CN112522231B

CN112522231B - Acyltransferase, and coding gene and application thereof

Info

Publication number: CN112522231B
Application number: CN202011474193.6A
Authority: CN
Inventors: 章卫民; 叶伟; 朱牧孜; 岑由飞; 李赛妮; 李浩华
Original assignee: Guangdong Detection Center of Microbiology of Guangdong Institute of Microbiology
Current assignee: Institute of Microbiology of Guangdong Academy of Sciences
Priority date: 2020-12-14
Filing date: 2020-12-14
Publication date: 2023-03-14
Anticipated expiration: 2040-12-14
Also published as: CN112522231A

Abstract

The invention discloses an acyltransferase, and a coding gene and application thereof. The amino acid sequence of the acyltransferase Tri18 is shown as SEQ ID NO. 2. The invention discovers a novel acyltransferase Tri18 which plays an important role in the formation process of a D-type trichothecene macrocyclic structure from the patchouli endophytic fungus Myrothecium roridum A553 for the first time. The novel acyltransferase Tri18 obtained by the invention can interact with acetyl CoA to play a role in acyl transfer. The method lays a molecular biological foundation for analyzing the biosynthetic pathway of the trichothecene and promoting the application of acyltransferase in biocatalysis, thereby laying a molecular biological foundation for analyzing the biosynthetic mechanism of the trichothecene in the myrothecium roridum and providing a material foundation for promoting the application of acyltransferase in biotransformation.

Description

Acyltransferase, and coding gene and application thereof

The technical field is as follows:

the invention belongs to the field of genetic engineering, and particularly relates to novel acyltransferase derived from novel plant endophytic fungi lacustris humilis, and a coding gene and application thereof.

Background art:

the Myrothecium roridum is a pathogenic bacterium with obvious pathogenicity for soybean and other economic crops, and causes immeasurable loss of soybean yield in China. According to research reports, trichothecene toxin is an important pathogenic factor of the myrothecium roridum. The inventor separates wet-spot lachnum A553 from medical plant patchouli endophytic fungi in earlier stage, and separates a large amount of trichothecene compounds from the wet-spot lachnum A553, and the trichothecene compounds have obvious cytotoxic activity on tumor cells. The combination of the trichothecene toxin and the targeted drug has great application prospect in the development of antitumor drugs.

The invention content is as follows:

the first purpose of the invention is to provide a novel acyltransferase Tri18 from the endophytic fungus Myrothecium roridum.

The novel acetyltransferase Tri18 of the invention is prepared by the following method:

a gene Tri18, which is a coding gene of acyltransferase Tri18, is obtained by using a genome of patchouli endophytic fungus Myrothecium roridumA553 as a template, designing a primer according to a Tri8 gene sequence (shown as SEQ ID NO. 1) in a gene cluster Tricluster and performing sectional amplification fusion PCR. Recovering a target fragment, inserting the target gene into an expression vector pET30a which is subjected to double enzyme digestion by restriction enzymes NdeI and HindIII by adopting a Clonexpress Ultra One Step Cloning Kit (Nanjing Biotechnology Co., ltd.), screening by using an LB plate containing 50 mu g/mL Kana, picking out clone for amplification culture, amplifying Tri18 gene by adopting a bacterial liquid PCR, screening positive clone, sequencing and verifying. Purifying the acyltransferase Tri18 by using a Ni affinity chromatographic column, and eluting by using eluents containing imidazole with different concentrations to obtain pure acyltransferase Tri18. Adding acyltransferase Tri18 into acetyl CoA and butanol as substrates, adding DTNB for color development, and detecting absorbance at 412nm to determine the activity of the acyltransferase Tri18, wherein Vmax is 307.7 + -10.91U/mg, km is 376.5 + -30.07 mu M, kcat is 1538.5S ^-1 Kcat/Km is 245.18. Mu.M/min. The enzyme activity of the acyltransferase Tri18 under the reaction conditions of 250 mu M acetyl coenzyme A, pH =8.0 and room temperature is about 115U/mg。

The amino acid sequence of the acyltransferase Tri18 is shown as SEQ ID NO. 2.

The second object of the present invention is to provide a gene encoding the above-mentioned acyltransferase Tri18.

The nucleotide sequence of the coding gene is shown in SEQ ID NO. 1.

The third purpose of the invention is to provide the application of the acyltransferase Tri18 in catalyzing acyl transfer to form ester or amide.

The acyltransferase plays an important role in the biosynthesis of an active secondary metabolite skeleton and the post-modification process, and the invention firstly discovers a novel acyltransferase Tri18 which plays an important role in the formation process of a D-type trichothecene macrocyclic structure from the Pogostemon cablin endophytic fungus Myrothecium Rhamnidum A553. The novel acyltransferase Tri18 obtained by the invention can interact with acetyl CoA to play a role in acyl transfer. The method lays a molecular biological foundation for analyzing the biosynthetic pathway of the trichothecene and promoting the application of acyltransferase in biocatalysis, thereby laying a molecular biological foundation for analyzing the biosynthetic mechanism of the trichothecene in the myrothecium roridum and providing a material foundation for promoting the application of acyltransferase in biotransformation.

Drawings

FIG. 1 shows the construction of the recombinant vector pET30-Tri 18: a) Amplifying an acyltransferase gene Tri18; b) PCR verification of bacterial liquid obtained by inserting pET30a into acyltransferase gene Tri18;

FIG. 2 is an expression purification diagram of an acyltransferase Tri18 protein, wherein S represents a supernatant after disruption, P represents a precipitate after disruption, F represents a Ni column permeate, and 10% -100% represents eluents of imidazole in different concentrations;

FIG. 3 shows the results of the analysis of the enzymatic properties of the acyltransferase Tri 18: a) Is the optimum temperature analysis of the acyltransferase Tri18; b) Optimum pH analysis of acyltransferase Tri18; c) Analyzing the thermal stability of the acyltransferase Tri18; d) Kinetic analysis of acyltransferase Tri18.

Detailed Description

The invention will be further explained with reference to specific embodiments with reference to the drawings. The examples themselves are not intended to limit the invention in any way.

Example 1 expression purification of the novel acyltransferase Tri18 in Myrothecium roridum A553

The genome of Myrothecium roridum A553 was extracted and amplified using primers Tri18-F: CTTTAAGAAGGAGATATACAATGATGGCCTCCGTGGACCAAC and Tri18-R: TGGTGCTCGAGTGCGGCCGCACTCCTCGGCAAGAGAATCTGTG: a target gene Tri18 (FIG. 1A) is amplified, and then an intron is removed through fusion PCR, so that a complete fragment of the Tri18 gene (the coding nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the encoded acyltransferase Tri18 is shown in SEQ ID NO. 2) is obtained. The complete fragment was recovered by cutting, and then the target gene was inserted into expression vector pET30a cut with restriction enzymes NdeI and Hind III using Clon express Ultra One Step Cloning Kit (Novone Biotechnology Co., ltd., nanjing) homologous recombination Kit, and the reaction system was as shown in Table 1 and reacted at 50 ℃ for 15min.

TABLE 1 ligation reaction System

The ligation product was transformed into E.coli DH 5. Alpha. Competent cells, positive clones were screened with LB plates containing 50. Mu.g/mLkana, and the Tri18 gene was amplified by PCR using bacterial suspension, which preliminarily verified the successful insertion of the Tri18 gene into pET30a (see FIG. 1B). The successful construction of the expression vector was further confirmed by sequencing results.

The successfully constructed recombinant plasmid pET30a-Tri18 is transformed into E.coli BL21 (DE 3), and the expression is induced by IPTG. The results show that: under the condition of low temperature (18 ℃), 0.1mM IPTG and 200r/min are shaken overnight to induce, the size of the target protein expressed by the induced pronucleus is about 65.40kDa, and the protein is mainly expressed in a soluble form (figure 2A).

The results of SDS-PAGE detection of the fractions of the Ni column on the total proteins of the supernatant are shown in FIG. 2B. The results show that: the acyltransferase Tri18 with higher purity was detected in the eluent of 100mM imidazole, and the acyltransferase Tri18 with purity of 97.8% in the eluent of 100mM imidazole was analyzed by Bandscan 5.0.

Example 2:

the enzymatic property analysis of the novel acyltransferase Tri18 protein comprises the following specific steps:

acyltransferase activity assay reference Garvey et al procedure, buffer a:5mM acetyl CoA,0.1M PBS, pH 8.0; buffer B:5g/L butanol, 0.1M PBS, pH 8.0; buffer C:0.2mg/mL acyltransferase Tri18; buffer D:20mM DTNB,0.1M PBS, pH 8.0.

Preparing a reaction system (300 mu L), and mixing the following components in percentage by volume: the percentage of the content of B +10% by weight of C +1% by weight of D +69% by weight of PBS Buffer was determined by 10%, and a group of blank controls containing no acyltransferase Tri18 was prepared, mixed uniformly, placed in a cuvette, and the absorbance at 412nm was measured with a microplate reader at 0, 5, 10, 15, and 20min after the reaction. At normal temperature, the change of 0.001 unit of catalytic light absorption value per mg of protein per minute in each mL reaction system is one enzyme activity unit and is expressed by U/mg. The calculation formula is as follows:

u/mg = ([ Delta ] A measurement- [ Delta ] A empty)/0.001/(Cpr 0.1 mL)/T

Cpr-protein concentration, mg/mL; t-reaction time, min

Temperature affects the catalytic activity of the enzyme, pH affects the conformation of the enzyme, and also affects the state of dissociation of the enzyme from the substrate, thereby affecting the activity and stability of the enzyme.

The enzyme activity of the acyltransferase Tri18 on the substrate acetyl CoA at different temperatures was determined at pH 7.0.

And (3) measuring the enzyme activity of the acyltransferase Tri18 to the substrate acetyl CoA at different pH values at the temperature of 40 ℃.

The specific result is that the optimum reaction temperature of the acyltransferase Tri18 is 40 ℃, but the enzyme activity is kept similar when the reaction system is 30-40 ℃ (figure 3A); the optimum pH value of the reaction is 6.0 under the weak acidic conditionThe enzyme activity is greatly lost (pH = 4.0-5.0), and the enzyme activity is relatively well retained under the weak alkaline condition (pH = 7.0-8.0) (figure 3B). The heat stability of the acyltransferase Tri18 was not ideal, and the enzyme activity remained around 40% after incubation for 90min at 40 ℃ (FIG. 3C). By varying the concentration of acetyl-CoA in the reaction system (acetyl acceptor is still assumed to be butanol), the Vmax of the acyltransferase Tri18 was found to be 307.7. + -. 10.91U/mg, km to be 376.5. + -. 30.07. Mu.M, and Kcat to be 1538.5S ^-1 Kcat/Km is 245.18. Mu.M/min (FIG. 3D). The enzyme activity of the acyltransferase Tri18 was approximately 115U/mg at 250 μ M acetyl-coa, pH =8.0, room temperature reaction conditions.

Sequence listing

<110> Guangdong province institute for microbiology (Guangdong province center for microbiological analysis and detection)

<120> acyltransferase, and coding gene and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1512

<212> DNA

<213> Myrothecium roridum A553 (Myrothecium roridum)

<400> 1

atgatggcct ccgtggacca actgaaagtt gatgtccttg tgacaccgaa gcaaaccatc 60

gacgatgagt cttaccttgc ttccggctcc gaacaatcgc catcttcacc cgtcgaatct 120

tccatcacct ccaattcccc gcctccagtc aacatggaca aatctccctc caagcccgag 180

caacctgctc ttcaacttcc gactttagat ccctctgaat tccgatggca cccgtctcct 240

gcagacagct ccgtgcttca gaggaaggca aatggcgtcg aggctcttgt tggtatcaaa 300

gatgccaacg ccatcggaac atacgatttc tactgcaaca tcgtcttgcg tgtgggcgaa 360

ttacccggtg ttacacttcc acgtctcaag cgcgccttcg ccaaagccct gctcgatgcc 420

cgttttgaga acccttcaat ctcttgctac ggttcttggg gacagaacaa ggagccacac 480

ctgccgcaca ttcagtacaa gtccttcaaa tctcacagcg aagcgcgtgc ttgggccaac 540

agcatcatct ccgtgcgggc aacgaatctg actactgccg aattgcgtgc tgaacgcatc 600

aaaaagcgca gagctgcggc ggtccaaaaa cctgccaatc ctctagatat catcatttct 660

gctgatgtgg ccaatgagag agctccactt ccggctggca ccagagtgga catcatgtgc 720

ctttacaacc acctcagctg ggacggcaaa ggccggtttt ttgcttccga gttggtgaag 780

cgcgctgctg tgatattgga aaagcgtgag gagaacaatg tgcctcctca aaaatgggga 840

agagaaggcg aggctggacc cgcccattct ggacgtcatg ttgttgagtt ggggccttcc 900

agtcaccaac acccaggaga gcctcttcaa ttccgttact gcctcagcat cgatgacagc 960

aagaaaatcg cagacgctgt caaaacacga ctgggctcca aatacaacat tggtcatgtt 1020

ggccatgctg caacagttct ggctctgctc aaacacaacc ctatcccggc ttctgctcga 1080

gattcagcat tcctcttttc cccattaccc gttgatgggc gcggattcct tgcagaggat 1140

cgcaagacgc ctcgttacgg aaacgctcaa gccgccgccg tcgttgagtt ccagctactg 1200

gcgtcctggg acatcaaggg agaagagcct gaagacctga aagtcgccct agacaacctg 1260

gcaaggaaaa tctcgaatgc cgtcccagaa gtccacgcaa ttccattctg caacgatggg 1320

cgctccgaga gcattatttc atacgaagtt cccggagaaa atagcaagag actttttgaa 1380

gttgaggatt gctttggcgg agtagaagtt gtgggatcca atgccttcct ccgaatggac 1440

acctggaggg atgctatccg tctgaccttg tgttacaaca acgggtgctt cacagattct 1500

cttgccgagg ag 1512

<210> 2

<211> 504

<212> PRT

<213> Myrothecium roridum A553 (Myrothecium roridum)

<400> 2

Met Met Ala Ser Val Asp Gln Leu Lys Val Asp Val Leu Val Thr Pro

1 5 10 15

Lys Gln Thr Ile Asp Asp Glu Ser Tyr Leu Ala Ser Gly Ser Glu Gln

20 25 30

Ser Pro Ser Ser Pro Val Glu Ser Ser Ile Thr Ser Asn Ser Pro Pro

35 40 45

Pro Val Asn Met Asp Lys Ser Pro Ser Lys Pro Glu Gln Pro Ala Leu

50 55 60

Gln Leu Pro Thr Leu Asp Pro Ser Glu Phe Arg Trp His Pro Ser Pro

65 70 75 80

Ala Asp Ser Ser Val Leu Gln Arg Lys Ala Asn Gly Val Glu Ala Leu

85 90 95

Val Gly Ile Lys Asp Ala Asn Ala Ile Gly Thr Tyr Asp Phe Tyr Cys

100 105 110

Asn Ile Val Leu Arg Val Gly Glu Leu Pro Gly Val Thr Leu Pro Arg

115 120 125

Leu Lys Arg Ala Phe Ala Lys Ala Leu Leu Asp Ala Arg Phe Glu Asn

130 135 140

Pro Ser Ile Ser Cys Tyr Gly Ser Trp Gly Gln Asn Lys Glu Pro His

145 150 155 160

Leu Pro His Ile Gln Tyr Lys Ser Phe Lys Ser His Ser Glu Ala Arg

165 170 175

Ala Trp Ala Asn Ser Ile Ile Ser Val Arg Ala Thr Asn Leu Thr Thr

180 185 190

Ala Glu Leu Arg Ala Glu Arg Ile Lys Lys Arg Arg Ala Ala Ala Val

195 200 205

Gln Lys Pro Ala Asn Pro Leu Asp Ile Ile Ile Ser Ala Asp Val Ala

210 215 220

Asn Glu Arg Ala Pro Leu Pro Ala Gly Thr Arg Val Asp Ile Met Cys

225 230 235 240

Leu Tyr Asn His Leu Ser Trp Asp Gly Lys Gly Arg Phe Phe Ala Ser

245 250 255

Glu Leu Val Lys Arg Ala Ala Val Ile Leu Glu Lys Arg Glu Glu Asn

260 265 270

Asn Val Pro Pro Gln Lys Trp Gly Arg Glu Gly Glu Ala Gly Pro Ala

275 280 285

His Ser Gly Arg His Val Val Glu Leu Gly Pro Ser Ser His Gln His

290 295 300

Pro Gly Glu Pro Leu Gln Phe Arg Tyr Cys Leu Ser Ile Asp Asp Ser

305 310 315 320

Lys Lys Ile Ala Asp Ala Val Lys Thr Arg Leu Gly Ser Lys Tyr Asn

325 330 335

Ile Gly His Val Gly His Ala Ala Thr Val Leu Ala Leu Leu Lys His

340 345 350

Asn Pro Ile Pro Ala Ser Ala Arg Asp Ser Ala Phe Leu Phe Ser Pro

355 360 365

Leu Pro Val Asp Gly Arg Gly Phe Leu Ala Glu Asp Arg Lys Thr Pro

370 375 380

Arg Tyr Gly Asn Ala Gln Ala Ala Ala Val Val Glu Phe Gln Leu Leu

385 390 395 400

Ala Ser Trp Asp Ile Lys Gly Glu Glu Pro Glu Asp Leu Lys Val Ala

405 410 415

Leu Asp Asn Leu Ala Arg Lys Ile Ser Asn Ala Val Pro Glu Val His

420 425 430

Ala Ile Pro Phe Cys Asn Asp Gly Arg Ser Glu Ser Ile Ile Ser Tyr

435 440 445

Glu Val Pro Gly Glu Asn Ser Lys Arg Leu Phe Glu Val Glu Asp Cys

450 455 460

Phe Gly Gly Val Glu Val Val Gly Ser Asn Ala Phe Leu Arg Met Asp

465 470 475 480

Thr Trp Arg Asp Ala Ile Arg Leu Thr Leu Cys Tyr Asn Asn Gly Cys

485 490 495

Phe Thr Asp Ser Leu Ala Glu Glu

500

Claims

1. An acyltransferase Tri18, characterized in that its amino acid sequence is shown as SEQ ID NO. 2.

2. An acyltransferase gene encoding the acyltransferase Tri18 of claim 1.

3. The acyltransferase gene as claimed in claim 2 wherein the nucleotide sequence is as shown in SEQ ID No. 1.

4. An expression vector comprising the acyltransferase gene for the acyltransferase Tri18 of claim 2.

5. Use of the acyltransferase Tri18 of claim 1 to catalyze the acyltransferase ester formation wherein the acyl-donor is acetyl-coa and the acceptor is butanol.