyme activity efficiency, short reaction time and high ee value of the target product.

Drawings

FIG. 1 is an expression plasmid map of NYPDC

FIG. 2 is SDS-PAGE patterns of protein expression supernatant and inclusion bodies of NYPDa, NYPDB, NYPDC, NYPDD and NYPDE

FIG. 3 is a TLC chart of the biotransformation reaction in example 8

FIG. 4 is an HPLC chromatogram of L-2-piperidinecarboxylic acid in example 8

FIG. 5 is a MS spectrum of L-2-piperidinecarboxylic acid of example 8

FIG. 6 is an expression plasmid map of SEQ ID NO.10

FIG. 7 is an SDS-PAGE pattern of E.coli containing the expression plasmid of SEQ ID NO. 10.

FIG. 8 is a TLC pattern of the biotransformation reaction in example 15

FIG. 9 is an HPLC chromatogram of L-2-piperidinecarboxylic acid in example 15

FIG. 10 is a MS spectrum of L-2-piperidinecarboxylic acid of example 15

FIG. 11 is an expression plasmid map of SEQ ID NO.13

FIG. 12 is an SDS-PAGE pattern of E.coli containing the expression plasmid of SEQ ID NO. 13.

FIG. 13 is a TLC pattern of the biotransformation reaction of example 19

FIG. 14 is an HPLC chromatogram of L-2-piperidinecarboxylic acid in example 19

FIG. 15 is a MS spectrum of L-2-piperidinecarboxylic acid of example 19

Detailed Description

In order to better explain the invention, the invention is further illustrated below with reference to examples. The instruments and reagents used in the present examples are commercially available products unless otherwise specified.

In the TLC assays referred to in the following examples:

developing agent: trichloromethane: methanol: mixing water at ratio of 6:5:1, standing for about 10 min.

Specification of the silica gel plate: thin layer chromatography silica gel plate 5x 10.

Color developing agent: ninhydrin coloration 100ml ethanol add 0.1g ninhydrin, 500ul glacial acetic acid and mix.

The LC-MS detection conditions referred to in the following examples are:

a Prevail C18 column (250X 4.6mm, i.d.5 μm); column temperature: 30 ℃; mobile phase: 0.4% (v/v) aqueous trifluoroacetic acid; flow rate: 0.5 ml/min; a detector: evaporative Light Scattering Detector (ELSD); detector temperature: 120 ℃; carrier gas: nitrogen (purity 99.9%); flow rate of carrier gas: 4L/min; sample introduction volume: 10 μ L.

Example 1

The Arenimonas donghaensis DSM 18148 was placed in LB medium, incubated at 30 ℃ and 180rpm for 3-5 days, the precipitate was collected by centrifugation, and the purified Arenimonas donghaensis DSM 18148 DNA was extracted using the DNA extraction and purification Kit Qiaamp Kit (Qiagen, Germany).

The genomic DNA of Arenimonas donghaensis DSM 18148 was PCR amplified with Pfu high fidelity enzyme using primers

NYPD-F 5' ATGACCATGACCCAGCTCACCA 3'

NYPD-R 5' TCAGGCCGCCTGCTTGC 3'

Since the GC content of the Arenimonas donghaensis DSM 18148 DNA fragment was close to 70%, betaine was added at a final concentration of 0.5M during amplification. Then, the amplified fragment was treated with Taq polymerase at 72 ℃ for 10 minutes to add base A to the 3' end of the DNA. This was then ligated into the pMD19T-simple (Takara Bao Bio Inc., Beijing) cloning vector, and a single clone was picked and sent to the Shanghai organism for sequencing. The DNA sequence obtained by sequencing is SEQ ID NO.1, and the corresponding amino acid sequence is SEQ ID NO. 2.

Example 2

Because the GC content of the original DNA sequence is too high, efficient transcription is difficult to realize during culture in host bacteria. Therefore, the secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in Escherichia coli. The following primers were obtained by designing using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) with the Tm difference controlled to be within 3 ℃ and the Primer length controlled to be within 50 base:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 55 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.3 and is named NYPDA.

An expression plasmid containing NYPDA was constructed in the manner described with reference to FIG. 1.

Example 3

The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in escherichia coli. The following primers were obtained by designing using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) with the Tm difference controlled to be within 3 ℃ and the Primer length controlled to be within 50 base:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 55 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.4 and is named NYPDB.

An expression plasmid containing NYPDB was constructed in the manner described with reference to FIG. 1.

Example 4

The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in escherichia coli. The following primers were obtained by designing using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) with the Tm difference controlled to be within 3 ℃ and the Primer length controlled to be within 50 base:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 55 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.5 and is named NYPDC.

Expression plasmids containing NYPDC were constructed in the manner shown in FIG. 1.

Example 5

The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in escherichia coli. The following primers were obtained by designing using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) with the Tm difference controlled to be within 3 ℃ and the Primer length controlled to be within 50 base:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 55 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.6 and is named NYPDD.

An expression plasmid containing NYPDD was constructed in the manner described with reference to FIG. 1.

Example 6

The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in escherichia coli. The following primers were obtained by designing using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) with the Tm difference controlled to be within 3 ℃ and the Primer length controlled to be within 50 base:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 55 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.7 and is named NYPDE.

An expression plasmid containing NYPDE was constructed in the manner described with reference to FIG. 1.

Example 7

And E.coli single colony containing NYPDA expression vector is selected and inoculated in 10ml of culture medium after autoclaving: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L. The culture was carried out at 30 ℃ and 250rpm overnight. Taking a 1L triangular flask the next day, and carrying out the following steps: 100 into 100ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L. The cells were cultured at 30 ℃ until the OD 5-6 of the cells became zero, and the cells were immediately placed in a flask in a shaker at 25 ℃ and cultured at 250rpm for 1 hour. IPTG was added to a final concentration of 0.1mM and incubation was continued at 25 ℃ for 16 hours at 250 rpm. After completion of the culture, the culture was centrifuged at 12000g at 4 ℃ for 20 minutes to collect wet cells. Then the bacterial pellet is washed twice with distilled water, and the bacterial is collected and preserved at-70 ℃. Meanwhile, a small amount of thallus is taken for SDS-PAGE detection.

