CN107287221B - Artificially synthesized gene for coding thymidine phosphorylase protein and application thereof - Google Patents
Artificially synthesized gene for coding thymidine phosphorylase protein and application thereof Download PDFInfo
- Publication number
- CN107287221B CN107287221B CN201610229357.6A CN201610229357A CN107287221B CN 107287221 B CN107287221 B CN 107287221B CN 201610229357 A CN201610229357 A CN 201610229357A CN 107287221 B CN107287221 B CN 107287221B
- Authority
- CN
- China
- Prior art keywords
- ala
- gly
- leu
- val
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1077—Pentosyltransferases (2.4.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/02—Pentosyltransferases (2.4.2)
- C12Y204/02004—Thymidine phosphorylase (2.4.2.4)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an artificially synthesized gene for coding thymidine phosphorylase protein and application thereof, belonging to the field of bioengineering. The optimized gene sequence is used for expressing the thymidine phosphorylase mutant, so that the total enzyme activity of unit thalli can be effectively improved, and the production cost of an anti-AIDS drug intermediate beta-thymidine can be effectively reduced. The production can be carried out only in a common fermentation workshop (such as an amino acid and vitamin production workshop), special equipment does not need to be purchased, and the method is easy to popularize and apply.
Description
Technical Field
The invention relates to an artificially synthesized gene for coding thymidine phosphorylase protein and application thereof, belonging to the field of bioengineering.
Background
Thymidine is an important intermediate of medicine raw material and biochemical reagent, and has wide application in research and production in biochemical field. Thymidine is an important raw material for preparing an anti-AIDS drug, namely Azidothymidine (AZT), but the content of the thymidine is required to be more than 98 percent, and the content of 5-methyluridine in the thymidine cannot exceed 0.3 percent. The preparation of thymidine at present mainly comprises two methods, namely chemical synthesis and DNA enzymolysis: the crude thymidine obtained by the chemical synthesis method contains oil, pigment, 5-methyluridine and other thymidine derivatives, and optical isomers are difficult to remove; in the process, a large amount of toxic and harmful organic solvent is also needed, and the process also has danger to environmental pollution. The enzymatic hydrolysis method hydrolyzes natural substances such as RNA or DNA, and the obtained thymidine crude product contains impurities such as deoxyadenosine (dA), deoxycytidine (dC), deoxyguanosine (dG), deoxyinosine (dI) and the like, and the separation and extraction are very complicated.
Thymidine phosphorylase has an important role in the biosynthesis of nucleoside drugs. The synthesized nucleoside medicament is widely applied to the field of medicines, such as HIV reverse transcriptase inhibitors zifudoxine (AZT), dideoxyinosine (ddl), zalcitabine (ddC) and the like for treating AIDS.
The thymidine phosphorylase can specifically act on beta-thymidine to catalyze reversible phosphorylation reaction of beta-thymidine, and can generate deoxyribose-1-phosphate and thymine from beta-thymidine, or generate beta-thymidine from deoxyribose-1-phosphate and thymine.
We obtain the mutated thymidine phosphorylase protein shown in the sequence 4 in the sequence table by performing directed mutation on the thymidine phosphorylase protein of Escherichia coli MG1655 shown in the sequence table 2, thereby solving the problem to be solved by the invention, namely how to efficiently express the thymidine phosphorylase protein in Escherichia coli.
Disclosure of Invention
We adjust the secondary structure and codon preference of the gene by a whole-gene synthesis method to realize high expression in Escherichia coli. Meanwhile, five amino acid mutations at the following positions were introduced at the time of synthesis: L10A, A209G, F210G, A221V, A413D, designed by using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/OPTIMIZER /), and ensuring that the Tm difference is controlled within 3 ℃, and the Primer length is controlled within 50base, the following primers are obtained:
the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.
| 2mM dNTP mix(2mM each dNTP) | 5μl |
| 10×Pfu buffer | 5μl |
| Pfu DNA polymerase(10U/μl) | 0.5μl |
| ddH20 | The total volume of the reaction system was adjusted to 50. mu.l |
The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 65 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.3, and the corresponding amino acid sequence is SEQ ID NO. 4.
