CN104651324A - CTP (Cytidine Triphosphate) synthetase of cordyceps sinensis, coding gene and application of CTP synthetase - Google Patents

Abstract

The invention relates to CTP (Cytidine Triphosphate) synthetase from Bailing producing strain cordyceps sinensis hirsutella sinensis participated in synthesis of metabolic cytidine triphosphate from uridine triphosphate, a gene for coding the synthetase and application of the CTP synthetase; the CTP synthetase has an amino acid sequence represented by SEQ ID No.2 and with the homology of more than 90%; the coding gene has a nucleotide sequence represented by SEQ ID No.4 and with the homology of more than 90%; a metabolic pathway of synthesis of cytidine triphosphate by uridine triphosphate is researched in a detailed manner in principle; cloned DNA of the nucleotide sequence provided by the invention can be transferred into engineering bacteria through transduction, conversion and conjugal transfer methods; by adjusting expression of a biosynthetic gene of cytidine triphosphate, the high expressivity of host cytidine triphosphate is given; an effective way is provided for increasing the yield of cytidine triphosphate; and therefore, the CTP synthetase has great application prospect.

Description

Cordyceps sinensis CTP synthetic enzyme, encoding gene and application thereof

(1) technical field

The present invention relates to a participation uridine triphosphate producing bacterium Cordyceps sinensis China pilose spore from " hundred make " to set out the CTP synthetic enzyme (CTP synthase) of anabolism cytidine, the gene of this enzyme of encoding and application thereof.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in the stroma on lepidopteran (Lepidoptera) Hepialidae insect (Hepialus armoricanus Oberthur) larva and the complex body (comprising stroma and polypide) on larva corpse.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the feature of meta-bolites and diverse biological activities, shows huge application and development prospect at biomedicine field.Cordyceps sinensis extensively, obviously receives much concern with its multiple medicinal efficacy, worldwide enjoys high praise.The traditional Chinese medical science is thought, Cordyceps sinensis enters lung kidney two warp, can tonifying lung cloudy, again can kidney-replenishing, cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, and phthisical cough phlegm blood, spontaneous sweating etc. are unique a kind of Chinese medicine that can balance simultaneously, regulate negative and positive.Modern pharmacology confirms, and Cordyceps sinensis has the biological activity widely such as immunomodulatory, antibacterial, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And in the actual production such as artificial culture, liquid fermenting, use the Cordyceps fungus in imperfect stage, thus the qualification of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is done a lot of work in Cordyceps Resources investigation, anamorph confirmation, activeconstituents compartment analysis and the mechanism of action, Application and Development.Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, therefore its output is very low, and price is high.Wild cordyceps owing to restricting by factors such as growing environments, scarcity of resources.Owing to making little progress on artificial culture in recent years, the research of wild cordyceps surrogate focused mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way solving Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation produces Chinese caterpillar fungus substitute, both can these precious resources of available protecting Chinese caterpillar fungus, and the restriction that climate, geographical environment and Chinese caterpillar fungus parasitic conditions are not strict again, is suitable for industrialization scale operation.The substitute produced is as also similar to natural cs with drug effect in its composition of mycelium, is thus devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, prove with natural cs chemical constitution, pharmacological action basically identical, natural cs can be replaced to produce cordyceps product, to make up the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites is all significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic techniques, in worm grass product research and development, progressively turn to deeper functional metabolic Study on product by the direct utilization of Chinese caterpillar fungus raw material or crude extract.Large quantifier elimination is done to Chinese caterpillar fungus meta-bolites both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative research of functional metabolic product in biosynthesizing, pharmacological action etc. such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL wins initial success.

Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein miazines nucleosides comprises cytidine(C and uridine.Uridine (uracil riboside), also known as uridine (uIidine), has another name called and to be muttered ribosyl uridylic by snow riboside, dihydro-pyrimidin nucleosides, 1-β-D-.Cytidine(C (cytosine riboside) has another name called cytidine (cytidine), cytidine, 1-β-D-ribofuranosyl cytidine.Pyrimidine nucleoside is multiduty nucleosides, can be used as the additive of healthcare products and food.It also becomes the requisite of people's life gradually as beauty treatment and anti-ultraviolet radiation makeup, as medicine, clinical application is in nervus centralis, uropoiesis, metabolism and many-sided disease such as cardiovascular, in the U.S., nucleic acid medicine shows irreplaceable effect at antiviral, anti-tumor aspect in recent years.

Due to the important physiological action of pyrimidine nucleoside and analogue thereof, domestic and international related microorganism produces the existing a lot of research of miazines nucleosides.But as the Cordyceps fungus of important anabolism miazines nucleosides, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in Cordyceps fungus miazines nucleosides metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is for the above deficiency that exists and the technical issues that need to address, the enzyme of bacterium Cordyceps sinensis China pilose spore anabolism cytidine is produced to " hundred make " and encoding gene is furtherd investigate, provide " hundred makes " and produce bacterium Cordyceps sinensis China pilose spore participation uridine triphosphate and to set out the enzyme of anabolism cytidine, encoding gene and application thereof.

The technical solution used in the present invention is:

The present invention relates to a kind of CTP synthetic enzyme of the anabolism cytidine that sets out from " hundred make " production bacterium Cordyceps sinensis China pilose spore participation uridine triphosphate, described enzyme has aminoacid sequence more than 90% homology shown in SEQ ID No.1 or SEQ ID No.2, the pynK2 albumen of preferred sequence to be the pynK1 albumen of SEQ ID No.1 or sequence be SEQ ID No.2; This enzyme can prepare cytidine by catalysis uridine triphosphate.Due to the singularity of aminoacid sequence; the fragment of any peptide protein containing aminoacid sequence shown in SEQ ID No.1 or SEQ ID No.2 or its variant; as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequences homology, more than 90%, all belong to the row of scope.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in aminoacid sequence; Wherein, the conservative property for variant changes, and the amino acid replaced has the structure similar to original acid or chemical property, and as replaced Isoleucine with leucine, variant also can have non-conservation and change, as replaced glycine with tryptophane.

The path being obtained cytidine by uridine triphosphate anabolism is as follows:

The invention still further relates to described Cordyceps sinensis CTP synthetic enzyme and prepare application in cytidine at biocatalysis uridine triphosphate, concrete described application is preferably: with the broken mixed solution of the wet thallus obtained containing Cordyceps sinensis CTP synthetic enzyme thalline fermentation culture after cytoclasis for catalyzer, take uridine triphosphate as substrate, be in the transformation system of buffered soln formation of 6.5 ~ 8.5 in pH, at 30 DEG C, conversion reaction 2 ~ 3h under 150rpm condition, after reaction terminates, by reacting liquid filtering, get filtrate and be crude product containing cytidine, described crude isolate purified acquisition cytidine, the starting point concentration of described substrate is 10g/L, and the volumetric usage of described catalyzer is 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

The preparation method of described catalyzer is: Cordyceps sinensis CTP synthetic enzyme recombinant bacterium E.coliBL21/pET-28a/pynK1 or E.coli BL21/pET-28a/pynK2 is inoculated in 5mL and contains in the LB liquid nutrient medium of Kan resistance (50mg/L), 37 DEG C, 250r/min overnight incubation.Get 1mL culture, transferred in 50mL fresh containing the LB liquid nutrient medium of Kan resistance in 37 DEG C, 250r/min is cultured to cell concentration OD600 and is about about 0.6 ~ 0.8, the IPTG inducing culture 8h of finite concentration (240mg/ml) is added in culture, get induction broth to filter, collect wet thallus, wet thallus 0.5g phosphate buffered saline buffer (50mM, pH8.0) 15mL taking collection suspends, and the thalline mixed solution that ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) obtains afterwards is as catalysis enzyme.

The invention still further relates to the encoding gene of above-mentioned CTP synthetic enzyme, i.e. Cordyceps sinensis CTP synthase gene, described gene has nucleotide sequence more than 90% homology shown in SEQ ID No.3 or SEQ ID No.4, the pynK2 gene of preferred sequence to be the pynK1 gene of SEQ ID No.3 or sequence be SEQ ID No.4.Due to the singularity of nucleotide sequence, shown in any SEQ ID NO:3 or SEQ ID NO:4, the variant of polynucleotide, as long as itself and this polynucleotide have more than 90% homology, all belongs to the row of scope.The variant of described polynucleotide refers to a kind of polynucleotide sequence having one or more Nucleotide and change.The variant of these polynucleotide can make raw displacement varient or the varient of non-life, comprises and replaces varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be the replacement of polynucleotide, disappearance or insertion, but can not from the function of peptide protein changing in fact its coding.

Described gene can be used for building can prepare the genetic engineering bacterium of cytidine, to expand the output of cytidine or derivatives thereof by biocatalysis uridine triphosphate; Described is applied as: build the recombinant vectors containing described Cordyceps sinensis CTP synthase gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtained carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells containing Cordyceps sinensis CTP synthetic enzyme.

The bacterial strain of Cordyceps sinensis CTP synthetic enzyme of the present invention and encoding gene thereof can be provided to be China pilose spore (Hirsutella Sinensis) L0106, this culture presevation is in China typical culture collection center, deposit number is CCTCC No:M 2011278, discloses in the patent CN102373190A of previously application.

Main points of the present invention there are provided SEQ ID NO:1 or the aminoacid sequence shown in SEQ ID NO:2 and SEQ ID NO:3 or the nucleotide sequence shown in SEQ ID NO:4, when this aminoacid sequence known and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and related vector, host cell acquisition, be all apparent to those skilled in the art.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in detail uridine triphosphate synthesis cytidine pathways metabolism principle, the cloned DNA comprising nucleotide sequence provided by the present invention can be used for proceeding in engineering bacteria by the method for transduction, conversion, Conjugative tiansfer, by regulating the expression of cytidine biosynthesis gene, give the high expression level of host's cytidine, for the output expanding cytidine or derivatives thereof provides effective way, there is major application prospect.

(4) accompanying drawing explanation

Fig. 1 is the denaturing formaldehyde gel electrophorogram that " hundred make " produces bacterium Cordyceps sinensis China pilose spore total serum IgE;

Fig. 2 is purine metabolism approach annotated map;

Fig. 3 is CTP synthase gene pcr amplification product gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/pynK physical map;

Fig. 6 is recombinant expression plasmid pET-28a/pynK building process schematic diagram;

Fig. 7 is recombinant expression plasmid pET-28a/pynK physical map;

Fig. 8 is that CTP synthetase albumen SDS-PAGE schemes.

(5) embodiment

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: first gather natural cordyceps from Qinghai, and taken back Hangzhou and carry out separation screening, obtain L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is in China typical culture collection center, deposit number is CCTCC No:M 2011278, discloses in the patent CN102373190A of previously application.

By this strain inoculation in inclined-plane, (this is the liquid formulations before solidification to culture medium prescription, by following proportions well after bevel again) be glucose 2.0% (w/v, 1% represents in 100mL substratum containing 1g, down together), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, magnesium sulfate 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water, cultivates 25 days at 12 ~ 16 DEG C; Then by strain inoculation in fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, magnesium sulfate 0.01%, potassium primary phosphate 0.02%, surplus is water, be placed on shaking table, temperature 12 ~ 16 DEG C is cultivated 25 days, after cultivation terminates aseptically, carries out solid-liquid separation, and solid is placed in sterilized equipment, for subsequent use.

Embodiment 2: " hundred make " produces the extraction of bacterium Cordyceps sinensis China pilose spore total serum IgE

Total serum IgE is extracted with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly adding liquid nitrogen is fully ground to Powdered, be dispensed in the 1.5mL centrifuge tube of precooling, add 1mLTRIzol reagent, mixing, leaves standstill 5min on ice, nucleic acid-protein mixture is separated completely.2) RNA is separated: add 0.2mL chloroform, firmly concussion mixing 15s, and leave standstill 2 ~ 3min on ice, 4 DEG C, the centrifugal 15min of 12000rpm, layering, gets upper strata aqueous phase, about 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leaving standstill 10min on ice, 4 DEG C, the centrifugal 10min of 12000rpm, abandon supernatant.4) RNA washing: add 1mL 75% (v/v) ethanol, precipitation hanged, leaves standstill 10min on ice, 4 DEG C, the centrifugal 15min of 7500rpm; Repeat washing step above, then wash one time.5) RNA is dissolved: be placed in by centrifuge tube and open wide dry 5 ~ 10min on ice, add appropriate DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

After extracting sample total serum IgE, with the enrichment with magnetic bead mRNA with Oligo (dT).Add fragmentationbuffer and mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, Article 1 cDNA chain is synthesized with hexabasic base random primer (random hexamers), then Article 2 cDNA chain is synthesized, do end reparation after adding EB buffer solution elution through QiaQuickPCR kits, add polyA and connect sequence measuring joints again, then clip size selection is carried out with agarose gel electrophoresis, finally carry out pcr amplification, the sequencing library Illumina GA IIx built up checks order.The raw image data obtained that checks order is converted into sequence data through base calling, i.e. raw data or raw reads.Only containing the reads of adaptor sequence in removing primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " production bacterium Cordyceps sinensis China pilose spore RNA is short reads sequence assembling

Use short reads composite software SOAPdenovo (Li, Zhu et al.De novo assembly of humangenomes with massively parallel short read sequencing [J] .Genome Res, 2010,20:265-272.) do transcript profile and from the beginning assemble.First the reads with certain length overlap is linked to be the longer Contig fragment not containing N by SOAPdenovo.Then Contig is returned in reads comparison, determine from the distance between the different Contig of same transcript and these Contig by paired-end reads, these Contig connect together by SOAPdenovo, and middle unknown nucleotide sequence N represents, so just obtains Scaffold.Utilize paired-endreads to do filling-up hole process to Scaffold further, finally obtain containing N minimum, the Unigene sequence that two ends can not extend again.Finally, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are done blastx comparison (evalue<0.00001), get the sequence direction that the best albumen of comparison result determines Unigene.If the comparison result between different sink is contradictory, then press nr, Swiss-Prot, the priority of KEGG and COG determines the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan (Iseli, Jongeneel et al.ESTScan:a program for detecting, evaluating, and reconstructing potential coding regionsin EST sequences [J] .In Proceedings of 9th InternationalConference on Intelligent Systemsfor Molecular Biology.AAAIPress, Menlo Park, CA, pp.1999, 138-148.) predict its coding region and determine the direction of sequence.For determining that the Unigene in sequence direction provides the sequence in its direction from 5' to 3', for determining the sequence that the Unigene in sequence direction provides composite software and obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides the protein function annotation of Unigene, Pathway annotation, COG functional annotation and GeneOntology (GO) functional annotation.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG (evalue<0.00001), obtain the albumen with given Unigene with highest serial similarity, thus obtain the protein function annotation information of this Unigene.The Pathway annotation of Unigene can be obtained further according to KEGG annotation information.Compared by Unigene and COG database, the function that prediction Unigene is possible also does function statistic of classification to it.According to nr annotation information, use Blast2GO software (Conesa, Gotz et al.Blast2GO:a universal tool for annotation, visualization and analysis infunctional genomics research [J] .Bioinformatics, 2005,21 (18): 3674-3676.) the GO annotation information of Unigene is obtained.After obtaining the GO annotation of each Unigene, with WEGO software (Ye, Fang et al.WEGO:a web tool for plotting GO annotations [J] .Nucleic Acids Research, 2006,34:293-297.) GO functional classification statistics is done, from the gene function distribution characteristics being macroscopically familiar with these species to all Unigene.

Embodiment 6: " hundred make " is produced bacterium Cordyceps sinensis China pilose spore cytidine pathways metabolism and analyzed

Fig. 2 is the pyrimidine metabolic (map00240) in KEGG pathways metabolism annotation, the enzyme annotated is that " hundred make " detected produces bacterium Cordyceps sinensis China pilose spore pyrimidine metabolic pathway relevant enzymes, as can be seen from the figure, CTP synthetic enzyme 2 Unigene from uridine triphosphate synthesis cytidine are detected.By the ORF Finder software on-line checkingi in NCBI, have found the open reading frame (SEQ ID No.3 and SEQ IDNo.4) of this gene and obtain corresponding protein sequence (SEQ ID No.1 and SEQ ID No.2).

Embodiment 7: " hundred make " produces bacterium Cordyceps sinensis China pilose spore CTP synthase gene design of primers

Use GENE RUNNER primer-design software according to predicting the gene open proofreading dna primers obtained, the CTP synthase gene of bacterium China pilose spore anabolism cytidine is produced for clone's " hundred make ", primer by Shanghai Sheng Gong biotechnology company limited synthesize, primer sequence as follows listed by:

PynK1 gene: forward primer 5 ' ATAGAATTCATGCGCTGCGGTCGGAAACTG3 '

Reverse primer 5 ' ACGAAGCTTCTAAAAGCAAGAATTATCAGG 3 '

PynK1 mrna length is 741bp

PynK2 gene: forward primer 5 ' ACAGAATTCATGAATCCGAAGGAGCACGGG 3 '

Reverse primer 5 ' ACGAAGCTTTCAGTGTTGCTCGAGCAAGATGG 3 '

PynK2 mrna length is 627bp

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA first chain

After the method first provided according to embodiment 1 turns out sutella sinensis fermented mycelium, the method provided according to embodiment 2 again carries out the extraction of total serum IgE to China pilose spore, carry out by following the synthesis that " hundred make " produces bacterium Cordyceps sinensis China pilose spore cDNA first chain, for follow-up each gene clone experiment after obtaining total serum IgE.

Adopt PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription synthesis cDNA first chain from Total RNA, experimental procedure is as follows:

1) in Microtube pipe, following mixed solution is prepared.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, and can improve reverse transcription reaction efficiency, so carry out sex change, annealing reaction in PCR instrument, condition setting is as follows:

65℃，5min

3) annealing terminates the rear centrifugal several seconds mixed solution of template ribonucleic acid/primer etc. is gathered in bottom Microtube pipe.

4) in above-mentioned Microtube pipe, following inverse transcription reaction liquid is prepared.

5) in PCR instrument, reverse transcription reaction is carried out by following condition.

42℃ 15～30min

70℃ 15min

Generalized case, a PolyA structure is had at eukaryote mRNA 3 ' end, the quantity of A base is not at ten to hundreds of etc., utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, take mRNA as templated synthesis cDNA first chain, the present invention adopts the sequence in the dT region developed alone by TaKaRa (providing in PrimeScript 1st Strand cDNA Synthesis Kit) to be primer, if the mRNA integrity obtained is better, cDNA first chain of all zymoprotein encoding genes in species so can be obtained by process of reverse-transcription.

Embodiment 9: " hundred make " produces the detection of the clone of bacterium Cordyceps sinensis China pilose spore anabolism miazines nucleosides functional gene CTP synthetic enzyme pynK1 and pynK2 gene, expression and protein vigor

1, the pcr amplification of CTP synthetic enzyme pynK1 and pynK2 gene

With cDNA first chain obtained in embodiment 8 for template, pynK1 gene primer with synthesis in embodiment 7: 5 ' ATA GAA TTC ATG CGC TGC GGT CGG AAA CTG 3 ' and 5 ' ACG AAG CTT CTAAAA GCA AGA ATT ATC AGG 3 ' and pynK2 gene primer: 5 ' ACA GAA TTC ATG AATCCG AAG GAG CAC GGG 3 ' and 5 ' ACG AAGCTTTCAGTGTTGCTCGAGCAAGATGG3 ' carries out Pfu archaeal dna polymerase pcr amplification reaction respectively, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2, CTP synthetic enzyme pynK1 and pynK2 gene PCR product detected through gel electrophoresis

Concrete detection method is: 1) make it be uniformly dissolved the sepharose microwave-oven-heating of prepare 0.9%; 2) get 15mL gel, when gel is cooled to about 50 DEG C, add 1 μ L staining fluid Gold view, pour into after mixing on treatments of Electrophoretic Slab Gels, after removing bubble, insert point sample comb; 3), after gel sets, the careful point sample that takes out is combed, and offset plate is put into electrophoresis chamber (loading wells one end is near the negative pole of electrophoresis chamber), adds TAE electrophoretic buffer in electrophoresis chamber; 4) get 5 μ L samples and then add 6 × Loading Buffer 1.5 μ L and ddH ₂o 4 μ L uses liquid-transfering gun loading after mixing, and applied sample amount is 10 μ L; 5) connect the supply lead between electrophoresis chamber and electrophoresis apparatus, just very red, negative pole is black; 6) power-on, start electrophoresis, maximum voltage is no more than 5V/cm; 7) electrophoresis can be stopped when sample ran 2/3 of offset plate; 8), after cutting off the electricity supply, gel taken out and puts into the observation of gel imaging instrument, take pictures.

The size of transcript profile order-checking prediction CTP synthetic enzyme pynK1 and pynK2 gene is respectively 741bp and 627bp, and agarose gel electrophoresis result (Fig. 3) shows that Successful amplification has gone out CTP synthetic enzyme pynK1 and pynK2 gene.

3, CTP synthetic enzyme pynK1 and pynK2 gene PCR product add base A process and purifying

Because Pfu archaeal dna polymerase PCR primer end is flush end, connect so just can be used for carrier T also need to carry out adding base A process, purifying after glue reclaims after.It is as follows that glue recovery product adds base A system:

In PCR instrument, 72 DEG C add A base 20min, finally purify with AxyPrep PCR cleaning agents box.

4, the connection of CTP synthetic enzyme pynK1 and pynK2 gene and cloning vector

Cloning vector pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), its physical map is shown in Fig. 4, respectively CTP synthetic enzyme pynK1 is connected construction recombination plasmid pMD18-T/pynK1 and pMD18-T/pynK2 with pynK2 gene with cloning vector, physical map is shown in Fig. 5, linked system and condition of contact as follows.

Linked system:

Condition of contact: 16 DEG C, 16h; Deactivation: 65 DEG C, 15min.

5, the conversion of CTP synthetic enzyme recombinant plasmid pMD18-T/pynK1 and pMD18-T/pynK2

Recombinant plasmid pMD18-T/pynK1 and pMD18-T/pynK2 is proceeded to respectively the recombinant bacterium E.coli JM109/pMD18-T/pynK1 and the E.coli JM109/pMD18-T/pynK2 that build in E. coli JM109 and carry CTP synthetic enzyme pynK1 and pynK2 gene.Concrete steps are: 1) go in competent cell E.coli JM109 by 10 μ L reaction systems, ice bath 30min; 2) thermal shock: 42 DEG C, 90s; 3) ice bath: 2-3min; 4) 800 μ L liquid LB are added, 37 DEG C, 250rpm, 1h; 5) spread plate (containing Amp resistance); 6) 37 DEG C of incubator overnight incubation.

6, the screening of the positive recombinant bacterium of CTP synthetic enzyme E.coli JM109/pMD18-T/pynK1 and E.coli JM109/pMD18-T/pynK2

Bacterium colony PCR can extract genomic dna, and directly with the DNA exposed after thalline pyrolysis for template carries out pcr amplification, whether the method is easy and simple to handle, quick, can Rapid identification bacterium colony be positive bacterium colony containing object plasmid.In experiment, carrying out bacterium colony PCR by being inoculated into single bacterium colony corresponding in liquid nutrient medium, whether proceeding to goal gene to verify.First, add in the 1.5mL centrifuge tube containing 50 μ L sterilized waters with toothpick picking list bacterium colony, boiling water bath 30min, then centrifugal using supernatant as template, carry out pcr amplification, PCR program setting is Taq enzyme amplification general procedure.The agarose gel electrophoresis of 0.9% is finally adopted to detect bacterium colony PCR primer.

7, the order-checking of CTP synthetic enzyme recombinant plasmid pMD18-T/pynK1 and pMD18-T/pynK2

After the positive recombinant bacterium LB liquid medium overnight incubation that bacterium colony PCR is detected, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is completed by Sani bio tech ltd, Shanghai.Through sequence verification, sequence SEQ ID No.3 and SEQ ID No.4 has recombinated respectively in pMD18-T/pynK1 and pMD18-T/pynK2.

8, the structure of CTP synthetic enzyme recombinant expression plasmid pET-28a/pynK1 and pET-28a/pynK2

Experiment is according to the principle of foreign gene at expression in escherichia coli, and expression vector pET-28a and CTP synthetic enzyme pynK1 and pynK2 gene restriction enzyme site comparison situation, determine pynK1 gene EcoR I and Hind III double enzyme site, pynK2 gene EcoR I and Hind III double enzyme site, and the cultivation of liquid LB test tube shaker, recombinant plasmid extraction are carried out to restructuring E. coli JM109/pMD18-T/pynK1 and E.coli JM109/pMD18-T/pynK2.

Respectively CTP synthetic enzyme pynK1 and recombinant plasmid pMD18-T/pynK1 and pMD18-T/pynK2 of pynK2 gene and expression vector pET-28a EcoR I/Hind III restriction enzyme of correspondence are cut process 6h at 37 DEG C of enzymes, it is as follows that enzyme cuts system:

EcoR I/Hind III double digestion system:

Enzyme is cut and is terminated rear 65 DEG C of deactivation 15min, then respectively with Axygen DNA gel recovery test kit carry out reclaiming, purifying.

CTP synthetic enzyme pynK1 and pynK2 gene and expression vector pET-28a connect with T4 ligase enzyme 16 DEG C again and spend the night after double digestion, purifying, build recombinant expression plasmid pET-28a/pynK1 and pET-28a/pynK2, its building process is shown in Fig. 6, and Fig. 7 is shown in by the recombinant expression plasmid pET-28a/pynK1 that structure obtains and pET-28a/pynK2 collection of illustrative plates.Linked system is composed as follows:

Linked system:

9, the conversion of CTP synthetic enzyme recombinant expression plasmid pET-28a/pynK1 and pET-28a/pynK2 and the screening of positive monoclonal

By heat-shock transformed in E.coli BL21 Host Strains for the expression plasmid built, be then applied on the LB agar plate containing kantlex (Kan) resistance (50mg/L), 37 DEG C of overnight incubation.From flat board, random choose list bacterium colony, carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of CTP synthetic enzyme recombinant bacterium E.coli BL21/pET-28a/pynK1 and E.coli BL21/pET-28a/pynK2

The mono-clonal being accredited as the positive is inoculated in 5mL to be contained in the LB liquid nutrient medium of Kan resistance (50mg/L), 37 DEG C, 250r/min overnight incubation.Get 1mL culture, transferred in 50mL to contain in the LB liquid nutrient medium of Kan resistance (50mg/L) 37 DEG C, 250r/min is cultured to cell concentration OD600 and is about about 0.6 ~ 0.8.The IPTG inducing culture 8h of finite concentration (240mg/L) is added respectively in culture.Collect thalline for electrophoretic analysis and Enzyme activity assay.

11, CTP synthetic enzyme recombinant bacterium E.coli BL21/pET-28a/pynK1 and E.coli BL21/pET-28a/pynK2 expression product SDS-PAGE analyzes

With the E.coli BL21 bacterium proceeding to empty carrier and do not add inductor IPTG recombinant bacterium in contrast.Be accredited as positive recombinant bacterium after IPTG inducing culture certain hour (8h), get 0.5mL Induced cultures, collected by centrifugation thalline, be resuspended in 50 μ L distilled water, add 50 μ L sample-loading buffers, 10min is boiled after mixing, carry out SDS-PAGE electrophoretic analysis, " K1 " swimming lane in Fig. 8 is the SDS-PAGE figure of the CTP synthetase albumen pynK1 (through its aminoacid sequence of sequence verification for shown in SEQ ID No.1) that recombinant bacterium E.coli BL21/pET-28a/pynK1 expresses, " K2 " swimming lane is the SDS-PAGE figure of the CTP synthetase albumen pynK2 (through its aminoacid sequence of sequence verification for shown in SEQ ID No.2) that recombinant bacterium E.coli BL21/pET-28a/pynK2 expresses.

12, the protein-active of CTP synthetic enzyme recombinant bacterium E.coli BL21/pET-28a/pynK1 and E.coli BL21/pET-28a/pynK2 detects

(1) protein-active of CTP synthetic enzyme recombinant bacterium E.coli BL21/pET-28a/pynK1 detects

Prepared by enzyme liquid: recombinant bacterium E.coli BL21/pET-28a/pynK1 wet thallus 0.5g (dry weight 0.1g) phosphate buffered saline buffer (50mM, pH8.0) 15mL taking collection suspends, and ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) is as catalysis enzyme.

CTP synthetic enzyme pynK1 transformation system: transform in bottle at 50mL and add E.coli BL21/pET-28a/pynK1 ultrasonication thalline 10mL, 0.1g uridine triphosphate, 30 DEG C, 150r/min conversion reaction 2 ~ 3h, after conversion terminates, centrifuging and taking supernatant is standby with subsequent detection.

Detection method: high performance liquid chromatography detection by quantitative cytidine.Pre-treatment: after conversion fluid is centrifugal, supernatant liquor is crossed 0.22 μm of microporous membrane and is detected for high performance liquid chromatography.Condition: chromatographic column: Agilent C18 post (4.6mm × 250mm i.d.5 μm); Column temperature: 35 DEG C; Sampling volume: 20 μ L; Flow velocity 1mL/min; Determined wavelength 260nm; Moving phase: A: ultrapure water; B: methyl alcohol.Gradient elution: 0min, 15%B, keeps 3min; 3.0-3.5min, 15-24%B; 3.5min, 24% keeps 5min; 8.5-9.0min, 24-35%B; 35%B keeps 6min; 15.0-16.0min, 35-85%B; 85%B keeps 6min; 22.0-22.5min, 85%-15%B; 15%B keeps 5min.

The making of typical curve: accurately take cytidine, about 1.00mg-2.00mg, ultrapure water constant volume.6 gradients (1 μ g/mL, 30 μ g/mL, 60 μ g/mL, 90 μ g/mL, 120 μ g/mL, 150 μ g/mL) prepared by each standard substance.Then loading successively, each concentration repeats for 5 times.After the reference liquid getting certain volume maximum concentration mixes, constant volume, then HPLC analyzes the optimal conditions that cytidine detects.

Detect through above-mentioned chromatographic condition and calculate, we draw to draw a conclusion: the high specific enzyme (Specific Activity) alive of the CTP synthetic enzyme expressed by CTP synthetic enzyme recombinant bacterium E.coliBL21/pET-28a/pynK1 is 2.51mol/min/mg.Substrate conversion efficiency is 74%.

(2) protein-active of CTP synthetic enzyme recombinant bacterium E.coli BL21/pET-28a/pynK2 detects

Prepared by enzyme liquid: recombinant bacterium E.coli BL21/pET-28a/pynK2 wet thallus 0.5g (dry weight 0.1g) phosphate buffered saline buffer (50mM, pH8.0) 15mL taking collection suspends, and ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) is as catalysis enzyme.

CTP synthetic enzyme pynK2 transformation system: transform in bottle at 50mL and add E.coli BL21/pET-28a/pynK2 ultrasonication thalline 10mL, 0.1g uridine triphosphate, 30 DEG C, 150r/min conversion reaction 2 ~ 3h, after conversion terminates, centrifuging and taking supernatant is standby with subsequent detection.

The making of detection method and typical curve detects with the protein-active of CTP synthetic enzyme recombinant bacterium E.coli BL21/pET-28a/pynK1.

Detect through above-mentioned chromatographic condition and calculate, we draw to draw a conclusion: the high specific enzyme (Specific Activity) alive of the CTP synthetic enzyme expressed by CTP synthetic enzyme recombinant bacterium E.coliBL21/pET-28a/pynK2 is 1.79mol/min/mg.Substrate conversion efficiency is respectively 71%.

Claims (8)

1. a Cordyceps sinensis CTP synthetic enzyme, is characterized in that the aminoacid sequence of described enzyme is for shown in SEQ ID No.2.

2. Cordyceps sinensis CTP synthetic enzyme prepares the application in cytidine at biocatalysis uridine triphosphate as claimed in claim 1.

3. apply as claimed in claim 2, it is characterized in that described being applied as: with the broken mixed solution of wet thallus after cytoclasis obtained containing Cordyceps sinensis CTP synthetic enzyme thalline fermentation culture for catalyzer, take uridine triphosphate as substrate, be in the transformation system of buffered soln formation of 6.5 ~ 8.5 in pH, at 30 DEG C, conversion reaction 2 ~ 3h under 150rpm condition, after reaction terminates, by reacting liquid filtering, get filtrate and be crude product containing cytidine, described crude isolate purified acquisition cytidine.

4. apply as claimed in claim 3, it is characterized in that the starting point concentration of described substrate is 10g/L, the volumetric usage of described catalyzer is 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

5. the gene of enzyme described in claim 1 of encoding.

6. gene as claimed in claim 5, is characterized in that the nucleotides sequence of described gene is classified as shown in SEQ ID No.4.

7. as described in one of claim 5 ~ 6, gene is building and can prepare application in the genetic engineering bacterium of cytidine by biocatalysis uridine triphosphate.

8. apply as claimed in claim 7, it is characterized in that described being applied as: build the recombinant vectors containing described Cordyceps sinensis CTP synthase gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtained carries out inducing culture, and nutrient solution separation and purification obtains the somatic cells containing Cordyceps sinensis CTP synthetic enzyme.