According to the above method, thallus of NYPDB, NYPDC, NYPDD, NYPDE were prepared respectively and subjected to SDS-PAGE protein gel detection, and the results are shown in FIG. 2. SDS-PAGE protein gel shows that NYPDC has the highest expression level, so that it is used as the preferred sequence for subsequent experiment.

Example 8

0.1M potassium phosphate buffer (pH8.0), 150g/L NYPDC cells, 25g/L L-lysine hydrochloride, 0.1mM NAD were added thereto, and the mixture was subjected to an open reaction at 25 ℃ with the rotation speed of the shaker set at 180 rpm. The sample was continuously taken out for TLC detection, and when the reaction time was 16 hours, the detection result is shown in FIG. 3, and the result shows that a large amount of product was produced in 16 hours, and no residue remained. The samples were simultaneously sampled and subjected to LC-MS detection, and the detection results are shown in FIG. 4 and FIG. 5.

Example 9

0.1M potassium phosphate buffer (pH8.0), 50g/L NYPDC cells, 74g/L L-lysine hydrochloride, 0.1mM NAD were added thereto, and the mixture was subjected to an open reaction at 25 ℃ with the rotation speed of the shaker set at 180 rpm. The reaction was sampled continuously for TLC detection, and the results showed that a large amount of product was produced in 48 hours with no residue. Meanwhile, sampling and carrying out LC-MS detection, and determining that the concentration of the final product reaches 37 g/L.

Example 10

0.1M potassium phosphate buffer (pH8.0), 50g/L NYPDC cells, 100g/L L-lysine hydrochloride, 0.1mM NAD were added thereto, and the mixture was subjected to an open reaction at 25 ℃ with the rotation speed of the shaker set at 180 rpm. The reaction was sampled continuously for TLC detection, and the results showed that a large amount of product was produced in 48 hours with no residue. Meanwhile, sampling and carrying out LC-MS detection, and determining that the concentration of the final product reaches 66.7 g/L.

Example 11

0.1M potassium phosphate buffer (pH8.0), 50g/L NYPDC cells, 150g/L L-lysine hydrochloride, 0.1mM NAD were added thereto, and the mixture was subjected to an open reaction at 25 ℃ with the rotation speed of the shaker set at 180 rpm. The reaction was sampled continuously for TLC detection, and the results showed that a large amount of product was produced in 48 hours with no residue. Meanwhile, sampling and carrying out LC-MS detection, and determining that the concentration of the final product reaches 76.9 g/L.

Example 12

Pseudomonas veronii CIP104663 was cultured in LB medium at 28.0 ℃ for 3 days at 180rpm, and the precipitate was collected by centrifugation, and purified Pseudomonas veronii genomic DNA was extracted using the DNA extraction and purification Kit Qiaamp Kit (Qiagen, Germany).

Carrying out PCR amplification on Pseudomonas veronii genome DNA by Pfu high fidelity enzyme, wherein the primer is

Pve-F 5' ATGGTGGCACAGCGAGCAAC 3'

Pve-R 5' TCATGCTAATTTTAAGGTACGGTCG 3'

Since the GC content of DNA of Pseudomonas veronii CIP104663 was close to 50%, it was directly amplified using Pfu high fidelity enzyme. Then, the amplified fragment was treated with Taq polymerase at 72 ℃ for 10 minutes to add base A to the 3' end of the DNA. This was then ligated into a pMD19T-simple (Takara Bao Bio Inc., Beijing) cloning vector, and single clones were picked up and sent to Nanjing Kinsry organisms for sequencing. The DNA sequence obtained by sequencing is SEQ ID NO.8, and the corresponding amino acid sequence is SEQ ID NO. 9.

Example 13

The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method, and the GC content of the DNA sequence is adjusted to 40-60 percent so as to realize high expression in Escherichia coli. The following primers were obtained by designing using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) with the Tm difference controlled to be within 3 ℃ and the Primer length controlled to be within 50 base:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10 U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 65 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO. 10.

An expression plasmid containing SEQ ID NO.10 was constructed in the manner shown in FIG. 6.

Example 14

Selecting a single escherichia coli colony containing an expression vector of SEQ ID NO.10 and inoculating the single escherichia coli colony in 10ml of an autoclaved culture medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L. The culture was carried out at 30 ℃ and 250rpm overnight. Taking a 1L triangular flask the next day, and carrying out the following steps: 100 into 100ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L. The cells were cultured at 30 ℃ until the OD 5-6 of the cells became zero, and the cells were immediately placed in a flask in a shaker at 25 ℃ and cultured at 250rpm for 1 hour. IPTG was added to a final concentration of 0.1mM and incubation was continued at 25 ℃ for 16 hours at 250 rpm. After completion of the culture, the culture was centrifuged at 12000g at 4 ℃ for 20 minutes to collect wet cells. Then the bacterial pellet is washed twice with distilled water, and the bacterial is collected and preserved at-70 ℃. Meanwhile, a small amount of thallus is taken for SDS-PAGE detection.

The results are shown in FIG. 7, in which lane 1 is the protein supernatant and lane 2 is the inclusion body. SDS-PAGE albumen glue shows that the expression quantity of the Escherichia coli containing the expression plasmid of SEQ ID NO.10 is high, and the requirements of biotransformation reaction experiments are met.

Example 15

0.1M potassium phosphate buffer (pH8.0), 65g/L of the cells containing the expression plasmid of SEQ ID NO.10, 60g/L L-lysine hydrochloride, 0.1mM NAD, were added to the mixture, and the reaction was opened to the atmosphere at 25 ℃ with the shaking table rotating at 180 rpm. The sample was continuously taken out for TLC detection, and when the reaction time was 16 hours, the detection result is shown in FIG. 8, and the result shows that a large amount of product was produced in 28 hours, and no residue remained. The product obtained was subjected to quantitative experiments and the final concentration of the product was 48.7 g/L. The samples were simultaneously sampled and subjected to LC-MS detection, and the detection results are shown in FIGS. 9 and 10.

Example 16

Streptomyces hirsutus ATCC 19091 was cultured in ATCC Medium 196 for 2 days at 180rpm at a temperature of 26.0 ℃ under centrifugation, and the precipitate was collected by centrifugation, and genomic DNA of Streptomyces hirsutus ATCC 19091 was extracted and purified using the DNA extraction and purification Kit Qiaamp Kit (Qiagen, Germany).