The recombinant expression vector containing the gene and Escherichia coli belong to the protection scope of the invention.
The invention also claims the application of the Escherichia coli containing the gene in the fermentation production of thymidine phosphorylase.
The optimized gene sequence is used for expressing the thymidine phosphorylase mutant, so that the total enzyme activity of unit thalli can be effectively improved, and the production cost of an anti-AIDS drug intermediate beta-thymidine can be effectively reduced. The production can be carried out only in a common fermentation workshop (such as an amino acid and vitamin production workshop), special equipment does not need to be purchased, and the method is easy to popularize and apply.
Drawings
FIG. 1 is a map of an expression vector of thymidine phosphorylase mutant Seq ID No. 3.
Detailed Description
In order to better explain the invention, the invention is further illustrated below with reference to examples. The instruments and reagents used in the present examples are commercially available products unless otherwise specified.
Example 1
Escherichia coli MG1655 was cultured in LB medium at 37.0 ℃ for 1 day at 180rpm, and the precipitate was collected by centrifugation, and the genomic DNA of Escherichia coli MG1655 was extracted and purified using the Qiaamp Kit (Qiagen, Germany).
PCR amplification of Escherichia coli MG1655 genomic DNA with Pfu high fidelity enzyme
1655TP-F 5’ATGTTTCTCGCACAAGAAATTATTCG 3’
1655TP-R 5’TTATTCGCTGATACGGCGATAGA 3’
Since the GC content of the DNA of E.coli MG1655 was close to 50%, direct amplification was carried out using Pfu high fidelity enzyme. Then, the amplified fragment was treated with Taq polymerase at 72 ℃ for 10 minutes to add base A to the 3' end of the DNA. This was then ligated into a pMD19T-simple (Takara Bao Bio Inc., Beijing) cloning vector, and single clones were picked up and sent to Nanjing Kinsry organisms for sequencing. The DNA sequence obtained by sequencing is SEQ ID NO.1, and the corresponding amino acid sequence is SEQ ID NO. 2.
Example 2
The secondary structure and codon preference of the gene are adjusted by a whole-gene synthesis method so as to realize high expression in escherichia coli. Meanwhile, five amino acid mutations at the following positions were introduced at the time of synthesis: L10A, A209G, F210G, A221V, A413D, designed by using Primer Premier (http:// Primer3.ut. ee /) and OPTIMIZER (http:// genes. urv. es/0PTIMIZER /), and ensuring that the Tm difference is controlled within 3 ℃, and the Primer length is controlled within 50base, the following primers are obtained:
the above primers were synthesized, and the obtained primers were dissolved in double distilled water and added to the following reaction system so that the final concentration of each primer was 30nM and the final concentration of the head and tail primers was 0.6. mu.M.
| 2mM dNTP mix(2mM each dNTP) | 5μl |
| 10×Pfu buffer | 5μl |
| Pfu DNA polymerase(10U/μl) | 0.5μl |
| ddH20 | The total volume of the reaction system was adjusted to 50. mu.l |
The prepared PCR reaction system is placed in a Bori XP cycler gene amplification instrument and amplified according to the following procedures: 30s at 98 ℃, 45s at 65 ℃, 120s at 72 ℃ and 35 x. The DNA fragment obtained by PCR was purified by gel cutting and cloned into the NdeI/XhoI site of pET30a by homologous recombination. Single clones were picked for sequencing. The DNA sequence successfully sequenced is SEQ ID NO.3, and the corresponding amino acid sequence is SEQ ID NO. 4.
