CN107287256A

CN107287256A - The method that whole-cell catalytic synthesizes L-2- piperidine carboxylic acids

Info

Publication number: CN107287256A
Application number: CN201610196785.3A
Authority: CN
Inventors: 朱惠霖; 丁雪峰; 陈令伟; 娄向弟
Original assignee: NANJING NUOYUN BIOTECHNOLOGY Co Ltd
Current assignee: NANJING NUOYUN BIOTECHNOLOGY Co Ltd
Priority date: 2016-03-31
Filing date: 2016-03-31
Publication date: 2017-10-24
Anticipated expiration: 2036-03-31
Also published as: CN107287256B

Abstract

The invention belongs to biocatalysis technology field, and in particular to the method that whole-cell catalytic synthesizes the piperidine carboxylic acids of L 2.The method of the Whole Cell Biocatalysis synthesis piperidine carboxylic acids of L 2 disclosed in this invention is using L lysine hydrochlorides as substrate, by adding NADH and the recombinant host bacterium containing the protein coding genes of Arenimonas donghaensis DSM 18148 or the recombinant host bacterium containing Pseudomonas veronii CIP104663 protein coding genes or recombinant host bacterium containing the protein coding genes of Streptomyces hirsutus ATCC 19091, pass through living things catalysis and prepare the piperidine carboxylic acids of L 2.So as to overcome current chemical synthesis cost height, condition harshness, low conversion ratio, high energy consumption, heavy-polluted problem.The efficiency high while living things catalysis system enzyme disclosed in this invention is lived, the reaction time is short, and target product ee values are high.

Description

The method that whole-cell catalytic synthesizes L-2- piperidine carboxylic acids

Technical field

The invention belongs to biocatalysis technology field, and in particular to the method that whole-cell catalytic synthesizes L-2- piperidine carboxylic acids.

Background technology

L-2- piperidine carboxylic acids are a kind of naturally occurring nonprotein amino acids, are important chirality pharmaceutical intermediate compounds, can For preparing rapamycin, antitumor agent VX-710, Immunosuppressive drug FK506, piperidine alkaloid etc., with very high production Industry application value.Current main production process is chemical synthesis, there is low yield, high energy consumption, the shortcomings of polluting big.Together When ee values be difficult to control to.

Fujii etc. utilizes the Escherichia coli for recombinantly expressing 1B -6- aminopherases and dihydropyrrol-5-carboxylic acid ester reductase Engineering bacteria, 3.9g/L products have been run up at 159 hours.Subsequently through addition lysP lysines permease and yeiE, 111 Hour highest runs up to 16g/L.Program subject matter is that the reaction time is long, and product formation is very few, real cost of production It is too high, it is difficult to amplification production.

Yasushi Tani et al. are by the LysR that is co-expressed, rAIP, DpkA, totally four albumen such as GDH, realize from The conversion of DL-lysine to L-2- piperidine carboxylic acids, 46 hours product yields reach 87.4%, but are related to being total to for multiple albumen Expression, there is strain, to build difficulty big, the shortcomings of poor repeatability.

Ying etc. utilizes the Escherichia coli containing pipA genes as whole-cell catalyst, and optimizes NAD concentration, reacts Temperature, reaction pH, metal ion and expression activity agent addition etc., final product can reach 17.25g/L.In the program PipA enzyme activity is not high, result in using full cell concentration excessively (OD=200), concentration of substrate is not high (lysine 25g/L), and need To add substrate in batches could react complete.These factors can cause the problems such as cost is too high when amplifying production.

The content of the invention

For problems of the prior art, the purpose of the present invention is a kind of efficient living things catalysis system of exploitation, with Phase improves substrate throwing amount, shortens the reaction time, and can obtain the product of high ee values.

In order to realize above-mentioned goal of the invention, the technical scheme of use of the invention is as follows：

The method that Whole Cell Biocatalysis synthesizes L-2- piperidine carboxylic acids, using L lysine HCL or 1B as substrate, by adding Plus NADH and recombinant host bacterium, L-2- piperidine carboxylic acids are prepared by living things catalysis；Wherein recombinant host bacterium For the recombinant host bacterium containing the protein coding genes of Arenimonas donghaensis DSM 18148, contain Pseudomonas The recombinant host bacterium of veronii CIP104663 protein coding genes contains the eggs of Streptomyces hirsutus ATCC 19091 Any one in the recombinant host bacterium of white encoding gene.Wherein, the recombinant host bacterium is Escherichia coli.

Further, reaction is carried out in pH8.0 buffer solution of potassium phosphate.

Preferably, reaction temperature is 20 DEG C -30 DEG C.

Meanwhile, we further preferably disclose reaction and carried out on shaking table, and shaking speed is 180rpm.

Finally, the concentration for we disclosing wherein recombinant host bacterium is 50g/L-150g/L.

The method that L-2- piperidine carboxylic acids are synthesized using whole-cell catalytic disclosed in this invention, overcomes current chemical synthesis Cost height, condition harshness, low conversion ratio, high energy consumption, heavy-polluted problem.While living things catalysis system disclosed in this invention Enzyme activity efficiency high, the reaction time is short, and target product ee values are high.

Brief description of the drawings

Fig. 1 is NYPDc expression plasmid collection of illustrative plates

Fig. 2 is NYPDa, NYPDb, NYPDc, NYPDd, NYPDe protein expression supernatant, inclusion body SDS-PAGE Collection of illustrative plates

Fig. 3 is the TLC collection of illustrative plates of bioconversion reaction in embodiment 8

Fig. 4 is the HPLC spectrograms of L-2- piperidine carboxylic acids in embodiment 8

Fig. 5 is the MS spectrograms of L-2- piperidine carboxylic acids in embodiment 8

Fig. 6 is SEQ ID NO.10 expression plasmid collection of illustrative plates

Fig. 7 is the SDS-PAGE collection of illustrative plates of the Escherichia coli containing SEQ ID NO.10 expression plasmids.

Fig. 8 is the TLC collection of illustrative plates of bioconversion reaction in embodiment 15

Fig. 9 is the HPLC spectrograms of L-2- piperidine carboxylic acids in embodiment 15

Figure 10 is the MS spectrograms of L-2- piperidine carboxylic acids in embodiment 15

Figure 11 is SEQ ID NO.13 expression plasmid collection of illustrative plates

Figure 12 is the SDS-PAGE collection of illustrative plates of the Escherichia coli containing SEQ ID NO.13 expression plasmids.

Figure 13 is the TLC collection of illustrative plates of bioconversion reaction in embodiment 19

Figure 14 is the HPLC spectrograms of L-2- piperidine carboxylic acids in embodiment 19

Figure 15 is the MS spectrograms of L-2- piperidine carboxylic acids in embodiment 19

Embodiment

In order to preferably explain the present invention, with reference to embodiment, the present invention will be further elaborated.In the present embodiment In used instrument, reagent, be commercially available prod unless there are specified otherwise.

In the TLC detections being related in following examples：

Solvent：Chloroform：Methanol：Water=6:5:1,10min or so is placed after mixing.

Silica gel plate specification：Tlc silica gel plate 5*10.

Developer：Ninhydrin colour developing 100ml ethanol adds 0.1g ninhydrins, and 500ul glacial acetic acids are mixed.

The LC-MS testing conditions being related in following instance are：

Prevail C18 chromatographic columns (250 × 4.6mm, i.d.5 μm)；Column temperature：30℃；Mobile phase：0.4% (v/v) three The fluoroacetic acid aqueous solution；Flow velocity：0.5ml/min；Detector：EISD (ELSD)；Detector temperature： 120℃；Carrier gas：Nitrogen (purity 99.9%)；Flow rate of carrier gas：4L/min；Sampling volume：10μL.

Embodiment 1

Arenimonas donghaensis DSM 18148 are placed in LB culture mediums, 30 DEG C are placed in, 180rpm is cultivated 3-5 days, Precipitation is collected by centrifugation, with DNA extraction purifications kit QiAamp Kit (Qiagen, Germany) extraction purification Arenimonas donghaensis DSM 18148 DNA。

Enter performing PCR to the genomic DNAs of Arenimonas donghaensis DSM 18148 with Pfu high-fidelities enzyme to expand, The primer is

NYPD-F 5' ATGACCATGACCCAGCTCACCA 3'

NYPD-R 5' TCAGGCCGCCTGCTTGC 3'

Because the DNA fragmentation G/C contents of Arenimonas donghaensis DSM 18148 are close to 70%, therefore addition is dense eventually in amplification Spend 0.5M glycine betaine.The fragment of amplification is handled 10 minutes for 72 DEG C with Taq polymerase afterwards, alkali is added at DNA 3' ends Base A.It is connected to afterwards in pMD19T-simple (Takara treasured biotech firm, Beijing) cloning vector, picking Dan Ke Grand Shanghai life work biology of delivering to is sequenced.Sequencing obtains DNA sequence dna for SEQ ID NO.1, and corresponding amino acid sequence is SEQ ID NO.2。

Embodiment 2

Because former DNA sequence dna G/C content is too high, efficient transcription is difficult to when being cultivated in Host Strains.Therefore synthesized by full genome Method, secondary structure and codon preference to gene be adjusted, and high is expressed with realize in Escherichia coli.Profit With Primer Premier (http://primer3.ut.ee/) and OPTIMIZER (http://genomes.urv.es/OPTIMIZER/) carry out Design, and ensure the control of Tm differences within 3 DEG C, primer length is controlled within 50base, obtains following primer：

Above-mentioned primer is synthesized, and the primer of acquisition is added after distilled water dissolving, is added in following reaction system so that the end of each primer Concentration is 30nM, final concentration of 0.6 μM of head and the tail primer.

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10U/μl)	0.5μl
		ddH2O	So that reaction system cumulative volume is to 50 μ l

The PCR reaction systems prepared are placed in rich day XP cycler gene-amplificative instraments, expanded by following procedure： 98 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 120s, 35x.The DNA fragmentation that PCR is obtained carries out cutting glue purification, utilizes The method of homologous recombination clones the NdeI/XhoI sites into pET30a.Picking monoclonal is sequenced.Successful DNA is sequenced Sequence is SEQ ID NO.3, is named as NYPDa.

The expression plasmid containing NYPDa is built with reference to Fig. 1 mode.

Embodiment 3

The method synthesized by full genome, secondary structure and codon preference to gene are adjusted, to realize in Escherichia coli In high expression.Utilize Primer Premier (http://primer3.ut.ee/) and OPTIMIZER(http://genomes.urv.es/OPTIMIZER/) it is designed, and ensure the control of Tm differences within 3 DEG C, Primer length is controlled within 50base, obtains following primer：

The PCR reaction systems prepared are placed in rich day XP cycler gene-amplificative instraments, expanded by following procedure： 98 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 120s, 35x.The DNA fragmentation that PCR is obtained carries out cutting glue purification, utilizes The method of homologous recombination clones the NdeI/XhoI sites into pET30a.Picking monoclonal is sequenced.Successful DNA is sequenced Sequence is SEQ ID NO.4, is named as NYPDb.

The expression plasmid containing NYPDb is built with reference to Fig. 1 mode.

Embodiment 4

The PCR reaction systems prepared are placed in rich day XP cycler gene-amplificative instraments, expanded by following procedure： 98 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 120s, 35x.The DNA fragmentation that PCR is obtained carries out cutting glue purification, utilizes The method of homologous recombination clones the NdeI/XhoI sites into pET30a.Picking monoclonal is sequenced.Successful DNA is sequenced Sequence is SEQ ID NO.5, is named as NYPDc.

The expression plasmid containing NYPDc is built in the way of Fig. 1.

Embodiment 5

The PCR reaction systems prepared are placed in rich day XP cycler gene-amplificative instraments, expanded by following procedure： 98 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 120s, 35x.The DNA fragmentation that PCR is obtained carries out cutting glue purification, utilizes The method of homologous recombination clones the NdeI/XhoI sites into pET30a.Picking monoclonal is sequenced.Successful DNA is sequenced Sequence is SEQ ID NO.6, is named as NYPDd.

The expression plasmid containing NYPDd is built with reference to Fig. 1 mode.

Embodiment 6

The PCR reaction systems prepared are placed in rich day XP cycler gene-amplificative instraments, expanded by following procedure： 98 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 120s, 35x.The DNA fragmentation that PCR is obtained carries out cutting glue purification, utilizes The method of homologous recombination clones the NdeI/XhoI sites into pET30a.Picking monoclonal is sequenced.Successful DNA is sequenced Sequence is SEQ ID NO.7, is named as NYPDe.

The expression plasmid containing NYPDe is built with reference to Fig. 1 mode.

Embodiment 7

The Escherichia coli single bacterium colony that picking contains NYPDa expression vectors is inoculated in the culture medium after 10ml autoclavings：Tryptose Peptone 10g/L, yeast extract 5g/L, disodium hydrogen phosphate 3.55g/L, potassium dihydrogen phosphate 3.4g/L, ammonium chloride 2.68g/L, Sodium sulphate 0.71g/L, epsom salt 0.493g/L, Iron trichloride hexahydrate 0.027g/L, glycerine 5g/L, glucose 0.8g/L, Kanamycins is added to 50mg/L.30 DEG C, 250rpm incubated overnights.Next day takes 1L triangular flasks, by 1：100 inoculation ratio Example is linked into the culture medium after 100ml autoclavings：Tryptone 10g/L, yeast extract 5g/L, disodium hydrogen phosphate 3.55g/L, potassium dihydrogen phosphate 3.4g/L, ammonium chloride 2.68g/L, sodium sulphate 0.71g/L, epsom salt 0.493g/L, six Water iron chloride 0.027g/L, glycerine 5g/L, glucose 0.3g/L, addition kanamycins to 50mg/L.In cultivated in 30 DEG C to Triangular flask, is placed in 25 DEG C of shaking tables by thalline OD 5-6 at once, and 250rpm is cultivated 1 hour.Plus IPTG is to final concentration 0.1mM, and in 25 DEG C, 250rpm continues to cultivate 16 hours.Culture terminate after, by nutrient solution in 4 DEG C, under 12000g from The heart collects wet thallus in 20 minutes.Then bacterial sediment is cleaned twice with distilled water, collects thalline, -70 DEG C of preservations.Take simultaneously A small amount of thalline carries out SDS-PAGE detections.

According to the method described above, NYPDb, NYPDc, NYPDd are prepared respectively, and NYPDe thalline simultaneously carries out SDS- PAGE protein adhesives are detected, as a result see Fig. 2.SDS-PAGE protein adhesives show, wherein NYPDc expression quantity highest, therefore do Subsequent experimental is carried out for preferred sequence.

Embodiment 8

Add 0.1M kaliumphosphate buffers (pH8.0), 150g/L NYPDc thalline, 25g/L L lysine HCLs, 0.1mM NAD, opening reaction, 25 DEG C, shaking speed is set to 180rpm.Constantly sampling carries out TLC detections in reaction, works as reaction At 16 hours, testing result such as Fig. 3, as a result display generates a large amount of products for 16 hours, and no substrate is remaining.Sample and carry out simultaneously LC-MS detections, testing result such as Fig. 4, shown in Fig. 5.

Embodiment 9

Addition 0.1M kaliumphosphate buffers (pH8.0), 50g/L NYPDc thalline, 74g/L L lysine HCLs, 0.1mM NAD, Opening reaction, 25 DEG C, shaking speed is set to 180rpm.Constantly sampling carries out TLC detections in reaction, as a result shows that 48 is small The a large amount of products of Shi Shengcheng, no substrate is remaining.Sample simultaneously and carry out LC-MS detections, measure final product concentration and reach 37g/L.

Embodiment 10

Add 0.1M kaliumphosphate buffers (pH8.0), 50g/L NYPDc thalline, 100g/L L lysine HCLs, 0.1mM NAD, opening reaction, 25 DEG C, shaking speed is set to 180rpm.Constantly sampling carries out TLC detections in reaction, as a result shows A large amount of products are generated within 48 hours, no substrate is remaining.Sample simultaneously and carry out LC-MS detections, measure final product concentration and reach 66.7g/L。

Embodiment 11

Add 0.1M kaliumphosphate buffers (pH8.0), 50g/L NYPDc thalline, 150g/L L lysine HCLs, 0.1mM NAD, opening reaction, 25 DEG C, shaking speed is set to 180rpm.Constantly sampling carries out TLC detections in reaction, as a result shows A large amount of products are generated within 48 hours, no substrate is remaining.Sample simultaneously and carry out LC-MS detections, measure final product concentration and reach 76.9g/L。

Embodiment 12

Pseudomonas veronii CIP104663 are placed in LB culture mediums and cultivated, it is 28.0 DEG C to control temperature, 180rpm cultures 3 days, precipitation is collected by centrifugation, with DNA extraction purifications kit QiAamp Kit (Qiagen, Germany) extraction purification Pseudomonas veronii genomic DNAs.

Enter performing PCR to Pseudomonas veronii genomic DNAs with Pfu high-fidelities enzyme to expand, the primer is

Pve-F 5' ATGGTGGCACAGCGAGCAAC 3'

Pve-R 5' TCATGCTAATTTTAAGGTACGGTCG 3'

Due to Pseudomonas veronii CIP104663 DNA G/C content close to 50%, therefore use Pfu high-fidelity enzymes straight Connect amplification.The fragment of amplification is handled 10 minutes for 72 DEG C with Taq polymerase afterwards, in DNA 3' ends addition base A.It After be connected in pMD19T-simple (Takara treasured biotech firm, Beijing) cloning vector, picking monoclonal delivers to south Jing Jinsirui biologies are sequenced.Sequencing obtains DNA sequence dna for SEQ ID NO.8, and corresponding amino acid sequence is SEQ ID NO.9。

Embodiment 13

The method synthesized by full genome, secondary structure and codon preference to gene are adjusted, and adjust DNA sequences The G/C content of row is to 40%~60%, to realize the high expression in Escherichia coli.Utilize Primer Premier(http://primer3.ut.ee/) and OPTIMIZER (http://genomes.urv.es/OPTIMIZER/) it is designed, and Ensure the control of Tm differences within 3 DEG C, primer length is controlled within 50base, obtains following primer：

2mM dNTP mix(2mM each dNTP)	5μl
		10×Pfu buffer	5μl
Pfu DNA polymerase(10 U/μl)	0.5μl
		ddH2O	So that reaction system cumulative volume is to 50 μ l

The PCR reaction systems prepared are placed in rich day XP cycler gene-amplificative instraments, expanded by following procedure： 98 DEG C of 30s, 65 DEG C of 45s, 72 DEG C of 120s, 35x.The DNA fragmentation that PCR is obtained carries out cutting glue purification, utilizes The method of homologous recombination clones the NdeI/XhoI sites into pET30a.Picking monoclonal is sequenced.Successful DNA is sequenced Sequence is SEQ ID NO.10.

The expression plasmid containing SEQ ID NO.10 is built in the way of Fig. 6.

Embodiment 14

The Escherichia coli single bacterium colony that picking contains SEQ ID NO.10 expression vectors is inoculated in the culture medium after 10ml autoclavings： Tryptone 10g/L, yeast extract 5g/L, disodium hydrogen phosphate 3.55g/L, potassium dihydrogen phosphate 3.4g/L, ammonium chloride 2.68g/L, sodium sulphate 0.71g/L, epsom salt 0.493g/L, Iron trichloride hexahydrate 0.027g/L, glycerine 5g/L, grape Sugared 0.8g/L, addition kanamycins to 50mg/L.30 DEG C, 250rpm incubated overnights.Next day takes 1L triangular flasks, by 1： 100 inoculative proportion is linked into the culture medium after 100ml autoclavings：Tryptone 10g/L, yeast extract 5g/L, Disodium hydrogen phosphate 3.55g/L, potassium dihydrogen phosphate 3.4g/L, ammonium chloride 2.68g/L, sodium sulphate 0.71g/L, epsom salt 0.493g/L, Iron trichloride hexahydrate 0.027g/L, glycerine 5g/L, glucose 0.3g/L, addition kanamycins to 50mg/L.In Cultivate to thalline OD 5-6, triangular flask is placed in 25 DEG C of shaking tables in 30 DEG C at once, 250rpm is cultivated 1 hour.Plus IPTG To final concentration 0.1mM, and in 25 DEG C, 250rpm continues to cultivate 16 hours.After culture terminates, by nutrient solution in 4 DEG C, Centrifuged under 12000g 20 minutes and collect wet thallus.Then bacterial sediment is cleaned twice with distilled water, collects thalline, -70 DEG C of guarantors Deposit.A small amount of thalline is taken to carry out SDS-PAGE detections simultaneously.

As a result Fig. 7 is seen, wherein 1 road is albumen supernatant, 2 roads are inclusion body.SDS-PAGE protein adhesives are shown, are contained The Bacillus coli expression amount of SEQ ID NO.10 expression plasmids is high, the need for meeting bioconversion reaction experiment.

Embodiment 15

0.1M kaliumphosphate buffers (pH8.0) are added, 65g/L contains the thalline of SEQ ID NO.10 expression plasmids, and 60g/L L- rely ammonia Acid hydrochloride, 0.1mM NAD, opening reaction, 25 DEG C, shaking speed is set to 180rpm.Constantly sampling is carried out in reaction TLC is detected, when reacting 16 hours, and testing result such as Fig. 8, as a result display generates a large amount of products for 28 hours, and no substrate is residual It is remaining.Quantitative experiment is carried out to the product of acquisition, product ultimate density is 48.7g/L.Sample simultaneously and carry out LC-MS detections, inspection Result such as Fig. 9 is surveyed, shown in Figure 10.

Embodiment 16

Streptomyces hirsutus ATCC 19091 are placed in the culture mediums of ATCC Medium 196 and cultivated, control the temperature to be 26.0 DEG C, 180rpm cultivate 2 days, precipitation is collected by centrifugation, with DNA extraction purification kit QiAamp Kit (Qiagen, Germany) the genomic DNAs of extraction purification Streptomyces hirsutus ATCC 19091.

Enter performing PCR to the genomic DNAs of Streptomyces hirsutus ATCC 19091 with Pfu high-fidelities enzyme to expand, institute It is with primer

Shi-F 5' ATCTTGCAAGCTGAGCGCACG 3'

Shi-R 5' TCATCGTCGCGCTCCGGC 3'

Because the local G/C contents of Streptomyces hirsutus ATCC 19091 DNA are close to 80%, therefore addition is whole in amplification Concentration 0.5M glycine betaine.The fragment of amplification is handled 10 minutes for 72 DEG C with Taq polymerase afterwards, in the addition of DNA 3' ends Base A.It is connected to afterwards in pMD19T-simple (Takara treasured biotech firm, Beijing) cloning vector, picking list Clone delivers to the outstanding Lee's biology in Shanghai and is sequenced.Sequencing obtains DNA sequence dna for SEQ ID NO.11, corresponding amino acid sequence It is classified as SEQ ID NO.12.

Embodiment 17

The PCR reaction systems prepared are placed in rich day XP cycler gene-amplificative instraments, expanded by following procedure： 98 DEG C of 30s, 65 DEG C of 45s, 72 DEG C of 120s, 35x.The DNA fragmentation that PCR is obtained carries out cutting glue purification, utilizes The method of homologous recombination clones the NdeI/XhoI sites into pET30a.Picking monoclonal is sequenced.Successful DNA is sequenced Sequence is SEQ ID NO.13.

The expression plasmid containing SEQ ID NO.13 is built in the way of Figure 11.

Embodiment 18

The Escherichia coli single bacterium colony that picking contains SEQ ID NO.13 expression vectors is inoculated in the culture medium after 10ml autoclavings： Tryptone 10g/L, yeast extract 5g/L, disodium hydrogen phosphate 3.55g/L, potassium dihydrogen phosphate 3.4g/L, ammonium chloride 2.68g/L, sodium sulphate 0.71g/L, epsom salt 0.493g/L, Iron trichloride hexahydrate 0.027g/L, glycerine 5g/L, grape Sugared 0.8g/L, addition kanamycins to 50mg/L.30 DEG C, 250rpm incubated overnights.Next day takes 1L triangular flasks, by 1： 100 inoculative proportion is linked into the culture medium after 100ml autoclavings：Tryptone 10g/L, yeast extract 5g/L, Disodium hydrogen phosphate 3.55g/L, potassium dihydrogen phosphate 3.4g/L, ammonium chloride 2.68g/L, sodium sulphate 0.71g/L, epsom salt 0.493g/L, Iron trichloride hexahydrate 0.027g/L, glycerine 5g/L, glucose 0.3g/L, addition kanamycins to 50mg/L.In Cultivate to thalline OD 5-6, triangular flask is placed in 25 DEG C of shaking tables in 30 DEG C at once, 250rpm is cultivated 1 hour.Plus IPTG To final concentration 0.1mM, and in 25 DEG C, 250rpm continues to cultivate 16 hours.After culture terminates, by nutrient solution in 4 DEG C, Centrifuged under 12000g 20 minutes and collect wet thallus.Then bacterial sediment is cleaned twice with distilled water, collects thalline, -70 DEG C of guarantors Deposit.A small amount of thalline is taken to carry out SDS-PAGE detections simultaneously.

As a result Figure 12 is seen, wherein 1 road is albumen supernatant, 2 roads are inclusion body.SDS-PAGE protein adhesives are shown, are contained The Bacillus coli expression amount of SEQ ID NO.13 expression plasmids is high, the need for meeting bioconversion reaction experiment.

Embodiment 19

0.1M kaliumphosphate buffers (pH8.0) are added, 50g/L contains the thalline of SEQ ID NO.13 expression plasmids, and 55g/L L- rely ammonia Acid hydrochloride, 0.1mM NAD, opening reaction, 25 DEG C, shaking speed is set to 180rpm.Constantly sampling is carried out in reaction TLC is detected, when reacting 16 hours, and testing result such as Figure 13, as a result display generates a large amount of products, no substrate for 16 hours It is remaining.Quantitative experiment is carried out to the product of acquisition, product ultimate density is 32g/L.Sample simultaneously and carry out LC-MS detections, Testing result such as Figure 14, shown in Figure 15.

When we add 1B in system, its fast transition is L lysine HCL, then according to preceding The mode for stating embodiment is reacted.

By using the gene order after the new zymoprotein of the present invention, and optimization, coordinate the conversion process after optimization, Can effectively it manufacture as medicine intermediate industrially useful compound L-Pipecolic Acid, technique is simple and yield is high. The 1B for converting used substrate industrially largely to produce, and it is cheap, according to the state in January, 2016 Interior lysine market conditions, the quotation of 98% content lysine for 8.5-8.6 members/kilogram or so, only domestic yield up to 120 tons, It ensure that the sufficient supply of substrate.Technology is portable strong, as long as general fermentation plant (such as amino acid, vitamin production car Between) can be put into production, it is not required to purchase special installation, it is easy to popularization and application.Current domestic production is contrasted to depend on Chemical resolution method, has 50% raw material to be split and slatterns, while a large amount of useless accessory substances of generation, and the ee values of product It is relatively low.Therefore the present invention has stronger practicality and promotional value.

SEQUENCE LISTING

<110>Nanjing Nuoyun Biological Technology Co., Ltd.

<120>The method that whole-cell catalytic synthesizes L-2- piperidine carboxylic acids

<130> 2016

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 1053

<212> DNA

<213> Arenimonas donghaensis

<400> 1

atgaccatga cccagctcac cacccaggac ctgacccaga tcgtcgcgac ccacggcctg 60

ccgaccctgc tcggccgcct ggtggactac ctggaggccg acttccggcg ctgggaggac 120

ttcgacaaga gcccgcgttc ggcggcccac tccccgggcg gcgtgatcga actgatgccg 180

gtcgccgata ccaaggaata cagcttcaag tacgtcaacg gccacccggg caacaccaag 240

ctgggcctgt ccaccgtggt ggccttcggc gtgctcgccg acgtcgatac cggcatgccg 300

accctgatca gcgaactgac cctgaccacc gcgctgcgca ccgccgccac ctcggtgatg 360

gcggccaagc tgctggcgcg caaggattcc aggaccatgg cgctgatcgg caacggcgcc 420

cagagcgagt tccaggcgct ggccttccac cacctgctgg gcatccagga agtgcgtgtg 480

tacgacgtcg acccggccgc caccgacaag ctggtgcgca acctggccgc ggccgcgccg 540

gaactgcgcg tggtgcgcag caccggcgtc gcccaggccg tgcgcggcgc cgacatcgtc 600

accaccgtca ccgcggacaa ggccaatgcc gacatcctga cgccggaaat gatcgagccg 660

ggcatgcacc tcaacgccgt cggcggcgac tgcccgggca agaccgaact ggccacggag 720

gtggtcgcca acgcctcggt gttcgtcgag ttcgagccgc agtcgcgcat cgaaggcgag 780

gtgcagcaga tgcccgccaa ctccccggtc accgaactgt ggcgcgtgct gaccatgcag 840

gccgccggcc gccgcaacat cgccgaggtc accctgttcg actcggtcgg tttcgcgctg 900

gaggattatt cggcgctgcg cctggtgcgc gattgcgcca aggaaatggg cctgggccgc 960

gaagccagcc tcatccccgc cctggccgac ccgaagaacc tgttcggcga gctggccgcg 1020

gcaccccagg ccgcgcgcaa gcaggcggcc tga 1053

<210> 2

<211> 350

<212> PRT

<213> Arenimonas donghaensis

<400> 2

Met Thr Met Thr Gln Leu Thr Thr Gln Asp Leu Thr Gln Ile Val Ala

1 5 10 15

Thr His Gly Leu Pro Thr Leu Leu Gly Arg Leu Val Asp Tyr Leu Glu

20 25 30

Ala Asp Phe Arg Arg Trp Glu Asp Phe Asp Lys Ser Pro Arg Ser Ala

35 40 45

Ala His Ser Pro Gly Gly Val Ile Glu Leu Met Pro Val Ala Asp Thr

50 55 60

Lys Glu Tyr Ser Phe Lys Tyr Val Asn Gly His Pro Gly Asn Thr Lys

65 70 75 80

Leu Gly Leu Ser Thr Val Val Ala Phe Gly Val Leu Ala Asp Val Asp

85 90 95

Thr Gly Met Pro Thr Leu Ile Ser Glu Leu Thr Leu Thr Thr Ala Leu

100 105 110

Arg Thr Ala Ala Thr Ser Val Met Ala Ala Lys Leu Leu Ala Arg Lys

115 120 125

Asp Ser Arg Thr Met Ala Leu Ile Gly Asn Gly Ala Gln Ser Glu Phe

130 135 140

Gln Ala Leu Ala Phe His His Leu Leu Gly Ile Gln Glu Val Arg Val

145 150 155 160

Tyr Asp Val Asp Pro Ala Ala Thr Asp Lys Leu Val Arg Asn Leu Ala

165 170 175

Ala Ala Ala Pro Glu Leu Arg Val Val Arg Ser Thr Gly Val Ala Gln

180 185 190

Ala Val Arg Gly Ala Asp Ile Val Thr Thr Val Thr Ala Asp Lys Ala

195 200 205

Asn Ala Asp Ile Leu Thr Pro Glu Met Ile Glu Pro Gly Met His Leu

210 215 220

Asn Ala Val Gly Gly Asp Cys Pro Gly Lys Thr Glu Leu Ala Thr Glu

225 230 235 240

Val Val Ala Asn Ala Ser Val Phe Val Glu Phe Glu Pro Gln Ser Arg

245 250 255

Ile Glu Gly Glu Val Gln Gln Met Pro Ala Asn Ser Pro Val Thr Glu

260 265 270

Leu Trp Arg Val Leu Thr Met Gln Ala Ala Gly Arg Arg Asn Ile Ala

275 280 285

Glu Val Thr Leu Phe Asp Ser Val Gly Phe Ala Leu Glu Asp Tyr Ser

290 295 300

Ala Leu Arg Leu Val Arg Asp Cys Ala Lys Glu Met Gly Leu Gly Arg

305 310 315 320

Glu Ala Ser Leu Ile Pro Ala Leu Ala Asp Pro Lys Asn Leu Phe Gly

325 330 335

Glu Leu Ala Ala Ala Pro Gln Ala Ala Arg Lys Gln Ala Ala

340 345 350

<210> 3

<211> 1053

<212> DNA

<213>Artificial sequence

<400> 3

atgaccatga cccagctgac cacccaggac ctgacccaga tcgttgctac ccacggtctg 60

ccgaccctgc tgggtcgtct ggttgactac ctggaagctg acttccgtcg ttgggaagac 120

ttcgacaaat ctccgcgttc tgctgctcac tctccgggtg gtgttatcga actgatgccg 180

gttgctgaca ccaaagaata ctctttcaaa tacgttaacg gtcacccggg taacaccaaa 240

ctgggtctgt ctaccgttgt tgctttcggt gttctggctg acgttgacac cggtatgccg 300

accctgatct ctgaactgac cctgaccacc gctctgcgta ccgctgctac ctctgttatg 360

gctgctaaac tgctggctcg taaagactct cgtaccatgg ctctgatcgg taacggtgct 420

cagtctgaat tccaggctct ggctttccac cacctgctgg gtatccagga agttcgtgtt 480

tacgacgttg acccggctgc taccgacaaa ctggttcgta acctggctgc tgctgctccg 540

gaactgcgtg ttgttcgttc taccggtgtt gctcaggctg ttcgtggtgc tgacatcgtt 600

accaccgtta ccgctgacaa agctaacgct gacatcctga ccccggaaat gatcgaaccg 660

ggtatgcacc tgaacgctgt tggtggtgac tgcccgggta aaaccgaact ggctaccgaa 720

gttgttgcta acgcttctgt tttcgttgaa ttcgaaccgc agtctcgtat cgaaggtgaa 780

gttcagcaga tgccggctaa ctctccggtt accgaactgt ggcgtgttct gaccatgcag 840

gctgctggtc gtcgtaacat cgctgaagtt accctgttcg actctgttgg tttcgctctg 900

gaagactact ctgctctgcg tctggttcgt gactgcgcta aagaaatggg tctgggtcgt 960

gaagcttctc tgatcccggc tctggctgac ccgaaaaacc tgttcggtga actggctgct 1020

gctccgcagg ctgctcgtaa acaggctgct taa 1053

<210> 4

<211> 1053

<212> DNA

<213>Artificial sequence

<400> 4

atgactatga ctcaactgac tactcaagac ctcactcaga ttgttgctac ccatggtctc 60

ccaaccctgc tcggtcgtct ggttgactat ctcgaagcgg acttccgccg ttgggaagac 120

ttcgacaagt ccccacgttc tgctgctcac tctccaggcg gtgttattga actcatgccg 180

gttgcggaca ccaaagaata ctctttcaaa tacgtgaacg gtcacccggg caataccaaa 240

ctcggtctct ctactgttgt tgcgttcggt gttctcgcgg atgttgacac tggtatgcca 300

actctcatct ctgagctgac cctgaccact gcgctccgta ccgctgcgac ttctgttatg 360

gcggcgaaac tgctggcgcg taaagactct cgtaccatgg ctctgatcgg taatggtgcg 420

cagtccgaat ttcaagcgct ggctttccac cacctgctgg gtatccagga agttcgtgtg 480

tacgacgtgg acccagcggc gactgataaa ctggttcgta acctggcggc tgctgcgcca 540

gaactgcgcg ttgttcgttc taccggtgtt gctcaagcgg tgcgtggcgc tgatatcgtt 600

actaccgtta ccgcggacaa ggcgaacgct gacatcctga ccccggaaat gatcgaaccg 660

ggtatgcacc tgaatgcggt tggtggtgat tgtccgggta aaactgaact ggcgaccgaa 720

gtggttgcga atgcgtctgt ttttgtggaa tttgaaccgc agtctcgtat cgaaggtgaa 780

gttcagcaaa tgccggcgaa ctccccagtt accgagctgt ggcgtgttct gaccatgcag 840

gctgcgggtc gtcgtaacat cgcggaggtt accctctttg attctgttgg tttcgctctg 900

gaggactatt ccgcgctgcg tctcgttcgc gattgcgcga aagaaatggg tctcggccgt 960

gaggcttccc tcattccagc tctggcggac ccgaaaaatc tgtttggtga actcgctgcg 1020

gctccacaag ctgctcgcaa acaggcggcg taa 1053

<210> 5

<211> 1053

<212> DNA

<213>Artificial sequence

<400> 5

atgaccatga cccagctgac cacccaggat ctgacccaga tcgttgcgac ccacggtctg 60

ccgaccctgc tgggccgtct ggttgactac ctggaagcgg acttccgtcg ttgggaagat 120

ttcgacaaat ctccgcgttc tgcggcgcac tctccgggtg gcgttatcga actgatgccg 180

gttgcggata ccaaagaata ctctttcaaa tatgttaacg gtcacccggg caacaccaaa 240

ctgggcctgt ctaccgttgt tgcgttcggc gttctggcgg atgttgacac cggtatgccg 300

accctgatct ctgaactgac cctgaccacc gcgctgcgta ccgcggcgac ctctgttatg 360

gcggcgaaac tgctggcgcg taaagactct cgtaccatgg cgctgatcgg caacggtgcg 420

cagtctgaat tccaggcgct ggcgttccac cacctgctgg gtatccagga agttcgtgtt 480

tatgacgttg atccggcggc gaccgataaa ctggttcgta acctggcggc ggcggcgccg 540

gaactgcgtg ttgttcgttc taccggtgtt gcgcaggcgg ttcgtggtgc ggacatcgtt 600

accaccgtta ccgcggacaa agcgaacgcg gatatcctga ccccggaaat gatcgaaccg 660

ggtatgcacc tgaacgcggt tggtggcgac tgtccgggta aaaccgaact ggcgaccgaa 720

gttgttgcga acgcgtctgt tttcgttgaa ttcgaaccgc agtctcgtat cgaaggcgaa 780

gttcagcaga tgccggcgaa ctctccggtt accgaactgt ggcgtgttct gaccatgcag 840

gcggcgggtc gtcgtaacat cgcggaagtt accctgttcg attctgttgg tttcgcgctg 900

gaagactatt ctgcgctgcg tctggttcgt gattgtgcga aagaaatggg cctgggtcgt 960

gaagcgtctc tgatcccggc gctggcggac ccgaaaaacc tgttcggtga actggcggcg 1020

gcgccgcagg cggcgcgtaa acaggcggcg taa 1053

<210> 6

<211> 1053

<212> DNA

<213>Artificial sequence

<400> 6

atgaccatga cccagctgac tactcaggac ctgactcaga tcgttgctac ccacggtctg 60

ccgactctgc tgggccgtct ggtggattac ctggaagcgg acttccgtcg ctgggaagac 120

tttgacaaat ccccgcgctc cgcggctcat tctccgggtg gtgttatcga actgatgccg 180

gttgcggaca ccaaagaata ctctttcaaa tacgtgaacg gtcacccggg caacactaaa 240

ctgggtctgt ccaccgtggt tgcgtttggc gttctggctg atgtggatac tggtatgccg 300

accctgatct ctgaactgac tctgaccacc gctctgcgta ccgctgctac ttctgttatg 360

gcggcgaaac tgctggctcg caaagactct cgtaccatgg cgctgatcgg caacggcgct 420

cagtctgaat ttcaggctct ggcttttcat cacctgctgg gtatccagga agttcgtgtg 480

tacgacgttg acccggctgc gaccgacaaa ctggttcgca acctggcggc tgctgctccg 540

gaactgcgtg tggttcgttc taccggtgtg gctcaggctg tgcgtggtgc ggatattgtt 600

accactgtta ccgcggacaa agcgaacgct gatatcctga ccccggaaat gatcgaaccg 660

ggcatgcacc tgaacgcggt tggtggtgat tgtccgggta aaaccgaact ggcgactgaa 720

gttgttgcta acgcgtccgt gtttgttgaa tttgaaccgc agtcccgcat cgaaggtgaa 780

gttcagcaga tgccggcgaa ctccccggtt actgaactgt ggcgtgttct gactatgcag 840

gcggctggcc gtcgtaacat cgcggaagtt actctgttcg attctgtggg cttcgctctg 900

gaagattatt ctgcgctgcg cctggtgcgc gactgtgcga aagaaatggg cctgggtcgt 960

gaagcgtccc tgattccggc gctggcggac ccgaaaaacc tgttcggtga actggctgcg 1020

gctccgcagg ctgcgcgtaa acaggctgct taa 1053

<210> 7

<211> 1053

<212> DNA

<213>Artificial sequence

<400> 7

atgactatga cccaactgac tactcaggac ctgactcaga tcgttgcgac ccacggcctg 60

ccgaccctgc tgggccgtct ggtagactac ctggaagcgg acttccgtcg ttgggaagac 120

tttgacaaat ctccgcgttc tgcggcgcac tccccgggtg gcgttatcga actgatgccg 180

gtagcggata ccaaggaata ctctttcaaa tatgttaacg gtcatccggg caacaccaaa 240

ctgggtctgt ctaccgtagt agcgttcggt gttctggcgg acgttgacac tggtatgccg 300

actctgatta gcgagctgac cctgaccacc gcgctgcgta ccgcggcaac ctctgtaatg 360

gcggcaaaac tgctggcgcg caaagactct cgtaccatgg cgctgatcgg caacggtgcg 420

caatctgaat tccaagcgct ggcgttccac catctgctgg gtatccagga ggttcgtgtt 480

tatgacgtgg acccggcagc gaccgataaa ctggttcgta atctggctgc ggctgcaccg 540

gaactgcgcg tagttcgttc tactggcgtg gctcaggctg tgcgtggtgc ggacattgtt 600

accaccgtta ccgctgacaa agcgaacgca gatatcctga ccccggaaat gattgagccg 660

ggtatgcatc tgaacgctgt aggtggtgac tgcccgggta aaaccgagct ggcaactgaa 720

gtggttgcta atgcgtctgt tttcgttgaa ttcgaaccgc agtctcgtat cgaaggcgaa 780

gttcagcaaa tgccggctaa ctctccggtt actgagctgt ggcgtgtact gaccatgcag 840

gcagctggtc gccgtaacat cgcggaagtt accctgtttg acagcgtagg tttcgcactg 900

gaagattatt ctgcactgcg cctggtgcgc gactgtgcaa aagaaatggg cctgggtcgt 960

gaggcaagcc tgatcccggc actggctgat ccgaaaaacc tgttcggcga actggcagcg 1020

gctccgcagg ctgctcgcaa acaagcggca taa 1053

<210> 8

<211> 1116

<212> DNA

<213> Pseudomonas veronii

<400> 8

atggtggcac agcgagcaac tattatcctc tctgaggaaa acattggtga aattgtcgca 60

gcagtcgggc tcgacacttt aatggatgaa acgattgcaa aactacgtga tgccctcaac 120

gtgtttggtg atggccaggt tgaaatacaa ccgcgcaccg gctttgtcta tgaaactccg 180

gaaatggggc tgatagagtt tatgccggct taccgccggg ataaaaatgt cgcgttaaaa 240

gttgttggct accatccggg aaatccgttt aaccggggca tgccgacggt catcgccact 300

aactccctat atgacgtaag ggacggccac cttattgcgg tgatcgatgg tgtatttgca 360

acagcagtac gaacgggcgc agcatccgct gtggcttcga agttgctggc tcatcctgaa 420

agcaaaaccc ttgggctgat cggagctggc gccatggcag tgacccaggc ccatgccctc 480

agtcgaattt atgactttga cgcagtcttg atccacgata ttgaccccgc agtggaaaaa 540

actttcgcca agcgggtatc cgccctggga attacaccga tcatcgcttc caaagacagg 600

gtactggcag agtccgacat catctgtgtt gctacctcca ttggccttga tgcaggcccg 660

gttctccacg ctggcgggat gaaaccacat gtacacatca atgctattgg tgccgacacg 720

ccgcgcaaat atgaattatc aacagagctg ctcaaaagct cgttccttgt cacggattat 780

ctggaacagg ccattaacga aggtgaatgc cagcaattga gtaaagacga atacggctat 840

atcggccctg agttgcacaa aatagtgaaa gagccgcaag cctatatcca atatcagatg 900

aaacagacca tctttgatag caccggtatt tcattggaag atcagataat gaccgaggtc 960

ttgatcgatc aggcggagag actagggctt ggtcagcgga tcctgattga agcgggatgt 1020

gatgacccca tgaacccata tcttttctca aattccgcga acgctcttga taccgtcaag 1080

aatacagtgc acgaccgtac cttaaaatta gcatga 1116

<210> 9

<211> 371

<212> PRT

<213> Pseudomonas veronii

<400> 9

Met Val Ala Gln Arg Ala Thr Ile Ile Leu Ser Glu Glu Asn Ile Gly

1 5 10 15

Glu Ile Val Ala Ala Val Gly Leu Asp Thr Leu Met Asp Glu Thr Ile

20 25 30

Ala Lys Leu Arg Asp Ala Leu Asn Val Phe Gly Asp Gly Gln Val Glu

35 40 45

Ile Gln Pro Arg Thr Gly Phe Val Tyr Glu Thr Pro Glu Met Gly Leu

50 55 60

Ile Glu Phe Met Pro Ala Tyr Arg Arg Asp Lys Asn Val Ala Leu Lys

65 70 75 80

Val Val Gly Tyr His Pro Gly Asn Pro Phe Asn Arg Gly Met Pro Thr

85 90 95

Val Ile Ala Thr Asn Ser Leu Tyr Asp Val Arg Asp Gly His Leu Ile

100 105 110

Ala Val Ile Asp Gly Val Phe Ala Thr Ala Val Arg Thr Gly Ala Ala

115 120 125

Ser Ala Val Ala Ser Lys Leu Leu Ala His Pro Glu Ser Lys Thr Leu

130 135 140

Gly Leu Ile Gly Ala Gly Ala Met Ala Val Thr Gln Ala His Ala Leu

145 150 155 160

Ser Arg Ile Tyr Asp Phe Asp Ala Val Leu Ile His Asp Ile Asp Pro

165 170 175

Ala Val Glu Lys Thr Phe Ala Lys Arg Val Ser Ala Leu Gly Ile Thr

180 185 190

Pro Ile Ile Ala Ser Lys Asp Arg Val Leu Ala Glu Ser Asp Ile Ile

195 200 205

Cys Val Ala Thr Ser Ile Gly Leu Asp Ala Gly Pro Val Leu His Ala

210 215 220

Gly Gly Met Lys Pro His Val His Ile Asn Ala Ile Gly Ala Asp Thr

225 230 235 240

Pro Arg Lys Tyr Glu Leu Ser Thr Glu Leu Leu Lys Ser Ser Phe Leu

245 250 255

Val Thr Asp Tyr Leu Glu Gln Ala Ile Asn Glu Gly Glu Cys Gln Gln

260 265 270

Leu Ser Lys Asp Glu Tyr Gly Tyr Ile Gly Pro Glu Leu His Lys Ile

275 280 285

Val Lys Glu Pro Gln Ala Tyr Ile Gln Tyr Gln Met Lys Gln Thr Ile

290 295 300

Phe Asp Ser Thr Gly Ile Ser Leu Glu Asp Gln Ile Met Thr Glu Val

305 310 315 320

Leu Ile Asp Gln Ala Glu Arg Leu Gly Leu Gly Gln Arg Ile Leu Ile

325 330 335

Glu Ala Gly Cys Asp Asp Pro Met Asn Pro Tyr Leu Phe Ser Asn Ser

340 345 350

Ala Asn Ala Leu Asp Thr Val Lys Asn Thr Val His Asp Arg Thr Leu

355 360 365

Lys Leu Ala

370

<210> 10

<211> 1116

<212> DNA

<213>Artificial sequence

<400> 10

atggttgctc agcgtgctac catcatcctg tctgaagaaa acatcggtga aatcgttgct 60

gctgttggtc tggacaccct gatggacgaa accatcgcta aactgcgtga cgctctgaac 120

gttttcggtg acggtcaggt tgaaatccag ccgcgtaccg gtttcgttta cgaaaccccg 180

gaaatgggtc tgatcgaatt catgccggct taccgtcgtg acaaaaacgt tgctctgaaa 240

gttgttggtt accacccggg taacccgttc aaccgtggta tgccgaccgt tatcgctacc 300

aactctctgt acgacgttcg tgacggtcac ctgatcgctg ttatcgacgg tgttttcgct 360

accgctgttc gtaccggtgc tgcttctgct gttgcttcta aactgctggc tcacccggaa 420

tctaaaaccc tgggtctgat cggtgctggt gctatggctg ttacccaggc tcacgctctg 480

tctcgtatct acgacttcga cgctgttctg atccacgaca tcgacccggc tgttgaaaaa 540

accttcgcta aacgtgtttc tgctctgggt atcaccccga tcatcgcttc taaagaccgt 600

gttctggctg aatctgacat catctgcgtt gctacctcta tcggtctgga cgctggtccg 660

gttctgcacg ctggtggtat gaaaccgcac gttcacatca acgctatcgg tgctgacacc 720

ccgcgtaaat acgaactgtc taccgaactg ctgaaatctt ctttcctggt taccgactac 780

ctggaacagg ctatcaacga aggtgaatgc cagcagctgt ctaaagacga atacggttac 840

atcggtccgg aactgcacaa aatcgttaaa gaaccgcagg cttacatcca gtaccagatg 900

aaacagacca tcttcgactc taccggtatc tctctggaag accagatcat gaccgaagtt 960

ctgatcgacc aggctgaacg tctgggtctg ggtcagcgta tcctgatcga agctggttgc 1020

gacgacccga tgaacccgta cctgttctct aactctgcta acgctctgga caccgttaaa 1080

aacaccgttc acgaccgtac cctgaaactg gcttaa 1116

<210> 11

<211> 1095

<212> DNA

<213> Streptomyces hirsutus

<400> 11

atgatcttgc aagctgagcg cacgcacatc gtcgacgccg aagccgtcgc caccatcgtc 60

acgaaggtgg gactggggca actctacgac ctgaccatcg cccgcatgga ggcggctctc 120

accggtggac ccggtgcgcc ggtggagatg aagcagcggg acggtttcct gctggagaca 180

ccgcagttgg gcctgctcga gtggatgccg gcggtccgcc aaggcaccac ggtctccatc 240

aagatggtcg cctacaaccc gcacaatccg gtcaagaacc agctgcccac catcctgtcg 300

acactgtgcg ccttcgacac ggacagcggc caccttcgtg ccgtcgtcga cggcacgttc 360

gccaccgccg tccgtacggg cgcggcgtcc gcactggcca gccgggtgct cgctcgcccg 420

gactccgccg tgctcggcct ggtgggctgc ggtgcccagg cggtcacgca gttgcacgcc 480

ctggcacgcg tcttctcgtt ctccgaggtg ctcgtccacg acaaggacgc gcgggcggag 540

cgatccttcg cggcgagggc ccggatgccc gaggggctgg tgcgcgtcgc gccgctcgcg 600

gaggtggagg agcgggccga cgtgctgtgc accgccacct cggtcggccc ccacgagggg 660

ccggtcatcc ggggcacgtc actcaagccc tgggtgcacg tcaacaccat cggatcggac 720

atgccgggca agacggagct gccgctggac cttctgcgcg cggcggtcgt ctgcccggac 780

cacgtggagc aggcacgggc cgagggtgac tgccagcagc tcgcccccga ggagatcggg 840

gctccgctcc ccgacctgct gcgtgatccg gacgcgcacc gcaggctgtc gccggtcacc 900

accgtgtacg actcgacagg tctcgcgctg caggatctcg tcatggtgga ggtgctggag 960

gagttggcgc gggacctcga cgtcggacac cacgtcttca tcgaggcgac ggccgacgac 1020

ccgcaggacc cgtactcgtt cctccctgcg gaggtcaccc ggtccctggc cggcacggcc 1080

ggagcgcgac gatga 1095

<210> 12

<211> 364

<212> PRT

<213> Streptomyces hirsutus

<400> 12

Met Ile Leu Gln Ala Glu Arg Thr His Ile Val Asp Ala Glu Ala Val

1 5 10 15

Ala Thr Ile Val Thr Lys Val Gly Leu Gly Gln Leu Tyr Asp Leu Thr

20 25 30

Ile Ala Arg Met Glu Ala Ala Leu Thr Gly Gly Pro Gly Ala Pro Val

35 40 45

Glu Met Lys Gln Arg Asp Gly Phe Leu Leu Glu Thr Pro Gln Leu Gly

50 55 60

Leu Leu Glu Trp Met Pro Ala Val Arg Gln Gly Thr Thr Val Ser Ile

65 70 75 80

Lys Met Val Ala Tyr Asn Pro His Asn Pro Val Lys Asn Gln Leu Pro

85 90 95

Thr Ile Leu Ser Thr Leu Cys Ala Phe Asp Thr Asp Ser Gly His Leu

100 105 110

Arg Ala Val Val Asp Gly Thr Phe Ala Thr Ala Val Arg Thr Gly Ala

115 120 125

Ala Ser Ala Leu Ala Ser Arg Val Leu Ala Arg Pro Asp Ser Ala Val

130 135 140

Leu Gly Leu Val Gly Cys Gly Ala Gln Ala Val Thr Gln Leu His Ala

145 150 155 160

Leu Ala Arg Val Phe Ser Phe Ser Glu Val Leu Val His Asp Lys Asp

165 170 175

Ala Arg Ala Glu Arg Ser Phe Ala Ala Arg Ala Arg Met Pro Glu Gly

180 185 190

Leu Val Arg Val Ala Pro Leu Ala Glu Val Glu Glu Arg Ala Asp Val

195 200 205

Leu Cys Thr Ala Thr Ser Val Gly Pro His Glu Gly Pro Val Ile Arg

210 215 220

Gly Thr Ser Leu Lys Pro Trp Val His Val Asn Thr Ile Gly Ser Asp

225 230 235 240

Met Pro Gly Lys Thr Glu Leu Pro Leu Asp Leu Leu Arg Ala Ala Val

245 250 255

Val Cys Pro Asp His Val Glu Gln Ala Arg Ala Glu Gly Asp Cys Gln

260 265 270

Gln Leu Ala Pro Glu Glu Ile Gly Ala Pro Leu Pro Asp Leu Leu Arg

275 280 285

Asp Pro Asp Ala His Arg Arg Leu Ser Pro Val Thr Thr Val Tyr Asp

290 295 300

Ser Thr Gly Leu Ala Leu Gln Asp Leu Val Met Val Glu Val Leu Glu

305 310 315 320

Glu Leu Ala Arg Asp Leu Asp Val Gly His His Val Phe Ile Glu Ala

325 330 335

Thr Ala Asp Asp Pro Gln Asp Pro Tyr Ser Phe Leu Pro Ala Glu Val

340 345 350

Thr Arg Ser Leu Ala Gly Thr Ala Gly Ala Arg Arg

355 360

<210> 13

<211> 1095

<212> DNA

<213>Artificial sequence

<400> 13

atgatcctgc aggctgaacg tacccacatc gttgacgctg aagctgttgc taccatcgtt 60

accaaagttg gtctgggtca gctgtacgac ctgaccatcg ctcgtatgga agctgctctg 120

accggtggtc cgggtgctcc ggttgaaatg aaacagcgtg acggtttcct gctggaaacc 180

ccgcagctgg gtctgctgga atggatgccg gctgttcgtc agggtaccac cgtttctatc 240

aaaatggttg cttacaaccc gcacaacccg gttaaaaacc agctgccgac catcctgtct 300

accctgtgcg ctttcgacac cgactctggt cacctgcgtg ctgttgttga cggtaccttc 360

gctaccgctg ttcgtaccgg tgctgcttct gctctggctt ctcgtgttct ggctcgtccg 420

gactctgctg ttctgggtct ggttggttgc ggtgctcagg ctgttaccca gctgcacgct 480

ctggctcgtg ttttctcttt ctctgaagtt ctggttcacg acaaagacgc tcgtgctgaa 540

cgttctttcg ctgctcgtgc tcgtatgccg gaaggtctgg ttcgtgttgc tccgctggct 600

gaagttgaag aacgtgctga cgttctgtgc accgctacct ctgttggtcc gcacgaaggt 660

ccggttatcc gtggtacctc tctgaaaccg tgggttcacg ttaacaccat cggttctgac 720

atgccgggta aaaccgaact gccgctggac ctgctgcgtg ctgctgttgt ttgcccggac 780

cacgttgaac aggctcgtgc tgaaggtgac tgccagcagc tggctccgga agaaatcggt 840

gctccgctgc cggacctgct gcgtgacccg gacgctcacc gtcgtctgtc tccggttacc 900

accgtttacg actctaccgg tctggctctg caggacctgg ttatggttga agttctggaa 960

gaactggctc gtgacctgga cgttggtcac cacgttttca tcgaagctac cgctgacgac 1020

ccgcaggacc cgtactcttt cctgccggct gaagttaccc gttctctggc tggtaccgct 1080

ggtgctcgtc gttaa 1095

Claims

1. the method that Whole Cell Biocatalysis synthesizes L-2- piperidine carboxylic acids, it is characterized in that, using L lysine HCL or 1B as substrate, by adding NADH and recombinant host bacterium, L-2- piperidine carboxylic acids are prepared by living things catalysis；Wherein recombinant host bacterium is to contain Arenimonas donghaensis Any one in the recombinant host bacterium of the protein coding genes of DSM 18148, the recombinant host bacterium containing Pseudomonas veronii CIP104663 protein coding genes or the recombinant host bacterium containing the protein coding genes of Streptomyces hirsutus ATCC 19091.

2. the method that Whole Cell Biocatalysis according to claim 1 synthesizes L-2- piperidine carboxylic acids, it is characterized in that, the recombinant host bacterium is Escherichia coli.

3. the method that Whole Cell Biocatalysis according to claim 1 or 2 synthesizes L-2- piperidine carboxylic acids, it is characterized in that, reaction is carried out in pH8.0 buffer solution of potassium phosphate.

4. the method that Whole Cell Biocatalysis according to claim 1 or 2 synthesizes L-2- piperidine carboxylic acids, it is characterized in that, reaction temperature is 20 DEG C -30 DEG C.

5. the method that Whole Cell Biocatalysis according to claim 1 or 2 synthesizes L-2- piperidine carboxylic acids, it is characterized in that, reaction is carried out on shaking table, and shaking speed is 180rpm.

6. the method that Whole Cell Biocatalysis according to claim 1 or 2 synthesizes L-2- piperidine carboxylic acids, it is characterized in that, the concentration of recombinant host bacterium is 50g/L-150g/L.