PCR amplification of Streptomyces hirsutus ATCC 19091 genomic DNA with Pfu Hi-Fi enzyme

Shi-F 5' ATCTTGCAAGCTGAGCGCACG 3'

Shi-R 5' TCATCGTCGCGCTCCGGC 3'

Since the local GC content of the DNA of Streptomyces hirsutus ATCC 19091 was close to 80%, betaine was added at a final concentration of 0.5M during amplification. Then, the amplified fragment was treated with Taq polymerase at 72 ℃ for 10 minutes to add base A to the 3' end of the DNA. This was then ligated into the pMD19T-simple (Takara Bao Bio Inc., Beijing) cloning vector, and a single clone was picked and sent to the Shanghai Jie plum organism for sequencing. The DNA sequence obtained by sequencing is SEQ ID NO.11, and the corresponding amino acid sequence is SEQ ID NO. 12.

Example 17

The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method, and the GC content of the DNA sequence is adjusted to 40-60 percent so as to realize high expression in Escherichia coli. The following primers were obtained by designing using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /) with the Tm difference controlled to be within 3 ℃ and the Primer length controlled to be within 50 base:

the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	The total volume of the reaction system was adjusted to 50. mu.l

The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 65 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO. 13.

An expression plasmid containing SEQ ID NO.13 was constructed in the manner shown in FIG. 11.

Example 18

The single colony of Escherichia coli containing the expression vector of SEQ ID NO.13 was selected and inoculated into 10ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L. The culture was carried out at 30 ℃ and 250rpm overnight. Taking a 1L triangular flask the next day, and carrying out the following steps: 100 into 100ml of autoclaved medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L. The cells were cultured at 30 ℃ until the OD 5-6 of the cells became zero, and the cells were immediately placed in a flask in a shaker at 25 ℃ and cultured at 250rpm for 1 hour. IPTG was added to a final concentration of 0.1mM and incubation was continued at 25 ℃ for 16 hours at 250 rpm. After completion of the culture, the culture was centrifuged at 12000g at 4 ℃ for 20 minutes to collect wet cells. Then the bacterial pellet is washed twice with distilled water, and the bacterial is collected and preserved at-70 ℃. Meanwhile, a small amount of thallus is taken for SDS-PAGE detection.

The results are shown in FIG. 12, in which lane 1 is the protein supernatant and lane 2 is the inclusion body. SDS-PAGE albumen glue shows that the expression quantity of the Escherichia coli containing the expression plasmid of SEQ ID NO.13 is high, and the requirements of biotransformation reaction experiments are met.

Example 19

0.1M potassium phosphate buffer (pH8.0), 50g/L of the cells containing the expression plasmid of SEQ ID NO.13, 55g/L L-lysine hydrochloride, 0.1mM NAD were added, and the reaction was opened to the atmosphere at 25 ℃ with the shaking table rotating at 180 rpm. The sample was continuously taken out for TLC detection, and when the reaction time was 16 hours, the detection result is shown in FIG. 13, and the result shows that a large amount of product was produced in 16 hours, and no residue remained. The product obtained was subjected to quantitative experiments and had a final concentration of 32 g/L. The samples were simultaneously sampled and subjected to LC-MS detection, and the detection results are shown in FIG. 14 and FIG. 15.

When L-lysine was added to the system, it was rapidly converted to L-lysine hydrochloride, and then the reaction was carried out in the same manner as in the previous example.

By using the novel enzyme protein of the present invention, the optimized gene sequence, and the optimized transformation process, L-2-piperidinecarboxylic acid, which is an industrially useful compound as a pharmaceutical intermediate, can be efficiently produced, and the process is simple and the yield is high. The substrate used for conversion is L-lysine which is industrially produced in large quantity, the price is low, the quotation of 98 percent content lysine is about 8.5-8.6 yuan/kg according to the domestic lysine market quotation in 2016 and 1 month, and the domestic yield can reach 120 tons only, thereby ensuring the sufficient supply of the substrate. The technology has strong portability, can be put into production only in a common fermentation workshop (such as an amino acid and vitamin production workshop), does not need to purchase special equipment, and is easy to popularize and apply. Compared with the current domestic production which mainly depends on a chemical resolution method, 50 percent of raw materials are resolved and wasted, a large amount of useless byproducts are generated, and the ee value of the product is lower. Therefore, the invention has stronger practicability and popularization value.

SEQUENCE LISTING

<110> Nanjing Nuo cloud Biotechnology Ltd

<120> method for synthesizing L-2-piperidinecarboxylic acid by whole-cell catalysis

<130> 2016

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 1053

<212> DNA

<213> Arenimonas donghaensis

<400> 1

atgaccatga cccagctcac cacccaggac ctgacccaga tcgtcgcgac ccacggcctg 60

ccgaccctgc tcggccgcct ggtggactac ctggaggccg acttccggcg ctgggaggac 120

ttcgacaaga gcccgcgttc ggcggcccac tccccgggcg gcgtgatcga actgatgccg 180

gtcgccgata ccaaggaata cagcttcaag tacgtcaacg gccacccggg caacaccaag 240

ctgggcctgt ccaccgtggt ggccttcggc gtgctcgccg acgtcgatac cggcatgccg 300

accctgatca gcgaactgac cctgaccacc gcgctgcgca ccgccgccac ctcggtgatg 360

gcggccaagc tgctggcgcg caaggattcc aggaccatgg cgctgatcgg caacggcgcc 420

cagagcgagt tccaggcgct ggccttccac cacctgctgg gcatccagga agtgcgtgtg 480

tacgacgtcg acccggccgc caccgacaag ctggtgcgca acctggccgc ggccgcgccg 540

gaactgcgcg tggtgcgcag caccggcgtc gcccaggccg tgcgcggcgc cgacatcgtc 600

accaccgtca ccgcggacaa ggccaatgcc gacatcctga cgccggaaat gatcgagccg 660

ggcatgcacc tcaacgccgt cggcggcgac tgcccgggca agaccgaact ggccacggag 720

gtggtcgcca acgcctcggt gttcgtcgag ttcgagccgc agtcgcgcat cgaaggcgag 780

gtgcagcaga tgcccgccaa ctccccggtc accgaactgt ggcgcgtgct gaccatgcag 840

gccgccggcc gccgcaacat cgccgaggtc accctgttcg actcggtcgg tttcgcgctg 900

gaggattatt cggcgctgcg cctggtgcgc gattgcgcca aggaaatggg cctgggccgc 960

gaagccagcc tcatccccgc cctggccgac ccgaagaacc tgttcggcga gctggccgcg 1020

gcaccccagg ccgcgcgcaa gcaggcggcc tga 1053

<210> 2

<211> 350

<212> PRT

<213> Arenimonas donghaensis

<400> 2

Met Thr Met Thr Gln Leu Thr Thr Gln Asp Leu Thr Gln Ile Val Ala

1 5 10 15

Thr His Gly Leu Pro Thr Leu Leu Gly Arg Leu Val Asp Tyr Leu Glu

20 25 30

Ala Asp Phe Arg Arg Trp Glu Asp Phe Asp Lys Ser Pro Arg Ser Ala

35 40 45

Ala His Ser Pro Gly Gly Val Ile Glu Leu Met Pro Val Ala Asp Thr

50 55 60

Lys Glu Tyr Ser Phe Lys Tyr Val Asn Gly His Pro Gly Asn Thr Lys

65 70 75 80

Leu Gly Leu Ser Thr Val Val Ala Phe Gly Val Leu Ala Asp Val Asp

85 90 95

Thr Gly Met Pro Thr Leu Ile Ser Glu Leu Thr Leu Thr Thr Ala Leu

100 105 110

Arg Thr Ala Ala Thr Ser Val Met Ala Ala Lys Leu Leu Ala Arg Lys

115 120 125

Asp Ser Arg Thr Met Ala Leu Ile Gly Asn Gly Ala Gln Ser Glu Phe

130 135 140

Gln Ala Leu Ala Phe His His Leu Leu Gly Ile Gln Glu Val Arg Val

145 150 155 160

Tyr Asp Val Asp Pro Ala Ala Thr Asp Lys Leu Val Arg Asn Leu Ala

165 170 175

Ala Ala Ala Pro Glu Leu Arg Val Val Arg Ser Thr Gly Val Ala Gln

180 185 190

Ala Val Arg Gly Ala Asp Ile Val Thr Thr Val Thr Ala Asp Lys Ala

195 200 205

Asn Ala Asp Ile Leu Thr Pro Glu Met Ile Glu Pro Gly Met His Leu

210 215 220

Asn Ala Val Gly Gly Asp Cys Pro Gly Lys Thr Glu Leu Ala Thr Glu

225 230 235 240

Val Val Ala Asn Ala Ser Val Phe Val Glu Phe Glu Pro Gln Ser Arg

245 250 255

Ile Glu Gly Glu Val Gln Gln Met Pro Ala Asn Ser Pro Val Thr Glu

260 265 270

Leu Trp Arg Val Leu Thr Met Gln Ala Ala Gly Arg Arg Asn Ile Ala

275 280 285

Glu Val Thr Leu Phe Asp Ser Val Gly Phe Ala Leu Glu Asp Tyr Ser

290 295 300

Ala Leu Arg Leu Val Arg Asp Cys Ala Lys Glu Met Gly Leu Gly Arg

305 310 315 320

Glu Ala Ser Leu Ile Pro Ala Leu Ala Asp Pro Lys Asn Leu Phe Gly

325 330 335

Glu Leu Ala Ala Ala Pro Gln Ala Ala Arg Lys Gln Ala Ala

340 345 350

<210> 3

<211> 1053

<212> DNA

<213> Artificial sequence

<400> 3

atgaccatga cccagctgac cacccaggac ctgacccaga tcgttgctac ccacggtctg 60

ccgaccctgc tgggtcgtct ggttgactac ctggaagctg acttccgtcg ttgggaagac 120

ttcgacaaat ctccgcgttc tgctgctcac tctccgggtg gtgttatcga actgatgccg 180

gttgctgaca ccaaagaata ctctttcaaa tacgttaacg gtcacccggg taacaccaaa 240

ctgggtctgt ctaccgttgt tgctttcggt gttctggctg acgttgacac cggtatgccg 300

accctgatct ctgaactgac cctgaccacc gctctgcgta ccgctgctac ctctgttatg 360

gctgctaaac tgctggctcg taaagactct cgtaccatgg ctctgatcgg taacggtgct 420

cagtctgaat tccaggctct ggctttccac cacctgctgg gtatccagga agttcgtgtt 480

tacgacgttg acccggctgc taccgacaaa ctggttcgta acctggctgc tgctgctccg 540

gaactgcgtg ttgttcgttc taccggtgtt gctcaggctg ttcgtggtgc tgacatcgtt 600

accaccgtta ccgctgacaa agctaacgct gacatcctga ccccggaaat gatcgaaccg 660

ggtatgcacc tgaacgctgt tggtggtgac tgcccgggta aaaccgaact ggctaccgaa 720

gttgttgcta acgcttctgt tttcgttgaa ttcgaaccgc agtctcgtat cgaaggtgaa 780

gttcagcaga tgccggctaa ctctccggtt accgaactgt ggcgtgttct gaccatgcag 840

gctgctggtc gtcgtaacat cgctgaagtt accctgttcg actctgttgg tttcgctctg 900

gaagactact ctgctctgcg tctggttcgt gactgcgcta aagaaatggg tctgggtcgt 960

gaagcttctc tgatcccggc tctggctgac ccgaaaaacc tgttcggtga actggctgct 1020

gctccgcagg ctgctcgtaa acaggctgct taa 1053

<210> 4

<211> 1053

<212> DNA

<213> Artificial sequence

<400> 4

atgactatga ctcaactgac tactcaagac ctcactcaga ttgttgctac ccatggtctc 60

ccaaccctgc tcggtcgtct ggttgactat ctcgaagcgg acttccgccg ttgggaagac 120

ttcgacaagt ccccacgttc tgctgctcac tctccaggcg gtgttattga actcatgccg 180

gttgcggaca ccaaagaata ctctttcaaa tacgtgaacg gtcacccggg caataccaaa 240

ctcggtctct ctactgttgt tgcgttcggt gttctcgcgg atgttgacac tggtatgcca 300

actctcatct ctgagctgac cctgaccact gcgctccgta ccgctgcgac ttctgttatg 360

gcggcgaaac tgctggcgcg taaagactct cgtaccatgg ctctgatcgg taatggtgcg 420

cagtccgaat ttcaagcgct ggctttccac cacctgctgg gtatccagga agttcgtgtg 480

tacgacgtgg acccagcggc gactgataaa ctggttcgta acctggcggc tgctgcgcca 540

gaactgcgcg ttgttcgttc taccggtgtt gctcaagcgg tgcgtggcgc tgatatcgtt 600

actaccgtta ccgcggacaa ggcgaacgct gacatcctga ccccggaaat gatcgaaccg 660

ggtatgcacc tgaatgcggt tggtggtgat tgtccgggta aaactgaact ggcgaccgaa 720

gtggttgcga atgcgtctgt ttttgtggaa tttgaaccgc agtctcgtat cgaaggtgaa 780

gttcagcaaa tgccggcgaa ctccccagtt accgagctgt ggcgtgttct gaccatgcag 840

gctgcgggtc gtcgtaacat cgcggaggtt accctctttg attctgttgg tttcgctctg 900

gaggactatt ccgcgctgcg tctcgttcgc gattgcgcga aagaaatggg tctcggccgt 960

gaggcttccc tcattccagc tctggcggac ccgaaaaatc tgtttggtga actcgctgcg 1020

gctccacaag ctgctcgcaa acaggcggcg taa 1053

<210> 5

<211> 1053

<212> DNA

<213> Artificial sequence

<400> 5

atgaccatga cccagctgac cacccaggat ctgacccaga tcgttgcgac ccacggtctg 60

ccgaccctgc tgggccgtct ggttgactac ctggaagcgg acttccgtcg ttgggaagat 120

ttcgacaaat ctccgcgttc tgcggcgcac tctccgggtg gcgttatcga actgatgccg 180

gttgcggata ccaaagaata ctctttcaaa tatgttaacg gtcacccggg caacaccaaa 240

ctgggcctgt ctaccgttgt tgcgttcggc gttctggcgg atgttgacac cggtatgccg 300

accctgatct ctgaactgac cctgaccacc gcgctgcgta ccgcggcgac ctctgttatg 360

gcggcgaaac tgctggcgcg taaagactct cgtaccatgg cgctgatcgg caacggtgcg 420

cagtctgaat tccaggcgct ggcgttccac cacctgctgg gtatccagga agttcgtgtt 480

tatgacgttg atccggcggc gaccgataaa ctggttcgta acctggcggc ggcggcgccg 540

gaactgcgtg ttgttcgttc taccggtgtt gcgcaggcgg ttcgtggtgc ggacatcgtt 600

accaccgtta ccgcggacaa agcgaacgcg gatatcctga ccccggaaat gatcgaaccg 660

ggtatgcacc tgaacgcggt tggtggcgac tgtccgggta aaaccgaact ggcgaccgaa 720

gttgttgcga acgcgtctgt tttcgttgaa ttcgaaccgc agtctcgtat cgaaggcgaa 780

gttcagcaga tgccggcgaa ctctccggtt accgaactgt ggcgtgttct gaccatgcag 840

gcggcgggtc gtcgtaacat cgcggaagtt accctgttcg attctgttgg tttcgcgctg 900

gaagactatt ctgcgctgcg tctggttcgt gattgtgcga aagaaatggg cctgggtcgt 960

gaagcgtctc tgatcccggc gctggcggac ccgaaaaacc tgttcggtga actggcggcg 1020

gcgccgcagg cggcgcgtaa acaggcggcg taa 1053

<210> 6

<211> 1053

<212> DNA

<213> Artificial sequence

<400> 6

atgaccatga cccagctgac tactcaggac ctgactcaga tcgttgctac ccacggtctg 60

ccgactctgc tgggccgtct ggtggattac ctggaagcgg acttccgtcg ctgggaagac 120

tttgacaaat ccccgcgctc cgcggctcat tctccgggtg gtgttatcga actgatgccg 180

gttgcggaca ccaaagaata ctctttcaaa tacgtgaacg gtcacccggg caacactaaa 240

ctgggtctgt ccaccgtggt tgcgtttggc gttctggctg atgtggatac tggtatgccg 300

accctgatct ctgaactgac tctgaccacc gctctgcgta ccgctgctac ttctgttatg 360

gcggcgaaac tgctggctcg caaagactct cgtaccatgg cgctgatcgg caacggcgct 420

cagtctgaat ttcaggctct ggcttttcat cacctgctgg gtatccagga agttcgtgtg 480

tacgacgttg acccggctgc gaccgacaaa ctggttcgca acctggcggc tgctgctccg 540

gaactgcgtg tggttcgttc taccggtgtg gctcaggctg tgcgtggtgc ggatattgtt 600

accactgtta ccgcggacaa agcgaacgct gatatcctga ccccggaaat gatcgaaccg 660

ggcatgcacc tgaacgcggt tggtggtgat tgtccgggta aaaccgaact ggcgactgaa 720

gttgttgcta acgcgtccgt gtttgttgaa tttgaaccgc agtcccgcat cgaaggtgaa 780

gttcagcaga tgccggcgaa ctccccggtt actgaactgt ggcgtgttct gactatgcag 840

gcggctggcc gtcgtaacat cgcggaagtt actctgttcg attctgtggg cttcgctctg 900

gaagattatt ctgcgctgcg cctggtgcgc gactgtgcga aagaaatggg cctgggtcgt 960

gaagcgtccc tgattccggc gctggcggac ccgaaaaacc tgttcggtga actggctgcg 1020

gctccgcagg ctgcgcgtaa acaggctgct taa 1053

<210> 7

<211> 1053

<212> DNA

<213> Artificial sequence

<400> 7

atgactatga cccaactgac tactcaggac ctgactcaga tcgttgcgac ccacggcctg 60

ccgaccctgc tgggccgtct ggtagactac ctggaagcgg acttccgtcg ttgggaagac 120

tttgacaaat ctccgcgttc tgcggcgcac tccccgggtg gcgttatcga actgatgccg 180

gtagcggata ccaaggaata ctctttcaaa tatgttaacg gtcatccggg caacaccaaa 240

ctgggtctgt ctaccgtagt agcgttcggt gttctggcgg acgttgacac tggtatgccg 300

actctgatta gcgagctgac cctgaccacc gcgctgcgta ccgcggcaac ctctgtaatg 360

gcggcaaaac tgctggcgcg caaagactct cgtaccatgg cgctgatcgg caacggtgcg 420

caatctgaat tccaagcgct ggcgttccac catctgctgg gtatccagga ggttcgtgtt 480

tatgacgtgg acccggcagc gaccgataaa ctggttcgta atctggctgc ggctgcaccg 540

gaactgcgcg tagttcgttc tactggcgtg gctcaggctg tgcgtggtgc ggacattgtt 600

accaccgtta ccgctgacaa agcgaacgca gatatcctga ccccggaaat gattgagccg 660

ggtatgcatc tgaacgctgt aggtggtgac tgcccgggta aaaccgagct ggcaactgaa 720

gtggttgcta atgcgtctgt tttcgttgaa ttcgaaccgc agtctcgtat cgaaggcgaa 780

gttcagcaaa tgccggctaa ctctccggtt actgagctgt ggcgtgtact gaccatgcag 840

gcagctggtc gccgtaacat cgcggaagtt accctgtttg acagcgtagg tttcgcactg 900

gaagattatt ctgcactgcg cctggtgcgc gactgtgcaa aagaaatggg cctgggtcgt 960

gaggcaagcc tgatcccggc actggctgat ccgaaaaacc tgttcggcga actggcagcg 1020

gctccgcagg ctgctcgcaa acaagcggca taa 1053

<210> 8

<211> 1116

<212> DNA

<213> Pseudomonas veronii

<400> 8

atggtggcac agcgagcaac tattatcctc tctgaggaaa acattggtga aattgtcgca 60

gcagtcgggc tcgacacttt aatggatgaa acgattgcaa aactacgtga tgccctcaac 120

gtgtttggtg atggccaggt tgaaatacaa ccgcgcaccg gctttgtcta tgaaactccg 180

gaaatggggc tgatagagtt tatgccggct taccgccggg ataaaaatgt cgcgttaaaa 240

gttgttggct accatccggg aaatccgttt aaccggggca tgccgacggt catcgccact 300

aactccctat atgacgtaag ggacggccac cttattgcgg tgatcgatgg tgtatttgca 360

acagcagtac gaacgggcgc agcatccgct gtggcttcga agttgctggc tcatcctgaa 420

agcaaaaccc ttgggctgat cggagctggc gccatggcag tgacccaggc ccatgccctc 480

agtcgaattt atgactttga cgcagtcttg atccacgata ttgaccccgc agtggaaaaa 540

actttcgcca agcgggtatc cgccctggga attacaccga tcatcgcttc caaagacagg 600

gtactggcag agtccgacat catctgtgtt gctacctcca ttggccttga tgcaggcccg 660

gttctccacg ctggcgggat gaaaccacat gtacacatca atgctattgg tgccgacacg 720

ccgcgcaaat atgaattatc aacagagctg ctcaaaagct cgttccttgt cacggattat 780

ctggaacagg ccattaacga aggtgaatgc cagcaattga gtaaagacga atacggctat 840

atcggccctg agttgcacaa aatagtgaaa gagccgcaag cctatatcca atatcagatg 900

aaacagacca tctttgatag caccggtatt tcattggaag atcagataat gaccgaggtc 960

ttgatcgatc aggcggagag actagggctt ggtcagcgga tcctgattga agcgggatgt 1020

gatgacccca tgaacccata tcttttctca aattccgcga acgctcttga taccgtcaag 1080

aatacagtgc acgaccgtac cttaaaatta gcatga 1116

<210> 9

<211> 371

<212> PRT

<213> Pseudomonas veronii

<400> 9

Met Val Ala Gln Arg Ala Thr Ile Ile Leu Ser Glu Glu Asn Ile Gly

1 5 10 15

Glu Ile Val Ala Ala Val Gly Leu Asp Thr Leu Met Asp Glu Thr Ile

20 25 30

Ala Lys Leu Arg Asp Ala Leu Asn Val Phe Gly Asp Gly Gln Val Glu

35 40 45

Ile Gln Pro Arg Thr Gly Phe Val Tyr Glu Thr Pro Glu Met Gly Leu

50 55 60

Ile Glu Phe Met Pro Ala Tyr Arg Arg Asp Lys Asn Val Ala Leu Lys

65 70 75 80

Val Val Gly Tyr His Pro Gly Asn Pro Phe Asn Arg Gly Met Pro Thr

85 90 95

Val Ile Ala Thr Asn Ser Leu Tyr Asp Val Arg Asp Gly His Leu Ile

100 105 110

Ala Val Ile Asp Gly Val Phe Ala Thr Ala Val Arg Thr Gly Ala Ala

115 120 125

Ser Ala Val Ala Ser Lys Leu Leu Ala His Pro Glu Ser Lys Thr Leu

130 135 140

Gly Leu Ile Gly Ala Gly Ala Met Ala Val Thr Gln Ala His Ala Leu

145 150 155 160

Ser Arg Ile Tyr Asp Phe Asp Ala Val Leu Ile His Asp Ile Asp Pro

165 170 175

Ala Val Glu Lys Thr Phe Ala Lys Arg Val Ser Ala Leu Gly Ile Thr

180 185 190

Pro Ile Ile Ala Ser Lys Asp Arg Val Leu Ala Glu Ser Asp Ile Ile

195 200 205

Cys Val Ala Thr Ser Ile Gly Leu Asp Ala Gly Pro Val Leu His Ala

210 215 220

Gly Gly Met Lys Pro His Val His Ile Asn Ala Ile Gly Ala Asp Thr

225 230 235 240

Pro Arg Lys Tyr Glu Leu Ser Thr Glu Leu Leu Lys Ser Ser Phe Leu

245 250 255

Val Thr Asp Tyr Leu Glu Gln Ala Ile Asn Glu Gly Glu Cys Gln Gln

260 265 270

Leu Ser Lys Asp Glu Tyr Gly Tyr Ile Gly Pro Glu Leu His Lys Ile

275 280 285

Val Lys Glu Pro Gln Ala Tyr Ile Gln Tyr Gln Met Lys Gln Thr Ile

290 295 300

Phe Asp Ser Thr Gly Ile Ser Leu Glu Asp Gln Ile Met Thr Glu Val

305 310 315 320

Leu Ile Asp Gln Ala Glu Arg Leu Gly Leu Gly Gln Arg Ile Leu Ile

325 330 335

Glu Ala Gly Cys Asp Asp Pro Met Asn Pro Tyr Leu Phe Ser Asn Ser

340 345 350

Ala Asn Ala Leu Asp Thr Val Lys Asn Thr Val His Asp Arg Thr Leu

355 360 365

Lys Leu Ala

370

<210> 10

<211> 1116

<212> DNA

<213> Artificial sequence

<400> 10

atggttgctc agcgtgctac catcatcctg tctgaagaaa acatcggtga aatcgttgct 60

gctgttggtc tggacaccct gatggacgaa accatcgcta aactgcgtga cgctctgaac 120

gttttcggtg acggtcaggt tgaaatccag ccgcgtaccg gtttcgttta cgaaaccccg 180

gaaatgggtc tgatcgaatt catgccggct taccgtcgtg acaaaaacgt tgctctgaaa 240

gttgttggtt accacccggg taacccgttc aaccgtggta tgccgaccgt tatcgctacc 300

aactctctgt acgacgttcg tgacggtcac ctgatcgctg ttatcgacgg tgttttcgct 360

accgctgttc gtaccggtgc tgcttctgct gttgcttcta aactgctggc tcacccggaa 420

tctaaaaccc tgggtctgat cggtgctggt gctatggctg ttacccaggc tcacgctctg 480

tctcgtatct acgacttcga cgctgttctg atccacgaca tcgacccggc tgttgaaaaa 540

accttcgcta aacgtgtttc tgctctgggt atcaccccga tcatcgcttc taaagaccgt 600

gttctggctg aatctgacat catctgcgtt gctacctcta tcggtctgga cgctggtccg 660

gttctgcacg ctggtggtat gaaaccgcac gttcacatca acgctatcgg tgctgacacc 720

ccgcgtaaat acgaactgtc taccgaactg ctgaaatctt ctttcctggt taccgactac 780

ctggaacagg ctatcaacga aggtgaatgc cagcagctgt ctaaagacga atacggttac 840

atcggtccgg aactgcacaa aatcgttaaa gaaccgcagg cttacatcca gtaccagatg 900

aaacagacca tcttcgactc taccggtatc tctctggaag accagatcat gaccgaagtt 960

ctgatcgacc aggctgaacg tctgggtctg ggtcagcgta tcctgatcga agctggttgc 1020

gacgacccga tgaacccgta cctgttctct aactctgcta acgctctgga caccgttaaa 1080

aacaccgttc acgaccgtac cctgaaactg gcttaa 1116

<210> 11

<211> 1095

<212> DNA

<213> Streptomyces hirsutus

<400> 11

atgatcttgc aagctgagcg cacgcacatc gtcgacgccg aagccgtcgc caccatcgtc 60

acgaaggtgg gactggggca actctacgac ctgaccatcg cccgcatgga ggcggctctc 120

accggtggac ccggtgcgcc ggtggagatg aagcagcggg acggtttcct gctggagaca 180

ccgcagttgg gcctgctcga gtggatgccg gcggtccgcc aaggcaccac ggtctccatc 240

aagatggtcg cctacaaccc gcacaatccg gtcaagaacc agctgcccac catcctgtcg 300

acactgtgcg ccttcgacac ggacagcggc caccttcgtg ccgtcgtcga cggcacgttc 360

gccaccgccg tccgtacggg cgcggcgtcc gcactggcca gccgggtgct cgctcgcccg 420

gactccgccg tgctcggcct ggtgggctgc ggtgcccagg cggtcacgca gttgcacgcc 480

ctggcacgcg tcttctcgtt ctccgaggtg ctcgtccacg acaaggacgc gcgggcggag 540

cgatccttcg cggcgagggc ccggatgccc gaggggctgg tgcgcgtcgc gccgctcgcg 600

gaggtggagg agcgggccga cgtgctgtgc accgccacct cggtcggccc ccacgagggg 660

ccggtcatcc ggggcacgtc actcaagccc tgggtgcacg tcaacaccat cggatcggac 720

atgccgggca agacggagct gccgctggac cttctgcgcg cggcggtcgt ctgcccggac 780

cacgtggagc aggcacgggc cgagggtgac tgccagcagc tcgcccccga ggagatcggg 840

gctccgctcc ccgacctgct gcgtgatccg gacgcgcacc gcaggctgtc gccggtcacc 900

accgtgtacg actcgacagg tctcgcgctg caggatctcg tcatggtgga ggtgctggag 960

gagttggcgc gggacctcga cgtcggacac cacgtcttca tcgaggcgac ggccgacgac 1020

ccgcaggacc cgtactcgtt cctccctgcg gaggtcaccc ggtccctggc cggcacggcc 1080

ggagcgcgac gatga 1095

<210> 12

<211> 364

<212> PRT

<213> Streptomyces hirsutus

<400> 12

Met Ile Leu Gln Ala Glu Arg Thr His Ile Val Asp Ala Glu Ala Val

1 5 10 15

Ala Thr Ile Val Thr Lys Val Gly Leu Gly Gln Leu Tyr Asp Leu Thr

20 25 30

Ile Ala Arg Met Glu Ala Ala Leu Thr Gly Gly Pro Gly Ala Pro Val

35 40 45

Glu Met Lys Gln Arg Asp Gly Phe Leu Leu Glu Thr Pro Gln Leu Gly

50 55 60

Leu Leu Glu Trp Met Pro Ala Val Arg Gln Gly Thr Thr Val Ser Ile

65 70 75 80

Lys Met Val Ala Tyr Asn Pro His Asn Pro Val Lys Asn Gln Leu Pro

85 90 95

Thr Ile Leu Ser Thr Leu Cys Ala Phe Asp Thr Asp Ser Gly His Leu

100 105 110

Arg Ala Val Val Asp Gly Thr Phe Ala Thr Ala Val Arg Thr Gly Ala

115 120 125

Ala Ser Ala Leu Ala Ser Arg Val Leu Ala Arg Pro Asp Ser Ala Val

130 135 140

Leu Gly Leu Val Gly Cys Gly Ala Gln Ala Val Thr Gln Leu His Ala

145 150 155 160

Leu Ala Arg Val Phe Ser Phe Ser Glu Val Leu Val His Asp Lys Asp

165 170 175

Ala Arg Ala Glu Arg Ser Phe Ala Ala Arg Ala Arg Met Pro Glu Gly

180 185 190

Leu Val Arg Val Ala Pro Leu Ala Glu Val Glu Glu Arg Ala Asp Val

195 200 205

Leu Cys Thr Ala Thr Ser Val Gly Pro His Glu Gly Pro Val Ile Arg

210 215 220

Gly Thr Ser Leu Lys Pro Trp Val His Val Asn Thr Ile Gly Ser Asp

225 230 235 240

Met Pro Gly Lys Thr Glu Leu Pro Leu Asp Leu Leu Arg Ala Ala Val

245 250 255

Val Cys Pro Asp His Val Glu Gln Ala Arg Ala Glu Gly Asp Cys Gln

260 265 270

Gln Leu Ala Pro Glu Glu Ile Gly Ala Pro Leu Pro Asp Leu Leu Arg

275 280 285

Asp Pro Asp Ala His Arg Arg Leu Ser Pro Val Thr Thr Val Tyr Asp

290 295 300

Ser Thr Gly Leu Ala Leu Gln Asp Leu Val Met Val Glu Val Leu Glu

305 310 315 320

Glu Leu Ala Arg Asp Leu Asp Val Gly His His Val Phe Ile Glu Ala

325 330 335

Thr Ala Asp Asp Pro Gln Asp Pro Tyr Ser Phe Leu Pro Ala Glu Val

340 345 350

Thr Arg Ser Leu Ala Gly Thr Ala Gly Ala Arg Arg

355 360

<210> 13

<211> 1095

<212> DNA

<213> Artificial sequence

<400> 13

atgatcctgc aggctgaacg tacccacatc gttgacgctg aagctgttgc taccatcgtt 60

accaaagttg gtctgggtca gctgtacgac ctgaccatcg ctcgtatgga agctgctctg 120

accggtggtc cgggtgctcc ggttgaaatg aaacagcgtg acggtttcct gctggaaacc 180

ccgcagctgg gtctgctgga atggatgccg gctgttcgtc agggtaccac cgtttctatc 240

aaaatggttg cttacaaccc gcacaacccg gttaaaaacc agctgccgac catcctgtct 300

accctgtgcg ctttcgacac cgactctggt cacctgcgtg ctgttgttga cggtaccttc 360

gctaccgctg ttcgtaccgg tgctgcttct gctctggctt ctcgtgttct ggctcgtccg 420

gactctgctg ttctgggtct ggttggttgc ggtgctcagg ctgttaccca gctgcacgct 480

ctggctcgtg ttttctcttt ctctgaagtt ctggttcacg acaaagacgc tcgtgctgaa 540

cgttctttcg ctgctcgtgc tcgtatgccg gaaggtctgg ttcgtgttgc tccgctggct 600

gaagttgaag aacgtgctga cgttctgtgc accgctacct ctgttggtcc gcacgaaggt 660

ccggttatcc gtggtacctc tctgaaaccg tgggttcacg ttaacaccat cggttctgac 720

atgccgggta aaaccgaact gccgctggac ctgctgcgtg ctgctgttgt ttgcccggac 780

cacgttgaac aggctcgtgc tgaaggtgac tgccagcagc tggctccgga agaaatcggt 840

gctccgctgc cggacctgct gcgtgacccg gacgctcacc gtcgtctgtc tccggttacc 900

accgtttacg actctaccgg tctggctctg caggacctgg ttatggttga agttctggaa 960

gaactggctc gtgacctgga cgttggtcac cacgttttca tcgaagctac cgctgacgac 1020

ccgcaggacc cgtactcttt cctgccggct gaagttaccc gttctctggc tggtaccgct 1080

ggtgctcgtc gttaa 1095

Claims (5)

1. A method for synthesizing L-2-piperidinecarboxylic acid by whole-cell biocatalysis is characterized in that L-lysine hydrochloride or L-lysine is used as a substrate, nicotinamide adenine dinucleotide and recombinant host bacteria are added, and L-2-piperidinecarboxylic acid is prepared by biocatalysis; wherein the recombinant host bacterium is a strain containingArenimonasdonghaensisRecombinant host bacterium containing gene encoding DSM 18148 proteinPseudomonas veroniiRecombinant host bacterium containing CIP104663 protein coding gene or recombinant host bacterium containing CIP104663 protein coding geneStreptomyceshirsutusAny one of recombinant host bacteria of ATCC 19091 protein coding gene;

the above-mentionedArenimonasdonghaensisThe DNA sequence of the gene encoding the DSM 18148 protein is SEQ ID NO. 5;

the above-mentionedPseudomonas veroniiThe DNA sequence of the CIP104663 protein coding gene is SEQ ID NO. 10;

the above-mentionedStreptomyceshirsutusThe DNA sequence of the ATCC 19091 protein coding gene is SEQ ID NO. 13;

the recombinant host bacterium is escherichia coli.

2. The method for the whole-cell biocatalytic synthesis of L-2-piperidinecarboxylic acid as claimed in claim 1, wherein the reaction is carried out in a pH8.0 potassium phosphate buffer solution.

3. The method for the whole-cell biocatalytic synthesis of L-2-piperidinecarboxylic acid as claimed in claim 1, wherein the reaction temperature is 20 ℃ to 30 ℃.

4. The method for the whole-cell biocatalytic synthesis of L-2-piperidinecarboxylic acid as claimed in claim 1, wherein the reaction is carried out on a shaker at a rate of 180 rpm.

5. The method for the whole-cell biocatalytic synthesis of L-2-piperidinecarboxylic acid as claimed in claim 1, wherein the concentration of the recombinant host bacteria is 50g/L-150 g/L.

Images