Example 3
Selecting a single escherichia coli colony containing an expression vector of SEQ ID NO.3, and inoculating the single escherichia coli colony in 10ml of an autoclaved culture medium: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.8g/L glucose, and kanamycin to 50 mg/L. The culture was carried out at 30 ℃ and 250rpm overnight. The next day, a 1L triangular flask is taken and inoculated into 100ml of culture medium after autoclaving according to the inoculation ratio of 1: 100: 10g/L tryptone, 5g/L yeast extract, 3.55g/L disodium hydrogen phosphate, 3.4g/L potassium dihydrogen phosphate, 2.68g/L ammonium chloride, 0.71g/L sodium sulfate, 0.493g/L magnesium sulfate heptahydrate, 0.027g/L ferric chloride hexahydrate, 5g/L glycerol, 0.3g/L glucose, and kanamycin to 50 mg/L. The cells were cultured at 30 ℃ until the OD 5-6 of the cells became zero, and the cells were immediately placed in a flask in a shaker at 25 ℃ and cultured at 250rpm for 1 hour. IPTG was added to a final concentration of 0.1mM and incubation was continued at 25 ℃ for 16 hours at 250 rpm. After completion of the culture, the culture was centrifuged at 12000g at 4 ℃ for 20 minutes to collect wet cells. Then the bacterial pellet is washed twice with distilled water, and the bacterial is collected and preserved at-70 ℃.
Example 4
The activity of the obtained thymidine phosphorylase was assayed by constructing a standard enzyme reaction solution according to the following system: 0.2M potassium phosphate buffer (pH7.4), 25mM thymidine, 1mM EDTA.
10ml of standard enzyme reaction liquid is filled in a 50ml centrifuge tube, and fermentation thalli are added according to the wet thalli amount of 5 percent; and (3) oscillating the reaction solution in a constant-temperature water bath for reaction for 3 hours under the condition of 25 ℃ water bath, and after the reaction is finished, terminating the reaction by placing the reaction solution in boiling water for 10 minutes. Transferring the reaction solution into a centrifuge tube, centrifuging at 12000r/min to remove precipitates, and taking supernate to dilute 100 times by using a diluted NaOH solution. The change in absorbance at 290nm of the diluted supernatant was measured using an ultraviolet spectrophotometer.
The same treatment was carried out as in the treatment of the experimental group described above using the blank solution as a control.
The enzyme activity unit is defined as: the wet bacterial cell amount required for the OD290nm to change by 0.01 within 1min at the pH of 7.4 and the temperature of 25 ℃ is defined as an enzyme activity unit;
the result shows that the thymidine phosphorylase activity containing five mutation sites is 3.60U/mg, while the thymidine phosphorylase activity before mutation is only 0.32U/mg wet thallus, and the enzyme activity is increased by about 10 times.
SEQUENCE LISTING
<110> Nanjing Nuo cloud Biotechnology Ltd
<120> artificially synthesized gene for coding thymidine phosphorylase protein and application thereof
<130> 2016
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 1323
<212> DNA
<213> Escherichia coli MG1655
<400> 1
atgtttctcg cacaagaaat tattcgtaaa aaacgtgatg gtcatgcgct gagcgatgaa 60
gaaattcgtt tctttatcaa cggtattcgc gacaacacta tctccgaagg gcagattgcc 120
gccctcgcga tgaccatttt cttccacgat atgacaatgc ctgagcgtgt ctcgctgacc 180
atggcgatgc gagattcagg aaccgttctc gactggaaaa gcctgcatct gaatggcccg 240
attgttgata aacactccac cggtggcgtc ggcgatgtga cttcgctgat gttggggccg 300
atggtcgcag cctgcggcgg ctatattccg atgatctctg gtcgcggcct cggtcatact 360
ggcggtacgc tcgacaaact ggaatccatc cctggcttcg acattttccc ggatgacaac 420
cgtttccgcg aaattattaa agacgtcggc gtggcgatta tcggtcagac cagttcactg 480
gctccggctg ataaacgttt ctacgcgacc cgtgatatta ccgcaaccgt ggactccatc 540
ccgctgatca ccgcctctat tctggcgaag aaacttgcgg aaggtctgga cgcgctggtg 600
atggacgtga aagtgggtag cggcgcgttt atgccgacct acgaactctc tgaagccctt 660
gccgaagcga ttgttggcgt ggctaacggc gctggcgtgc gcaccaccgc gctgctcacc 720
gacatgaatc aggtactggc ctccagtgca ggtaacgcgg ttgaagttcg tgaagcggtg 780
cagttcctga cgggtgaata tcgtaacccg cgtctgtttg atgtcacgat ggcgctgtgc 840
gtggagatgc tgatctccgg caaactggcg aaagatgacg ccgaagcgcg cgcgaaattg 900
caggcggtgc tggacaacgg taaagcggca gaagtctttg gtcgtatggt agcggcacaa 960
aaaggcccga ccgacttcgt tgagaactac gcgaagtatc tgccgacagc gatgctgacg 1020
aaagcagtct atgctgatac cgaaggtttt gtcagtgaaa tggatacccg cgcgctgggg 1080
atggcagtgg ttgcaatggg cggcggacgc cgtcaggcat ctgacaccat cgattacagc 1140
gtcggcttta ctgatatggc gcgtctgggc gaccaggtag acggtcagcg tccgctggcg 1200
gttatccacg cgaaagacga aaacaactgg caggaagcgg cgaaagcggt gaaagcggca 1260
attaaacttg ccgataaagc accggaaagc acaccaactg tctatcgccg tatcagcgaa 1320
taa 1323
<210> 2
<211> 440
<212> PRT
<213> Escherichia coli str. K-12 substr. MG1655
<400> 2
Met Phe Leu Ala Gln Glu Ile Ile Arg Lys Lys Arg Asp Gly His Ala
1 5 10 15
Leu Ser Asp Glu Glu Ile Arg Phe Phe Ile Asn Gly Ile Arg Asp Asn
20 25 30
Thr Ile Ser Glu Gly Gln Ile Ala Ala Leu Ala Met Thr Ile Phe Phe
35 40 45
His Asp Met Thr Met Pro Glu Arg Val Ser Leu Thr Met Ala Met Arg
50 55 60
Asp Ser Gly Thr Val Leu Asp Trp Lys Ser Leu His Leu Asn Gly Pro
65 70 75 80
Ile Val Asp Lys His Ser Thr Gly Gly Val Gly Asp Val Thr Ser Leu
85 90 95
Met Leu Gly Pro Met Val Ala Ala Cys Gly Gly Tyr Ile Pro Met Ile
100 105 110
Ser Gly Arg Gly Leu Gly His Thr Gly Gly Thr Leu Asp Lys Leu Glu
115 120 125
Ser Ile Pro Gly Phe Asp Ile Phe Pro Asp Asp Asn Arg Phe Arg Glu
130 135 140
Ile Ile Lys Asp Val Gly Val Ala Ile Ile Gly Gln Thr Ser Ser Leu
145 150 155 160
Ala Pro Ala Asp Lys Arg Phe Tyr Ala Thr Arg Asp Ile Thr Ala Thr
165 170 175
Val Asp Ser Ile Pro Leu Ile Thr Ala Ser Ile Leu Ala Lys Lys Leu
180 185 190
Ala Glu Gly Leu Asp Ala Leu Val Met Asp Val Lys Val Gly Ser Gly
195 200 205
Ala Phe Met Pro Thr Tyr Glu Leu Ser Glu Ala Leu Ala Glu Ala Ile
210 215 220
Val Gly Val Ala Asn Gly Ala Gly Val Arg Thr Thr Ala Leu Leu Thr
225 230 235 240
Asp Met Asn Gln Val Leu Ala Ser Ser Ala Gly Asn Ala Val Glu Val
245 250 255
Arg Glu Ala Val Gln Phe Leu Thr Gly Glu Tyr Arg Asn Pro Arg Leu
260 265 270
Phe Asp Val Thr Met Ala Leu Cys Val Glu Met Leu Ile Ser Gly Lys
275 280 285
Leu Ala Lys Asp Asp Ala Glu Ala Arg Ala Lys Leu Gln Ala Val Leu
290 295 300
Asp Asn Gly Lys Ala Ala Glu Val Phe Gly Arg Met Val Ala Ala Gln
305 310 315 320
Lys Gly Pro Thr Asp Phe Val Glu Asn Tyr Ala Lys Tyr Leu Pro Thr
325 330 335
Ala Met Leu Thr Lys Ala Val Tyr Ala Asp Thr Glu Gly Phe Val Ser
340 345 350
Glu Met Asp Thr Arg Ala Leu Gly Met Ala Val Val Ala Met Gly Gly
355 360 365
Gly Arg Arg Gln Ala Ser Asp Thr Ile Asp Tyr Ser Val Gly Phe Thr
370 375 380
Asp Met Ala Arg Leu Gly Asp Gln Val Asp Gly Gln Arg Pro Leu Ala
385 390 395 400
Val Ile His Ala Lys Asp Glu Asn Asn Trp Gln Glu Ala Ala Lys Ala
405 410 415
Val Lys Ala Ala Ile Lys Leu Ala Asp Lys Ala Pro Glu Ser Thr Pro
420 425 430
Thr Val Tyr Arg Arg Ile Ser Glu
435 440
<210> 3
<211> 1323
<212> DNA
<213> Artificial sequence
<400> 3
atgttcctgg ctcaggaaat catccgtaaa aaacgtgacg gtcacgctct gtctgacgaa 60
gaaatccgtt tcttcatcaa cggtatccgt gacaacacca tctctgaagg tcagatcgct 120
gctctggcta tgaccatctt cttccacgac atgaccatgc cggaacgtgt ttctctgacc 180
atggctatgc gtgactctgg taccgttgct gactggaaat ctctgcacct gaacggtccg 240
atcgttgaca aacactctac cggtggtgtt ggtgacgtta cctctctgat gctgggtccg 300
atggttgctg cttgcggtgg ttacatcccg atgatctctg gtcgtggtct gggtcacacc 360
ggtggtaccc tggacaaact ggaatctatc ccgggtttcg acatcttccc ggacgacaac 420
cgtttccgtg aaatcatcaa agacgttggt gttgctatca tcggtcagac ctcttctctg 480
gctccggctg acaaacgttt ctacgctacc cgtgacatca ccgctaccgt tgactctatc 540
ccgctgatca ccgcttctat cctggctaaa aaactggctg aaggtctgga cgctctggtt 600
atggacgtta aagttggttc tggtggtggt atgccgacct acgaactgtc tgaagctctg 660
gttgaagcta tcgttggtgt tgctaacggt gctggtgttc gtaccaccgc tctgctgacc 720
gacatgaacc aggttctggc ttcttctgct ggtaacgctg ttgaagttcg tgaagctgtt 780
cagttcctga ccggtgaata ccgtaacccg cgtctgttcg acgttaccat ggctctgtgc 840
gttgaaatgc tgatctctgg taaactggct aaagacgacg ctgaagctcg tgctaaactg 900
caggctgttc tggacaacgg taaagctgct gaagttttcg gtcgtatggt tgctgctcag 960
aaaggtccga ccgacttcgt tgaaaactac gctaaatacc tgccgaccgc tatgctgacc 1020
aaagctgttt acgctgacac cgaaggtttc gtttctgaaa tggacacccg tgctctgggt 1080
atggctgttg ttgctatggg tggtggtcgt cgtcaggctt ctgacaccat cgactactct 1140
gttggtttca ccgacatggc tcgtctgggt gaccaggttg acggtcagcg tccgctggct 1200
gttatccacg ctaaagacga aaacaactgg caggaagacg ctaaagctgt taaagctgct 1260
atcaaactgg ctgacaaagc tccggaatct accccgaccg tttaccgtcg tatctctgaa 1320
taa 1323
<210> 4
<211> 440
<212> PRT
<213> Artificial sequence
<400> 4
Met Phe Leu Ala Gln Glu Ile Ile Arg Lys Lys Arg Asp Gly His Ala
1 5 10 15
Leu Ser Asp Glu Glu Ile Arg Phe Phe Ile Asn Gly Ile Arg Asp Asn
20 25 30
Thr Ile Ser Glu Gly Gln Ile Ala Ala Leu Ala Met Thr Ile Phe Phe
35 40 45
His Asp Met Thr Met Pro Glu Arg Val Ser Leu Thr Met Ala Met Arg
50 55 60
Asp Ser Gly Thr Val Ala Asp Trp Lys Ser Leu His Leu Asn Gly Pro
65 70 75 80
Ile Val Asp Lys His Ser Thr Gly Gly Val Gly Asp Val Thr Ser Leu
85 90 95
Met Leu Gly Pro Met Val Ala Ala Cys Gly Gly Tyr Ile Pro Met Ile
100 105 110
Ser Gly Arg Gly Leu Gly His Thr Gly Gly Thr Leu Asp Lys Leu Glu
115 120 125
Ser Ile Pro Gly Phe Asp Ile Phe Pro Asp Asp Asn Arg Phe Arg Glu
130 135 140
Ile Ile Lys Asp Val Gly Val Ala Ile Ile Gly Gln Thr Ser Ser Leu
145 150 155 160
Ala Pro Ala Asp Lys Arg Phe Tyr Ala Thr Arg Asp Ile Thr Ala Thr
165 170 175
Val Asp Ser Ile Pro Leu Ile Thr Ala Ser Ile Leu Ala Lys Lys Leu
180 185 190
Ala Glu Gly Leu Asp Ala Leu Val Met Asp Val Lys Val Gly Ser Gly
195 200 205
Gly Gly Met Pro Thr Tyr Glu Leu Ser Glu Ala Leu Val Glu Ala Ile
210 215 220
Val Gly Val Ala Asn Gly Ala Gly Val Arg Thr Thr Ala Leu Leu Thr
225 230 235 240
Asp Met Asn Gln Val Leu Ala Ser Ser Ala Gly Asn Ala Val Glu Val
245 250 255
Arg Glu Ala Val Gln Phe Leu Thr Gly Glu Tyr Arg Asn Pro Arg Leu
260 265 270
Phe Asp Val Thr Met Ala Leu Cys Val Glu Met Leu Ile Ser Gly Lys
275 280 285
Leu Ala Lys Asp Asp Ala Glu Ala Arg Ala Lys Leu Gln Ala Val Leu
290 295 300
Asp Asn Gly Lys Ala Ala Glu Val Phe Gly Arg Met Val Ala Ala Gln
305 310 315 320
Lys Gly Pro Thr Asp Phe Val Glu Asn Tyr Ala Lys Tyr Leu Pro Thr
325 330 335
Ala Met Leu Thr Lys Ala Val Tyr Ala Asp Thr Glu Gly Phe Val Ser
340 345 350
Glu Met Asp Thr Arg Ala Leu Gly Met Ala Val Val Ala Met Gly Gly
355 360 365
Gly Arg Arg Gln Ala Ser Asp Thr Ile Asp Tyr Ser Val Gly Phe Thr
370 375 380
Asp Met Ala Arg Leu Gly Asp Gln Val Asp Gly Gln Arg Pro Leu Ala
385 390 395 400
Val Ile His Ala Lys Asp Glu Asn Asn Trp Gln Glu Asp Ala Lys Ala
405 410 415
Val Lys Ala Ala Ile Lys Leu Ala Asp Lys Ala Pro Glu Ser Thr Pro
420 425 430
Thr Val Tyr Arg Arg Ile Ser Glu
435 440
Claims (4)
1. The artificially synthesized gene for coding the thymic phosphorylase protein mutant has a nucleic acid sequence shown as SEQ ID NO: 3.
2. a recombinant expression vector comprising the gene of claim 1.
3. Escherichia coli containing the gene of claim 1.
4. Use of an escherichia coli strain according to claim 3 for the fermentative production of thymidine phosphorylase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610229357.6A CN107287221B (en) | 2016-04-13 | 2016-04-13 | Artificially synthesized gene for coding thymidine phosphorylase protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610229357.6A CN107287221B (en) | 2016-04-13 | 2016-04-13 | Artificially synthesized gene for coding thymidine phosphorylase protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107287221A CN107287221A (en) | 2017-10-24 |
| CN107287221B true CN107287221B (en) | 2021-01-05 |
Family
ID=60093269
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610229357.6A Active CN107287221B (en) | 2016-04-13 | 2016-04-13 | Artificially synthesized gene for coding thymidine phosphorylase protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107287221B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1379101A (en) * | 2002-02-01 | 2002-11-13 | 杭州华大基因研发中心 | Refractory thymidine phosphorylase gene and its polypeptide coded by it and preparing process |
| CN102206606A (en) * | 2011-03-31 | 2011-10-05 | 山东大学 | Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA) |
-
2016
- 2016-04-13 CN CN201610229357.6A patent/CN107287221B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1379101A (en) * | 2002-02-01 | 2002-11-13 | 杭州华大基因研发中心 | Refractory thymidine phosphorylase gene and its polypeptide coded by it and preparing process |
| CN102206606A (en) * | 2011-03-31 | 2011-10-05 | 山东大学 | Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA) |
Non-Patent Citations (2)
| Title |
|---|
| A new thymidine phosphorylase mutation causing elongation of the protein underlies mitochondrial neurogastrointestinal encephalomyopathy;Cardaioli E等;《J Neurol》;20110612;第259卷(第1期);第172–174页 * |
| 核苷磷酸化酶的克隆、表达与应用;丁庆豹;《中国博士学位论文全文数据库 基础科学辑》;20120415(第04期);A006-11 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107287221A (en) | 2017-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11040996B2 (en) | Method for preparing nicotinamide mononucleotide (NMN) | |
| CN111718915B (en) | Nicotinamide phosphoribosyl transferase mutant, recombinant expression vector and recombinant bacterium containing mutant and application | |
| CN107922952B (en) | Method for preparing nicotinamide mononucleotide | |
| CN107858340B (en) | High-catalytic-activity D-fructose-6-phosphate aldolase A mutant, recombinant expression vector, genetically engineered bacterium and application thereof | |
| CN103710321A (en) | Nicotinamide mononucleotide adenylyltransferase (Nmnat) mutant as well as coding gene and application thereof | |
| WO2017148163A1 (en) | Method for extracting 2',3'-cyclic nucleoside monophosphates | |
| KR20200010285A (en) | Genomic Engineering of Biosynthetic Pathways Inducing Increased NADPH | |
| CN109593749B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesis of chiral epichlorohydrin | |
| CN107287172B (en) | Method for producing thymidine phosphorylase by using escherichia coli fermentation | |
| CN113430181B (en) | Bacterial laccase derived from Asian elephant intestinal metagenome and gene thereof | |
| CN104480127B (en) | Hyperthermophilic glucosides enzyme mutant and its application in prepared by Ginsenoside compound K | |
| TWI719140B (en) | New polyphosphate-dependent glucokinase and method for preparing glucose 6-phosphate using the same | |
| CN103103234A (en) | Method for synthesizing nicotinamide adenine dinucleotide (NAD) by immobilized enzyme | |
| US20240076705A1 (en) | Lambda-carrageenase mutant ouc-cgla-dpqq and application thereof | |
| CN107287221B (en) | Artificially synthesized gene for coding thymidine phosphorylase protein and application thereof | |
| CN107287173B (en) | Thymidine phosphorylase protein mutant | |
| CN106244566B (en) | A kind of chondroitin synthase mutant and its application | |
| CN111808836B (en) | Heat-resistant mutant enzyme of pullulanase I and preparation method and application thereof | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN112410353B (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
| WO2017215174A1 (en) | Marine bacterial gene lfliz and use | |
| CN115948363B (en) | Tn5 transposase mutant and preparation method and application thereof | |
| CN115058402B (en) | Nicotinamide ribokinase mutant and coding gene and application thereof | |
| CN111826368B (en) | Mutant enzyme of type I pullulanase and preparation method and application thereof | |
| CN117210429A (en) | Histidine trimethylase EgtD mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |