CN112553173B - Wild oxidase mutant and preparation method and application thereof - Google Patents
Wild oxidase mutant and preparation method and application thereof Download PDFInfo
- Publication number
- CN112553173B CN112553173B CN202011529752.9A CN202011529752A CN112553173B CN 112553173 B CN112553173 B CN 112553173B CN 202011529752 A CN202011529752 A CN 202011529752A CN 112553173 B CN112553173 B CN 112553173B
- Authority
- CN
- China
- Prior art keywords
- wild
- oxidase
- mutant
- oxidase mutant
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
- C12Y106/99—Oxidoreductases acting on NADH or NADPH (1.6) with other acceptors (1.6.99)
- C12Y106/99003—NADH dehydrogenase (1.6.99.3)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to the field of medical chemistry, in particular to the field of preparation of a drug intermediate, and more particularly relates to a wild oxidase mutant and a preparation method and application thereof. The wild oxidase mutant is NADH dependent oxidase, and the amino acid sequence of the wild oxidase mutant is shown in SEQ ID NO. 1. The wild oxidase mutant disclosed by the invention can be efficiently oxidized to generate (4R-cis) -6-formaldehyde-2, 2-dimethyl-1, 3-dioxane-4-tert-butyl acetate. The method has mild reaction conditions, can achieve the effect of no byproduct generation under the participation of a coenzyme system, is environment-friendly, and is an economic and efficient preparation method.
Description
Technical Field
The invention relates to the field of medical chemistry, in particular to the field of preparation of a drug intermediate, and more particularly relates to a wild oxidase mutant and a preparation method and application thereof.
Background
Methyl 2- ((4R,6S) -6-formaldehyde-2, 2-dimethyl-1, 3 dioxane-4-yl) -acetate is an important intermediate compound of the medicine. Currently, a common method for synthesizing 2- ((4R,6S) -6-formaldehyde-2, 2-dimethyl-1, 3 dioxane-4-yl) -methyl acetate is a chemical synthesis method, which mainly comprises two methods:
the method comprises the following steps:
the method needs oxygen to oxidize and break double bonds, has complex process operation, high preparation cost, low effective conversion rate and low purity of the obtained product. Meanwhile, because the raw materials are not easy to obtain, the synthesis is more complex, and the industrialization cost is increased.
The second method comprises the following steps:
although the method simplifies the process, the raw materials are not easy to obtain, and the synthesis process is also relatively complex and is not suitable for industrial production.
The enzyme method is used as a biological preparation method, and has the advantages of few side reaction products, environmental friendliness, consistent reaction conditions, simplicity in operation and the like.
Disclosure of Invention
The invention aims to solve the technical problem of finding a biological preparation method, so that a drug intermediate 2- ((4R,6S) -6-formaldehyde-2, 2-dimethyl-1, 3 dioxane-4-yl) -methyl acetate can be prepared and obtained by replacing the existing chemical synthesis method.
In order to solve the technical problems, the invention discloses a wild oxidase mutant, wherein the wild oxidase mutant is NADH dependent oxidase, and the amino acid sequence of the wild oxidase mutant is shown as SEQ ID NO. 1.
Further disclosed is a vector containing a nucleic acid molecule encoding the wild oxidase mutant.
Preferably, in the present invention, the vector is a pET-30a plasmid vector.
Meanwhile, the invention further discloses a recombinant bacterium containing the vector, preferably, the recombinant bacterium is any one of baker's yeast, saccharomyces cerevisiae, escherichia coli, bacillus subtilis and bacillus amyloliquefaciens, preferably, the recombinant bacterium is escherichia coli, and more preferably, escherichia coli (e.coli) BL21(DE 3).
Meanwhile, the invention further discloses a preparation method of the wild oxidase mutant, which induces the recombinant bacteria by isopropyl thiogalactoside (IPTG) so as to obtain the wild oxidase mutant.
In a preferred technical scheme, the invention further preferably adds propylthiogalactoside (IPTG) with the final concentration of 0.1mmol/L to induce when the OD600 of the recombinant bacteria culture solution reaches 0.6 to obtain the wild oxidase mutant.
Finally, the invention also discloses the application of the wild oxidase mutant in preparing the formula I by oxidizing the formula II, wherein the reaction equation is as follows:
wherein the oxidase can be in the form of mixture enzyme in cell lysate, and/or extracted crude enzyme, and/or treated immobilized enzyme.
Preferably, NAD + is used as cofactor in the oxidation reaction.
More preferably, NADH Oxidase (NOX) is further added to the oxidation reaction, thereby enabling the regeneration of the coenzyme factor.
As a preference, the present invention further discloses a reaction condition arbitrarily selecting any one or more of the following:
a. the dosage of the oxidase is 1-10U/ml;
b. the amount of the NADH oxidase is 0.5-8U/ml;
c. the amount of the NAD + is 0.1-1.0 mmol/L;
d. the reaction temperature is 0-80 ℃, preferably 10-50 ℃, and more preferably 15-37 ℃;
e. the pH value of the reaction environment is 4-12, preferably 4-8, and more preferably 5-8;
f. the concentration of the compound shown in the formula II is 20-200 mmol/L;
g. and a buffer solution Tris-HCl is also added, and the concentration of the buffer solution is 0.1-0.2 mol/L.
The wild oxidase mutant disclosed by the invention can be efficiently oxidized to generate (4R-cis) -6-formaldehyde-2, 2 dimethyl-1, 3-dioxane-4-tert-butyl acetate. The method has the advantages of mild reaction conditions, no byproduct generation effect under the participation of a coenzyme system, and environmental friendliness. The conversion rate of the (4R-cis) -6-formaldehyde-2, 2 dimethyl-1, 3-dioxane-4-tert-butyl acetate substrate prepared by the method disclosed by the invention can reach 92%, and the purity of the generated (4R-cis) -6-formaldehyde-2, 2 dimethyl-1, 3-dioxane-4-tert-butyl acetate product can reach 93%, so that the method is an economic and efficient preparation method.
Detailed Description
In order that the invention may be better understood, we now provide further explanation of the invention with reference to specific examples.
Unless otherwise specified, the reagents used in the examples of the present invention are all common commercial products.
Example 1 construction of engineered bacteria
1.1 error-prone PCR design
The original DNA sequence of wild oxidase (NCBI accession XM _005867960.2) is used as a template, artificial design is carried out after codon optimization, and the amino acid sequence obtained by coding the designed nucleic acid sequence is shown as SEQ ID: 1 is shown.
1.2PCR mutation amplification
The PCR amplification system is as follows: 10 XPCR buffer 10. mu.L, dNTP (0.1M) 2.4. mu.L, dNTP 2.5mM 1. mu.L, MgCl2 5mM 20μL，MgCl20.2 mmol/L20. mu.L, F Primer 1. mu.L, R Primer 1. mu.L, pUC18 template 1pUC18, Taq enzyme 2U, ddH2The content of O is filled to 100 mu L.
The PCR amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 45s, denaturation at 55 ℃ for 45s, and extension at 72 ℃ for 45s for 30 cycles; further extension at 72 deg.C for 10min, and storage at 4 deg.C.
1.3 preparation of engineering bacteria
Selecting enzyme cleavage sites of BamH I and XhoI to introduce the PCR amplification product into plasmid pET-30a, wherein the primer sequence is as follows:
F：gcgggatccatgttgctcaagcaaataaaatatctgt，
R：ccgctcgagtcaaaatgtcaggacagtgc。
the connection system of the target gene and the vector pET-30a is as follows: 4 mu L of target gene, 2 mu L of plasmid vector pET-30a, 2 mu L of Buffer, 1 mu L of ligase and overnight connection at 16 ℃ to obtain the pET-30a plasmid vector containing the target gene.
Introducing the constructed vector into Escherichia coli E.coli BL21(DE3) by transformation technology, coating the vector on an LB plate containing kanamycin, putting the LB plate into an incubator at 37 ℃ overnight, and carrying out plasmid extraction and sequencing on a single colony grown out to finally obtain the recombinant engineering bacterium containing the oxidase.
Example 2 preparation of wild oxidase mutant
If the engineered bacteria in example 1 are frozen in a refrigerator at-80 ℃, the engineered bacteria are activated by LB medium before the wild oxidase mutant is prepared. The proportion of the LB culture medium is as follows: 10g/L of peptone, 5g/L of yeast extract, 10g/L of NaCl, 37 ℃ and 6 hours of activation time.
The activated or unfrozen engineering bacteria with activity are inoculated into LB culture medium (the culture medium composition is as above) containing 10mg/100ml kanamycin and cultured overnight at 37 ℃ with shaking. The wild magnesium oxide mutant, NADH-dependent oxidase, as defined in the present invention was obtained by inoculating 1% (v/v) of the strain into a 250mL Erlenmeyer flask containing 100mL of LB medium (the medium composition is as above), shaking-culturing at 37 ℃ and 250rpm, adding IPTG at a final concentration of 0.1mmol/L when OD600 of the culture solution reached 0.6, and inducing at 25 ℃ and 200rpm for 6 hours.
Example 3 application of wild oxidase mutant in preparation of (4R-cis) -6-formaldehyde-2, 2 dimethyl-1, 3-dioxane-4-tert-butyl acetate
Adding 4U/L of the wild oxidase mutant obtained in example 2 as an oxidase, 4U/L of commercially available NADH oxidase NOX, to Tris-HCl buffer (0.1mol/L, pH7.5-8.0), then adding 120mmol/L of a substrate (compound of formula II), and further adding 0.1mmol/L of NAD +3 mg; the reaction was carried out at 30 ℃ for 10h with shaking at 200 rpm. Through detection, the substrate conversion rate is 92%, and the purity of the product (4R-cis) -6-formaldehyde-2, 2-dimethyl-1, 3-dioxane-4-tert-butyl acetate (the compound shown in the formula I) is 93%.
What has been described above is a specific embodiment of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and such improvements and modifications are also considered to be within the scope of the present invention.
Sequence listing
<110> Jiangsu alpha pharmaceutical Co., Ltd
<120> wild oxidase mutant and preparation method and application thereof
<130> 202010096
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 365
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Ser Thr Ala Gly Lys Val Ile Lys Cys Lys Ala Ala Val Leu Trp
1 5 10 15
Glu Glu Lys Lys Pro Phe Ser Ile Glu Glu Val Glu Val Ala Pro Pro
20 25 30
Lys Ala His Glu Val Arg Ile Lys Met Val Ala Thr Gly Val Cys Arg
35 40 45
Ser Asp Asp His Val Val Ser Gly Asn Leu Ala Thr Pro Leu Pro Val
50 55 60
Ile Ala Gly His Glu Ala Ala Gly Ile Val Glu Ser Ile Gly Glu Gly
65 70 75 80
Val Thr Thr Val Arg Lys Pro Gly Asp Lys Val Ile Pro Leu Phe Thr
85 90 95
Pro Gln Cys Gly Lys Cys Asn Val Cys Lys His Pro Glu Gly Asn Phe
100 105 110
Cys Val Lys Asn Asp Leu Ser Met Pro Arg Gly Thr Met Gln Asp Gly
115 120 125
Thr Thr Arg Phe Thr Cys Lys Gly Lys Ser Ile Asn His Phe Leu Ser
130 135 140
Thr Ser Thr Phe Ser Gln Tyr Thr Val Val Asp Glu Ile Ser Val Val
145 150 155 160
Lys Ile Asp Ala Ala Ala Pro Leu Asp Lys Val Cys Leu Ile Gly Cys
165 170 175
Gly Phe Thr Thr Gly Tyr Gly Ser Ala Val Lys Val Ala Lys Val Thr
180 185 190
Pro Gly Ser Thr Cys Val Val Phe Gly Leu Gly Gly Val Gly Leu Ser
195 200 205
Val Val Met Gly Cys Lys Ala Ala Gly Ala Ala Arg Ile Ile Gly Val
210 215 220
Asp Ile Asn Lys Asp Lys Tyr Ala Lys Ala Lys Gln Leu Gly Ala Thr
225 230 235 240
Glu Cys Ile Ser Pro Gln Asp Phe Lys Lys Pro Ile His Glu Val Leu
245 250 255
Lys Glu Met Ser Gly Gly Gly Val Asp Phe Ser Phe Glu Val Ile Gly
260 265 270
Arg Leu Asp Thr Met Glu Ala Ala Leu Ala Ser Cys His Glu Ala Tyr
275 280 285
Gly Val Ser Val Ile Val Gly Val Pro Pro Asp Ser His Asn Leu Ser
290 295 300
Met Asn Pro Met Leu Leu Leu Ser Gly Arg Thr Trp Lys Gly Ala Val
305 310 315 320
Phe Gly Gly Phe Lys Ser Lys Asp Ser Val Pro Lys Leu Val Ala Asp
325 330 335
Phe Met Ala Lys Lys Phe Ser Leu Asp Pro Leu Ile Thr His Val Leu
340 345 350
Pro Phe Glu Lys Ile Asn Glu Gly Phe Asp Leu Leu Arg
355 360 365
Claims (12)
1. A wild oxidase mutant characterized by: the wild oxidase mutant is NADH dependent oxidase, and the amino acid sequence of the wild oxidase mutant is shown in SEQ ID NO. 1.
2. A vector comprising a nucleic acid molecule encoding the wild oxidase mutant of claim 1; the vector is a pET-30a plasmid vector.
3. A recombinant bacterium comprising the vector of claim 2, wherein the recombinant bacterium is Escherichia coli.
4. The recombinant bacterium according to claim 3, which is Escherichia coli (E.coli) BL21(DE 3).
5. A method of making a mutant wild oxidase as described in claim 1, characterized in that: inducing the recombinant strain of claim 3 with isopropyl thiogalactoside (IPTG) to obtain the wild oxidase mutant of claim 1.
6. The method of the wild oxidase mutant according to claim 5, characterized in that: when the OD600 of the recombinant bacteria culture solution reaches 0.6, propyl thiogalactoside (IPTG) with the final concentration of 0.1mmol/L is added to induce to obtain a wild oxidase mutant.
7. Use of the wild-type oxidase mutant as claimed in claim 1 as oxidase in the oxidation of formula II to prepare formula I, wherein the reaction equation is as follows:
the mode of taking the wild oxidase mutant as the oxidase is mixture enzyme in cell lysate, and/or extracted crude enzyme, and/or processed immobilized enzyme;
the reaction temperature is 15-37 ℃;
the pH value of the reaction environment is 5-8;
the concentration of the compound shown in the formula II is 20-200 mmol/L;
and a buffer solution Tris-HCl is also added, and the concentration of the buffer solution is 0.1-0.2 mol/L.
8. Use according to claim 7, characterized in that: NAD + was used as cofactor in the reaction.
9. Use according to claim 8, characterized in that: the amount of the NAD + is 0.1-1.0 mmol/L.
10. Use according to claim 7, characterized in that: NADH oxidase is also added in the oxidation reaction.
11. Use according to claim 10, characterized in that: the amount of the NADH oxidase is 0.5-8U/ml.
12. Use according to claim 7, characterized in that: the dosage of the wild type oxidase mutant is 1-10U/ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011529752.9A CN112553173B (en) | 2020-12-22 | 2020-12-22 | Wild oxidase mutant and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011529752.9A CN112553173B (en) | 2020-12-22 | 2020-12-22 | Wild oxidase mutant and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112553173A CN112553173A (en) | 2021-03-26 |
| CN112553173B true CN112553173B (en) | 2022-05-31 |
Family
ID=75030802
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011529752.9A Active CN112553173B (en) | 2020-12-22 | 2020-12-22 | Wild oxidase mutant and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112553173B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103435592A (en) * | 2013-08-12 | 2013-12-11 | 南京欧信医药技术有限公司 | 2-((4R,6S)-6-formaldehyde-2,2-dimethyl-1,3 dioxane-4-base)-methyl acetate preparation method |
| CN104342410A (en) * | 2013-07-26 | 2015-02-11 | 南京朗恩生物科技有限公司 | Ketone reductase mutant and preparation method thereof |
| CN111363775A (en) * | 2020-03-18 | 2020-07-03 | 浙江工业大学 | Method for preparing L-glufosinate-ammonium by racemization removal with biological enzyme method, glufosinate-ammonium dehydrogenase mutant and application |
-
2020
- 2020-12-22 CN CN202011529752.9A patent/CN112553173B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342410A (en) * | 2013-07-26 | 2015-02-11 | 南京朗恩生物科技有限公司 | Ketone reductase mutant and preparation method thereof |
| CN103435592A (en) * | 2013-08-12 | 2013-12-11 | 南京欧信医药技术有限公司 | 2-((4R,6S)-6-formaldehyde-2,2-dimethyl-1,3 dioxane-4-base)-methyl acetate preparation method |
| CN111363775A (en) * | 2020-03-18 | 2020-07-03 | 浙江工业大学 | Method for preparing L-glufosinate-ammonium by racemization removal with biological enzyme method, glufosinate-ammonium dehydrogenase mutant and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112553173A (en) | 2021-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106479988B (en) | A kind of enzyme activity and stability-enhanced formic dehydrogenase mutant and its construction method | |
| CN107058248B (en) | Recombinant aldone reductase mutant, gene, vector, engineering bacterium and application thereof | |
| CN111254129B (en) | Polyphosphate kinase mutant and application thereof | |
| CN112175916B (en) | L-amino acid ligase mutant, recombinant vector, recombinant bacterium and application thereof | |
| CN112877307B (en) | Amino acid dehydrogenase mutant and application thereof | |
| CN109055324B (en) | Improved ketoreductase and application thereof | |
| CN114667346B (en) | EanB enzyme mutant and application thereof | |
| CN111893125A (en) | Chitosan enzyme gene, chitosanase, preparation method and application thereof | |
| CN113122527B (en) | Aspartase mutant with improved enzyme activity and changed optimal pH | |
| CN110592035B (en) | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol | |
| CN112746067A (en) | Lysine decarboxylase mutants for producing D-ornithine | |
| CN112553173B (en) | Wild oxidase mutant and preparation method and application thereof | |
| CN111748535B (en) | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine | |
| CN115058408B (en) | Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof | |
| CN114908129B (en) | Dehydrogenase for the preparation of (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| CN113061593B (en) | L-malate dehydrogenase mutant and application thereof | |
| CN112831532B (en) | Method for enzymatic synthesis of D-leucine | |
| CN114277020B (en) | Nitrilase mutant, engineering bacterium and application thereof | |
| CN110846288B (en) | Glutathione bifunctional enzyme mutant and application thereof | |
| CN115896081A (en) | Aspartase mutant and application thereof | |
| CN110343728B (en) | Method for synthesizing hexahydropyridazine-3-carboxylic acid through biotransformation | |
| CN107287256A (en) | The method that whole-cell catalytic synthesizes L-2- piperidine carboxylic acids | |
| CN112877305B (en) | Glucose dehydrogenase mutant with improved coenzyme affinity | |
| CN114752576B (en) | Catalase mutant and application thereof | |
| KR102291199B1 (en) | Biocatalytic process for the production of (r)-3-quinuclidinol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 223800 No.5, Yanshan Road, Suqian eco Chemical Technology Industrial Park, Suqian City, Jiangsu Province Applicant after: Jiangsu alpha Pharmaceutical Co.,Ltd. Address before: 223800 No.5 Yanshan Road, eco Chemical Technology Industrial Park, Suqian City, Jiangsu Province Applicant before: JIANGSU ALPHA PHARMACEUTICAL Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |