CN103045548A - Cordyceps sinensis ribonucleotide reductase as well as coding gene and application thereof - Google Patents

Abstract

The invention relates to ribonucleotide reductase from 'Bailing' producing strain cordyceps sinensis hirsutella sinensis for anabolism of deoxidized pyrimidine nucleoside diphosphate from pyrimidine nucleoside diphosphate, a gene coding the ribonucleotide reductase and application of the ribonucleotide reductase. The ribonucleotide reductase has over 90% of homology to the amino acid sequence shown by SEQ ID No.1 or SEQ ID No.3; and the coding gene has over 90% of homology to the nucleotide sequence shown by SEQ ID No.2 or SEQ ID No.4. According to the invention, the metabolic pathway for synthesizing deoxidized pyrimidine nucleoside diphosphate from pyrimidine nucleoside diphosphate is studied in details in principle, the cloning DNA (Deoxyribonucleic Acid) comprising the nucleotide sequence provided by the invention can be transferred into engineering bacteria through transduction, transformation and combined transfer, high expressivity of the host deoxidized pyrimidine nucleoside diphosphate is obtained by adjusting the expression of the deoxidized pyrimidine nucleoside diphosphate biosynthesis gene, an effective means of increasing output of the deoxidized pyrimidine nucleoside diphosphate is provided, and a significant application prospect is realized.

Description

Cordyceps sinensis ribonucleotide reductase, encoding gene and application thereof

(1) technical field

The present invention relates to set out ribonucleotide reductase (the ribonucleotide reductase of anabolism deoxidation bisphosphate pyrimidine nucleoside of a kind of participation bisphosphate pyrimidine nucleoside of producing bacterium Cordyceps sinensis China pilose spore from " hundred make ", class II), encode gene and the application thereof of this enzyme.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in stroma and the complex body on the larva corpse (comprising stroma and polypide) on lepidopteran (Lepidoptera) Hepialidae insect (the Hepialus armoricanus Oberthur) larva.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has the various characteristics of meta-bolites and biological activity, shows huge application and development prospect at biomedicine field.Cordyceps sinensis with its multiple medicinal efficacy extensively, obviously receive much concern worldwide enjoys high praise.The traditional Chinese medical science thinks that Cordyceps sinensis enters lung kidney two warps, and is can tonifying lung cloudy, again can kidney-replenishing, and cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough phlegm blood, spontaneous sweatings etc. are unique a kind of simultaneously balances, regulate the Chinese medicine of negative and positive.Modern pharmacology confirms that Cordyceps sinensis has the widely biological activity such as immunomodulatory, antibiotic, antitumor, anti-oxidant, anti-ageing, hypoglycemic blood fat, gonadotropic Effect.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (anamorph) and thecaspore stage (teleomorph) in its life history.And what use in the actual productions such as artificial culture, liquid fermenting is the Cordyceps fungus in imperfect stage, thereby the evaluation of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is being done a lot of work aspect Cordyceps Resources investigation, anamorph conclusive evidence, activeconstituents compartment analysis and the mechanism of action, the Application and Development.The Cordyceps sinensis China pilose spore has been proved to be the anamorph existence form of Cordyceps sinensis, has the activeconstituents identical with natural cordyceps and drug effect.

Natural cs has strict parasitics and special ecotope, so its output is very low, price is high.Wild cordyceps restricts scarcity of resources owing to factors such as being subjected to growing environment.Owing to made little progress at artificial culture in recent years, the research of wild cordyceps surrogate focuses mostly on liquid fermenting.Utilizing liquid submerged fermentation to cultivate Cordyceps mycelium, extract or fermented liquid, is a kind of effective way that solves Cordyceps sinensis medicine source.Chinese caterpillar fungus fermentation is produced the Chinese caterpillar fungus substitute, both can effectively protect these precious resources of Chinese caterpillar fungus, and not climate, geographical environment and the strict restriction of Chinese caterpillar fungus parasitic conditions is suitable for large-scale industrialization production again.Its composition of the substitute of producing such as mycelium is also similar to natural cs with drug effect, thereby is devoted to the fermentation culture of Cordyceps mycelium both at home and abroad always.The mycelia that the aweto cultured by artificial fermentation China pilose spore obtains, through toxicity, pharmacology, plant research, proof is basically identical with natural cs chemical constitution, pharmacological action, can replace natural cs to produce cordyceps product, to remedy the shortage of natural resources, by the optimization to fermentation condition, the amount of mycelial biomass and meta-bolites all is significantly improved.

In recent years, along with the develop rapidly of natural product chemistry and modern chromatographic technique, to progressively turning to deeper functional meta-bolites research by the direct utilization of Chinese caterpillar fungus raw material or crude extract in the worm grass product research and development.The Chinese caterpillar fungus meta-bolites has been done a large amount of research both at home and abroad, meta-bolites mainly comprises several large compounds such as nucleosides, polysaccharide, polypeptide, sterol, and wherein the representative researchs of functional meta-bolites at aspects such as biosynthesizing, pharmacological actions such as purines nucleosides, Cordyceps polysaccharide, N.F,USP MANNITOL win initial success.

Ucleosides is one of topmost active substance of Chinese caterpillar fungus, and wherein the miazines nucleosides comprises cytidine(C and uridine.Uridine (uracil riboside) claim again uridine (uIidine), and another name is by snow riboside, dihydro-pyrimidin nucleosides, the 1-β-D-ribosyl uridylic of muttering.Cytidine(C (cytosine riboside) has another name called cytidine (cytidine), cytidine, 1-β-D-furans nucleosides cytosine(Cyt).Pyrimidine nucleoside is multiduty nucleosides, can be used as the additive of healthcare products and food.It also becomes the requisite of people's life gradually as beauty treatment and anti-ultraviolet radiation makeup, as medicine, clinical application is in nervus centralis, uropoiesis, metabolism and many-sided disease such as cardiovascular, in the U.S., the nucleic acid medicine has shown irreplaceable effect at antiviral, anti-tumor aspect in recent years.

Because the important physiological action of pyrimidine nucleoside and analogue thereof, related microorganism is produced the existing a lot of researchs of miazines nucleosides both at home and abroad.Yet as the Cordyceps fungus of important anabolism miazines nucleosides, also only rest in the research of meta-bolites composition analysis and effect, also rarely found to the research of genes involved and albumen in the Cordyceps fungus miazines nucleosides metabolic pathway of synthesizing.

(3) summary of the invention

The object of the invention is for the deficiency of above existence and the technical issues that need to address, " hundred make " produced enzyme and the encoding gene thereof of bacterium Cordyceps sinensis China pilose spore anabolism bisphosphate pyrimidine nucleoside and further investigate, the enzyme, encoding gene and the application thereof that provide " hundred make " production bacterium Cordyceps sinensis China pilose spore participation bisphosphate pyrimidine nucleoside to set out anabolism deoxidation bisphosphate pyrimidine nucleoside.

The technical solution used in the present invention is:

The present invention relates to a kind ofly produce bacterium Cordyceps sinensis China pilose spore from " hundred make " and participate in the set out ribonucleotide reductase of anabolism deoxidation bisphosphate pyrimidine nucleoside of bisphosphate pyrimidine nucleoside, described enzyme has aminoacid sequence 90% above homology shown in SEQ ID No.1 or the SEQ ID No.3, and preferably its sequence is that pynN2 albumen or the sequence of SEQ ID No.1 are the pynN3 albumen of SEQ ID No.3; But this enzyme catalysis bisphosphate pyrimidine nucleoside prepares deoxidation bisphosphate pyrimidine nucleoside.Because the singularity of aminoacid sequence; any fragment or its variant that contains the peptide protein of aminoacid sequence shown in SEQ ID No.1 or the SEQ ID No.3; such as its examples of conservative variations, bioactive fragment or derivative; as long as the fragment of this peptide protein or peptide protein variant and aforementioned amino acid sequence homology all belong to the row of protection domain of the present invention more than 90%.Concrete described change can comprise amino acid whose disappearance, insertion or replacement in the aminoacid sequence; Wherein, for the conservative property change of variant, the amino acid of replacing has the structure similar to original acid or chemical property, and as replacing Isoleucine with leucine, variant also can have non-conservation and change, as replacing glycine with tryptophane.

The path that is obtained deoxidation bisphosphate pyrimidine nucleoside by bisphosphate pyrimidine nucleoside anabolism is as follows:

The invention still further relates to described Cordyceps sinensis ribonucleotide reductase and prepare application in the deoxidation bisphosphate pyrimidine nucleoside at biocatalysis bisphosphate pyrimidine nucleoside.

Further, described being applied as: to contain the broken mixed solution of wet thallus after cytoclasis that Cordyceps sinensis ribonucleotide reductase thalline fermentation culture obtains as catalyzer, take the bisphosphate pyrimidine nucleoside as substrate, be in the transformation system that consists of of 6.5 ~ 8.5 buffered soln in pH, conversion reaction 2 ~ 3h under 30 ℃, 150rpm condition, after reaction finishes, with reacting liquid filtering, get the crude product that filtrate being contains deoxidation bisphosphate pyrimidine nucleoside, described crude product separation and purification obtains deoxidation bisphosphate pyrimidine nucleoside.

The starting point concentration of described substrate is 10g/L, and the volumetric usage of described catalyzer is the 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

The preparation method of described catalyzer is: Cordyceps sinensis ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN2 or E. coli BL21/pET-28a/pynN3 are inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (50mg/L) 37 ℃, 250r/min overnight incubation.Get the 1mL culture, its transfer in the fresh LB liquid nutrient medium that contains the Kan resistance of 50mL 37 ℃, 250r/min are cultured to cell concentration OD600 and are about about 0.6～0.8, the IPTG inducing culture 8h that adds finite concentration (240mg/ml) in the culture, getting inducing culture liquid filters, collect wet thallus, the wet thallus 0.5g that takes by weighing collection suspends with phosphate buffered saline buffer (50mM, pH8.0) 15mL, and the thalline mixed solution that obtains after the ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) is as the catalysis enzyme.

The invention still further relates to the encoding gene of above-mentioned Cordyceps sinensis ribonucleotide reductase, it is the ribonucleotide reductase gene, described gene has nucleotide sequence 90% above homology shown in SEQ ID No.2 or the SEQ ID No.4, and preferred sequence is that pynN2 gene or the sequence of SEQ ID No.2 is the pynN3 gene shown in the SEQ ID No.4.Because the singularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO:2 or the SEQ ID NO:4 as long as itself and this polynucleotide have 90% above homology, all belongs to the row of protection domain of the present invention.The variant of described polynucleotide refers to a kind of polynucleotide sequence that one or more Nucleotide change that has.The variant of these polynucleotide can make living displacement varient or the varient of non-life, comprises replacing varient, deletion mutation body and inserting varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of polynucleotide, but can be from the function of the peptide protein that changes in fact its coding.

Described gene can be used for making up the genetic engineering bacterium that can biocatalysis bisphosphate pyrimidine nucleoside prepares deoxidation bisphosphate pyrimidine nucleoside, to enlarge the output of deoxidation bisphosphate pyrimidine nucleoside or derivatives thereof, be specially: make up the recombinant vectors that contains described Cordyceps sinensis ribonucleotide reductase gene, described recombinant vectors is converted in the intestinal bacteria, the recombination engineering bacteria that obtains carries out inducing culture, and the nutrient solution separation and purification obtains to contain the somatic cells of Cordyceps sinensis ribonucleotide reductase.

Main points of the present invention have been to provide the nucleotide sequence shown in the aminoacid sequence shown in SEQ ID NO:1 or the SEQ ID NO:3 and SEQ ID NO:2 or the SEQ ID NO:4, in the situation of known this aminoacid sequence and nucleotide sequence, the acquisition of this aminoacid sequence and nucleotide sequence, and the acquisition of related vector, host cell, all be apparent to those skilled in the art.

The bacterial strain that Cordyceps sinensis ribonucleotide reductase of the present invention and encoding gene thereof can be provided is China pilose spore (Hirsutella Sinensis) L0106, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly discloses among the patent CN102373190A of application.

Beneficial effect of the present invention is mainly reflected in: the present invention studies in great detail the synthetic deoxidation bisphosphate pyrimidine nucleoside pathways metabolism of bisphosphate pyrimidine nucleoside on principle, the cloned DNA that comprises nucleotide sequence provided by the present invention can be used for by transduction, transform, change in the engineering bacteria in conjunction with the method that shifts, by regulating the expression of deoxidation bisphosphate pyrimidine nucleoside biosynthesis gene, give the high expression level of host's deoxidation bisphosphate pyrimidine nucleoside, for the output that enlarges deoxidation bisphosphate pyrimidine nucleoside or derivatives thereof provides effective way, has the major application prospect.

(4) description of drawings

Fig. 1 is the denaturing formaldehyde gel electrophoresis figure that " hundred make " produces the total RNA of bacterium Cordyceps sinensis China pilose spore;

Fig. 2 is purine metabolism approach annotated map;

Fig. 3 is ribonucleotide reductase gene PCR amplified production gel electrophoresis figure;

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map;

Fig. 5 is restructuring cloned plasmids pMD18-T/pynN2 and recombinant clone plasmid pMD18-T/pynN3 physical map;

Fig. 6 is recombinant expression plasmid pET-28a/pynN2 and recombinant expression plasmid pET-28a/pynN3 building process synoptic diagram;

Fig. 7 is recombinant expression plasmid pET-28a/pynN2 and recombinant expression plasmid pET-28a/pynN3 physical map;

Fig. 8 is ribonucleotide reductase protein SDS-PAGE figure.

(5) embodiment

The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis China pilose spore

Bacterium source: at first gather natural cordyceps from Qinghai, and it is taken back Hangzhou carry out separation screening, obtained the L0106 bacterial strain, and be China pilose spore (Hirsutella Sinensis) through this bacterial strain of strain identification, this culture presevation is at Chinese Typical Representative culture collection center, deposit number is CCTCC No:M 2011278, formerly discloses among the patent CN102373190A of application.

With this bacterial classification inoculation in the inclined-plane, (this is the liquid formulations before solidifying to culture medium prescription, prepare afterwards again bevel in following ratio) be glucose 2.0%(w/v, contain 1g in the 1% expression 100mL substratum, down together), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, sal epsom 0.05%, potassium primary phosphate 0.05%, agar powder 1.0%, surplus is water, cultivates 25 days at 12 ~ 16 ℃; Then with bacterial classification inoculation in fermention medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract paste 0.5%, sal epsom 0.01%, potassium primary phosphate 0.02%, surplus is water, place on the shaking table, 12 ~ 16 ℃ of cultivations of temperature 25 days under aseptic condition, are carried out solid-liquid separation after cultivation finishes, and solid placed aseptic utensil, for subsequent use.

Embodiment 2: " hundred make " produces the extraction of the total RNA of bacterium Cordyceps sinensis China pilose spore

Extract total RNA with TRIzol reagent, step is specially: 1) liquid nitrogen grinding: get the new fresh thalli of 1g and put into mortar, repeatedly adding liquid nitrogen fully is ground to Powdered, divide and install in the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mixing leaves standstill 5min on ice, and the nucleic acid-protein mixture is separated fully.2) RNA separates: add the 0.2mL chloroform, firmly shake mixing 15s, leave standstill 2 ~ 3min on ice, and 4 ℃, the centrifugal 15min of 12000rpm, the upper strata water is got in layering, about 600 μ L.3) RNA precipitation: add 500 μ L Virahols, leave standstill 10min on ice, 4 ℃, the centrifugal 10min of 12000rpm abandon supernatant.4) RNA washing: add 1mL 75%(v/v) ethanol will precipitate and hang, and leave standstill 10min on ice, 4 ℃, the centrifugal 15min of 7500rpm; Washing step above repeating is washed one time again.5) dissolving RNA: centrifuge tube is placed unlimited dry 5 ~ 10min on ice, add an amount of DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis China pilose spore RNA sample

After extracting the total RNA of sample, use with Oligo(dT) enrichment with magnetic bead mRNA.Add fragmentation buffer mRNA is broken into short-movie section (200 ~ 700bp), take mRNA as template, with the synthetic article one cDNA chain of hexabasic basic random primer (random hexamers), then synthesize second cDNA chain, pass through again QiaQuick PCR test kit purifying and add the EB buffer solution elution and do terminal reparation afterwards, add polyA and connect sequence measuring joints, then carrying out clip size with agarose gel electrophoresis selects, carry out at last pcr amplification, the sequencing library of building up checks order with Illumina GA IIx.The raw image data that order-checking obtains is converted into sequence data through base calling, i.e. raw data or raw reads.Remove the reads that only contains the adaptor sequence among the primitive sequencer reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces the short sequence assembling of reading of bacterium Cordyceps sinensis China pilose spore RNA

Use short reads composite software SOAPdenovo(Li, Zhu et al. De novo assembly of human genomes with massively parallel short read sequencing [J]. Genome Res, 2010,20:265-272.) do and transcribe group and from the beginning assemble.The reads that SOAPdenovo at first will have certain-length overlap is linked to be the longer Contig fragment that does not contain N.Then reads is compared back Contig, determine from the different Contig of same transcript and the distance between these Contig by paired-end reads, SOAPdenovo connects together these Contig, and middle unknown nucleotide sequence represents with N, so just obtains Scaffold.Further utilize paired-end reads that Scaffold is done filling-up hole and process, it is minimum to obtain at last containing N, the Unigene sequence that two ends can not prolong again.At last, Unigene sequence and albumen database nr, Swiss-Prot, KEGG and COG are blastx compare (evalue＜0.00001), get the sequence direction that the best albumen of comparison result is determined Unigene.If the comparison result between the different sink is contradictory, then press nr, Swiss-Prot, the priority of KEGG and COG is determined the sequence direction of Unigene, with above four storehouses all to less than Unigene software ESTScan(Iseli, Jongeneel et al. ESTScan:a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences[J]. In Proceedings of 9th InternationalConference on Intelligent Systems for Molecular Biology. AAAIPress, Menlo Park, CA, pp. 1999,138-148.) predict its coding region and determine the direction of sequence.Provide its sequence from 5' to the 3' direction for the Unigene that can determine the sequence direction, provide the sequence that composite software obtains for the Unigene that can't determine the sequence direction.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis China pilose spore Unigene functional annotation

Functional annotation information provides protein function note, Pathway note, COG functional annotation and the Gene Ontology(GO of Unigene) functional annotation.At first, by blastx with the Unigene sequence alignment to albumen database nr, Swiss-Prot, KEGG and COG(evalue＜0.00001), obtain having the albumen of highest serial similarity with given Unigene, thereby obtain the protein function annotation information of this Unigene.Can further obtain the Pathway note of Unigene according to the KEGG annotation information.Unigene and COG database are compared, and the possible function of prediction Unigene is also done the function statistic of classification to it.According to the nr annotation information, use Blast2GO software (Conesa, Gotz et al. Blast2GO:a universal tool for annotation, visualization and analysis in functional genomics research[J]. Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.After obtaining the GO note of each Unigene, with WEGO software (Ye, Fang et al. WEGO:a web tool for plotting GO annotations[J]. Nucleic Acids Research, 2006,34:293-297.) all Unigene are done GO functional classification statistics, from the gene function distribution characteristics of these species of macroscopic view understanding.

Embodiment 6: " hundred make " produced bacterium Cordyceps sinensis China pilose spore bisphosphate pyrimidine nucleoside pathways metabolism and analyzed

Fig. 2 is the pyrimidine metabolic (map00240) in the KEGG pathways metabolism note, the enzyme of note is that " hundred make " that has detected produced bacterium Cordyceps sinensis China pilose spore pyrimidine metabolic approach relevant enzymes, as can be seen from the figure, detected from 2 Unigene of ribonucleotide reductase of the synthetic deoxidation bisphosphate pyrimidine nucleoside of bisphosphate pyrimidine nucleoside.Detect online by the ORF Finder software among the NCBI, found out the open reading frame (SEQ ID No.2 or SEQ ID No.4) of this gene and obtained corresponding protein sequence (SEQ ID No.1 or SEQ ID No.3).

Embodiment 7: " hundred make " produces the design of bacterium Cordyceps sinensis China pilose spore ribonucleotide reductase gene primer

The gene open reading frame dna sequence dna design primer that uses GENE RUNNER primer-design software to obtain according to prediction, be used for the ribonucleotide reductase gene that clone's " hundred make " produces bacterium China pilose spore anabolism bisphosphate pyrimidine nucleoside, primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized, and primer sequence is following listed:

PynN2 gene: forward primer 5 ' AGAGAATTCATGAAGGACCCAACCATGGGC3 '

Reverse primer 5 ' ATTAAGCTTTCACAGCACCTTGGGGCTGTCG 3 '

The pynN2 mrna length is 417bp

PynN3 gene: forward primer 5 ' ATAGAATTCATGGGCGGGACGCATCCCCAC 3 '

Reverse primer 5 ' ACGGTCGACCTATATATATTTCGTAAGCAAAGC 3 '

The pynN3 mrna length is 369bp

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis China pilose spore cDNA the first chain

After the method that provides according to embodiment 1 is first turned out sutella sinensis fermented mycelium, the method that provides according to embodiment 2 is again carried out the extraction of total RNA to China pilose spore, obtain being undertaken synthesizing of " hundred make " production bacterium Cordyceps sinensis China pilose spore cDNA the first chain by following behind total RNA, be used for follow-up each gene clone experiment.

Adopt synthetic cDNA the first chain of PrimeScript 1st Strand cDNA Synthesis Kit test kit (TaKaRa) reverse transcription from Total RNA, experimental procedure is as follows:

1) the following mixed solution of preparation in the Microtube pipe.

2) sex change, annealing operation are conducive to the sex change of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, can improve reverse transcription reaction efficient, so carry out sex change, annealing reaction at the PCR instrument, condition setting is as follows:

65℃，5 min

3) the centrifugal several seconds made the mixed solution of template ribonucleic acid/primer etc. be gathered in Microtube pipe bottom after annealing finished.

4) the following inverse transcription reaction liquid of preparation in above-mentioned Microtube pipe.

5) on the PCR instrument, carry out reverse transcription reaction by following condition.

42℃ 15～30 min

70℃ 15 min

Generalized case, at eukaryote mRNA 3 ' end a PolyA structure is arranged, the quantity of A base does not wait to hundreds of is individual ten, utilize this structure can utilize Oligo (dT) primer, under the effect of ThermoScript II, synthetic cDNA the first chain take mRNA as template, the present invention adopts the sequence (providing among the PrimeScript 1st Strand cDNA Synthesis Kit) in the dT zone of being developed alone by TaKaRa to be primer, if the mRNA integrity that obtains is better, can obtain so cDNA first chain of all zymoprotein encoding genes in the species by the reverse transcription process.

Embodiment 9: " hundred make " produces the detection of bacterium Cordyceps sinensis China pilose spore anabolism miazines nucleosides functional gene ribonucleotide reductase pynN2 and pynN3 gene cloning, expression and protein vigor

1, the pcr amplification of ribonucleotide reductase pynN2 and pynN3 gene

CDNA the first chain that obtains in the embodiment 8 is as template, with pynN2 gene primer synthetic among the embodiment 7: 5 ' AGA GAA TTC ATG AAG GAC CCA ACC ATG GGC 3 ' and 5 ' ATT AAG CTT TCA CAG CAC CTT GGG GCT GTC G 3 ' and pynN3 gene primer: 5 ' ATA GAA TTC ATG GGC GGG ACG CAT CCC CAC 3 ' and 5 ' ACGGTCGACCTATATATATTTCGTAAGCAAAGC 3 ' carry out respectively Pfu archaeal dna polymerase pcr amplification reaction, and reaction conditions arranges as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase pcr amplification condition:

2, ribonucleotide reductase pynN2 and pynN3 gene PCR product gel electrophoresis detection

Concrete detection method is: 0.9% the sepharose that 1) will prepare makes its dissolving evenly with microwave-oven-heating; 2) get the 15mL gel, when treating that gel is cooled to 50 ℃ of left and right sides, add 1 μ L staining fluid Gold view, pour on the treatments of Electrophoretic Slab Gels after mixing, remove and insert the point sample comb behind the bubble; 3) after gel solidifies, carefully take out the point sample comb, offset plate is put into electrophoresis chamber (point sample hole one end is near the negative pole of electrophoresis chamber), in electrophoresis chamber, add the TAE electrophoretic buffer; 4) get 5 μ L samples and then add 6 * Loading Buffer, 1.5 μ L and ddH ₂Using liquid-transfering gun loading, applied sample amount after O 4 μ L mix is 10 μ L; 5) supply lead between connection electrophoresis chamber and the electrophoresis apparatus, just very red, negative pole is black; 6) power-on, the beginning electrophoresis, maximum voltage is no more than 5 V/cm; 7) when sample ran offset plate 2/3 the time can stop electrophoresis; 8) cut off the electricity supply after, gel taken out puts into the gel imaging instrument and observe, take pictures.

The size of transcribing group order-checking prediction ribonucleotide reductase pynN2 and ribonucleotide reductase pynN3 gene is respectively 417bp and 369bp, and the agarose gel electrophoresis result shows and successfully amplified ribonucleotide reductase pynN2 and ribonucleotide reductase pynN3 gene.The results are shown in shown in Figure 3.

3, the base A that adds of ribonucleotide reductase pynN2 and pynN3 gene PCR product processes and purifying

Because Pfu archaeal dna polymerase PCR product end is flush end, so just can be used for the connection of T carrier after after glue reclaims, also need adding base A processing, purifying.It is as follows that glue recovery product adds base A system:

72 ℃ add A base 20 min in the PCR instrument, use at last AxyPrep PCR cleaning agents box purifying.

4, ribonucleotide reductase pynN2 and pynN3 gene and cloning vector is connected

Cloning vector pMD18-T Vector is available from TaKaRa company (TaKaRa code D101A), its physical map is seen Fig. 4, respectively ribonucleotide reductase pynN2 is connected construction recombination plasmid pMD18-T/pynN2 and pMD18-T/pynN3 with the pynN3 gene with cloning vector, physical map is seen Fig. 5, and linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 ℃, 16h; Deactivation: 65 ℃, 15min.

5, the conversion of ribonucleotide reductase recombinant plasmid pMD18-T/pynN2 and pMD18-T/pynN3

Recombinant plasmid pMD18-T/pynN2 and pMD18-T/pynN3 changed over to respectively make up recombinant bacterium E. coli JM109/pMD18-T/pynN2 and the E. coli JM109/pMD18-T/pynN3 that carries ribonucleotide reductase pynN2 and pynN3 gene among the intestinal bacteria E. coli JM109.Concrete steps are: 1) 10 μ L reaction systems are gone among the competent cell E. coli JM109 ice bath 30min; 2) thermal shock: 42 ℃, 90s; 3) ice bath: 2-3min; 4) add 800 μ L liquid LB, 37 ℃, 250rpm, 1h; 5) spread plate (containing the Amp resistance); 6) 37 ℃ of incubator overnight incubation.

6, the positive restructuring of ribonucleotide reductase E. coli JM109/pMD18-T/pynN2 and E. coli JM109/pMD18-T/pynN3 screening

Bacterium colony PCR can extract genomic dna, and the DNA that directly exposes after the thalline pyrolysis carries out pcr amplification as template, the method is easy and simple to handle, quick, can the Rapid identification bacterium colony whether be the positive bacterium colony that contains the purpose plasmid, transform in identifying comparatively common.In the experiment, carry out bacterium colony PCR with being inoculated into single bacterium colony corresponding in the liquid nutrient medium, whether change goal gene over to checking.At first, add with toothpick picking list bacterium colony and to contain in the 1.5mL centrifuge tube of 50 μ L sterilized waters, boiling water bath 30min, then centrifugal with supernatant liquor as template, carry out pcr amplification, the PCR program setting is Taq enzymatic amplification general procedure.Adopt at last 0.9% agarose gel electrophoresis detection bacterium colony PCR product.

7, the order-checking of ribonucleotide reductase recombinant plasmid pMD18-T/pynN2 and pMD18-T/pynN3

After the detected positive recombinant bacterium liquid LB culture medium culturing of bacterium colony PCR spent the night, get 4mL bacterium liquid and extract plasmid, the operation instructions that method provides by AxyPrep plasmid DNA small volume of reagent box.Order-checking is finished by Shanghai Sani's bio tech ltd.Through sequence verification, sequence SEQ ID No.2 and SEQ ID No.4 recombinate respectively to pMD18-T/pynN2 and pMD18-T/pynN3.

8, the structure of ribonucleotide reductase recombinant expression plasmid pET-28a/pynN2 and pET-28a/pynN3

The experimental basis foreign gene is in the principle of expression in escherichia coli, and expression vector pET-28a and ribonucleotide reductase pynN2 and pynN3 gene restriction enzyme site comparison situation, determined pynN2 gene EcoR I and Hind III double enzyme site, pynN3 gene EcoR I and Sal I double enzyme site, and recombination bacillus coli E. coli JM109/pMD18-T/pynN2 and E. coli JM109/pMD18-T/pynN3 have been carried out the cultivation of liquid LB test tube shaker, recombinant plasmid extraction.

Respectively the recombinant plasmid pMD18-T/pynN2 of ribonucleotide reductase pynN2 and pynN3 gene and the expression vector pET-28a of pMD18-T/pynN3 and correspondence are cut processing 6h with EcoR I/Hind III, EcoR I/Sal I restriction enzyme at 37 ℃ of enzymes, it is as follows that enzyme is cut system:

EcoR I/Hind III double digestion system:

Enzyme is cut and is finished rear 65 ℃ of deactivation 15min, then respectively with Axygen dna gel recovery test kit reclaim, purifying.

Ribonucleotide reductase pynN2 spends the night with 16 ℃ of connections of T4 ligase enzyme behind double digestion, purifying with pynN3 gene and expression vector pET-28a again, make up recombinant expression plasmid pET-28a/pynN2 and pET-28a/pynN3, its building process is seen Fig. 6, makes up the recombinant expression plasmid pET-28a/pynN2 and the pET-28a/pynN3 collection of illustrative plates that obtain and sees Fig. 7.Linked system is composed as follows:

Linked system:

9, the screening of the conversion of ribonucleotide reductase recombinant expression plasmid pET-28a/pynN2 and pET-28a/pynN3 and positive monoclonal

The expression plasmid heat shock that builds is converted in the E. coli BL21 Host Strains, then is applied on the LB agar plate that contains kantlex (Kan) resistance (50mg/L) 37 ℃ of overnight incubation.Random choose list bacterium colony from the flat board carries out pcr amplification with the primer of each functional gene, selects positive colony.

10, the abduction delivering of ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN2 and E. coli BL21/pET-28a/pynN3

Be inoculated in the LB liquid nutrient medium that 5mL contains Kan resistance (50mg/L) 37 ℃, 250r/min overnight incubation with being accredited as positive mono-clonal.Get the 1mL culture, it is transferred contain in the LB liquid nutrient medium of Kan resistance (50mg/L) 37 ℃, 250r/min in 50mL and be cultured to cell concentration OD600 and be about about 0.6～0.8.The IPTG inducing culture 8h that adds respectively finite concentration (240mg/L) in the culture.Collecting thalline surveys for electrophoresis analysis and enzyme biopsy.

11, ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN2 and E. coli BL21/pET-28a/pynN3 expression product SDS-PAGE analyze

With the E. coli BL21 bacterium that changes empty carrier over to and the recombinant bacterium that do not add inductor IPTG in contrast.Be accredited as positive recombinant bacterium behind IPTG inducing culture certain hour (8h), get 0.5mL inducing culture thing, centrifugal collection thalline, be resuspended in the 50 μ L distilled water, add 50 μ L sample-loading buffers, boil 10min behind the mixing, carry out the SDS-PAGE electrophoretic analysis, " N2 " swimming lane among Fig. 8 be ribonucleotide reductase albumen pynN2(that recombinant bacterium E. coli BL21/pET-28a/pynN2 expresses through its aminoacid sequence of sequence verification shown in SEQ ID No.1) SDS-PAGE figure, " N3 " swimming lane be ribonucleotide reductase albumen pynN3(that recombinant bacterium E. coli BL21/pET-28a/pynN3 expresses through its aminoacid sequence of sequence verification shown in SEQ ID No.3) SDS-PAGE figure.

12, the protein-active of ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN2 and E. coli BL21/pET-28a/pynN3 detects

(1) ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN2 protein-active detects

Enzyme liquid preparation: the recombinant bacterium E. coli BL21/pET-28a/pynN2 wet thallus 0.5g(dry weight 0.1g that takes by weighing collection), suspend with phosphate buffered saline buffer (50mM, pH8.0) 15mL, be used as the catalysis enzyme after the ultrasonication (power 350W, broken 2s, interval 2s, common ultrasonication 5min).

Ribonucleotide reductase pynN2 transformation system: transform adding E. coli BL21/pET-28a/pynN2 ultrasonication thalline 10mL, 0.1g cytidine diphosphate (CDP) or 0.1g uridine diphosphate (UDP) in the bottle at 50mL, 30 ℃, 150r/min conversion reaction 2 ~ 3h, after transforming end, the centrifuging and taking supernatant is standby with subsequent detection.

Detection method: high performance liquid chromatography detection by quantitative deoxidation bisphosphate pyrimidine nucleoside.Pre-treatment: after conversion fluid was centrifugal, supernatant liquor was crossed 0.22 μ m microporous membrane and is used for the high performance liquid chromatography detection.Condition: chromatographic column: Agilent C18 post (4.6mm * 250mm i.d.5 μ m); Column temperature: 35 ℃; Sampling volume: 20 μ L; Flow velocity 1mL/min; Detect wavelength 260nm; Moving phase: A: ultrapure water; B: methyl alcohol.Gradient elution: 0min, 15%B keeps 3min; 3.0-3.5min, 15-24%B; 3.5min 24% keeps 5min; 8.5-9.0min, 24-35%B; 35%B keeps 6min; 15.0-16.0min, 35-85%B; 85%B keeps 6min; 22.0-22.5min, 85%-15%B; 15%B keeps 5min.

The making of typical curve: accurately take by weighing deoxidation bisphosphate pyrimidine nucleoside standard substance, about 1.00mg-2.00mg, ultrapure water constant volume.Each standard substance preparation 6 gradient (1 μ g/mL, 30 μ g/mL, 60 μ g/mL, 90 μ g/mL, 120 μ g/mL, 150 μ g/mL).Then loading successively, each concentration repeats for 5 times.After the reference liquid of getting the certain volume maximum concentration mixes, constant volume, then HPLC analyzes the optimal conditions that deoxidation bisphosphate pyrimidine nucleoside detects.

Detect and calculate through above-mentioned chromatographic condition, we draw to draw a conclusion: the high specific enzyme of the ribonucleotide reductase that ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN2 is expressed (Specific Activity) alive is alive more maximum than enzyme in 6.3mol/min/mg(cytidine diphosphate (CDP) and the uridine diphosphate (UDP)), substrate conversion efficiency is 75% and 83%.

(2) ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN3 protein-active detects

Enzyme liquid preparation: the recombinant bacterium E. coli BL21/pET-28a/pynN3 wet thallus 0.5g(dry weight 0.1g that takes by weighing collection) suspend with phosphate buffered saline buffer (50mM, pH8.0) 15mL, after the ultrasonication (power 350W, broken 2s, interval 2s, altogether ultrasonication 5min) as the catalysis enzyme.

Ribonucleotide reductase pynN3 transformation system: transform adding E. coli BL21/pET-28a/pynN3 ultrasonication thalline 10mL, 0.1g cytidine diphosphate (CDP) or 0.1g uridine diphosphate (UDP) in the bottle at 50mL, 30 ℃, 150r/min conversion reaction 2 ~ 3h, after transforming end, the centrifuging and taking supernatant is standby with subsequent detection.

The making of detection method and typical curve detects with ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN2 protein-active.

Detect and calculate through above-mentioned chromatographic condition, we draw to draw a conclusion: the high specific enzyme of the ribonucleotide reductase that ribonucleotide reductase recombinant bacterium E. coli BL21/pET-28a/pynN3 is expressed (Specific Activity) alive is alive more maximum than enzyme in 6.3mol/min/mg(cytidine diphosphate (CDP) and the uridine diphosphate (UDP)), substrate conversion efficiency is 78% and 79%.

SEQUENCE LISTING

＜110〉Zhejiang Polytechnical University, Zhongmei Huadong Pharmaceutical Co., Ltd. Hangzhou

＜120〉Cordyceps sinensis ribonucleotide reductase, encoding gene and application thereof

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 313

<212> PRT

<213> Hirsutella Sinensis

<400> 1

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro

1 5 10 15

Arg Gly Ser His Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg

20 25 30

Gly Ser Glu Phe Met Phe Val Arg Lys Arg Asp Gly Arg Gln Glu Arg

35 40 45

Val Gln Tyr Asp Lys Ile Thr Ala Arg Val Ser Arg Leu Cys Tyr Gly

50 55 60

Leu Asp Pro Asp His Val Asp Pro Ala Ala Ile Thr Gln Lys Val Ile

65 70 75 80

Ser Gly Val Tyr Ser Gly Val Thr Thr Val Gln Leu Asp Asp Leu Ala

85 90 95

Ala Glu Thr Ala Ala Tyr Met Thr Val Thr His Pro Asp Tyr Ala Ile

100 105 110

Leu Ala Ala Arg Ile Ala Val Ser Asn Leu His Lys Gln Thr Lys Lys

115 120 125

Gln Trp Ser Ser Val Ile Ser Asp Leu Tyr His Tyr Val Asn Pro Lys

130 135 140

Asn Asp Arg Ala Ser Pro Met Ile Ser Gln Glu Thr Tyr Glu Cys Val

145 150 155 160

Met Lys His Lys Asp Asp Leu Asp Ser Ala Ile Val Tyr Asp Arg Asp

165 170 175

Phe Asn Tyr Gln Tyr Phe Gly Phe Lys Thr Leu Glu Arg Ser Tyr Leu

180 185 190

Leu Lys Leu Asn Gly Lys Ile Val Glu Arg Pro Gln His Met Ile Met

195 200 205

Arg Val Ala Val Gly Ile Trp Arg Asp Asp Ile Glu Arg Val Val Glu

210 215 220

Thr Tyr Asn Phe Met Ser Ser Lys Phe Phe Thr His Ala Ser Pro Thr

225 230 235 240

Leu Phe Asn Ala Arg His Ser Pro Gly Pro Ala Val Val Leu Leu Pro

245 250 255

Arg Arg His Glu Gly Arg Gln His Arg Trp His Leu Arg Tyr Pro Gln

260 265 270

Asp Leu Arg His Asp Leu Gln Asp Gly Trp Arg His Arg Ala Ser Thr

275 280 285

Ser Thr Ala Ser Ala Pro Pro Gly Ala Tyr Ile Ala Gly Thr Asn Gly

290 295 300

Thr Ser Asn Gly Val Val Pro Met Leu

305 310

<210> 2

<211> 939

<212> DNA

<213> Hirsutella Sinensis

<400> 2

atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60

atggctagca tgactggtgg acagcaaatg ggtcgcggat ccgaattcat gttcgtccga 120

aagcgcgatg gacgtcagga gcgcgtccaa tacgataaga tcactgcccg cgtctctcgg 180

ctgtgttacg gcctcgatcc ggaccacgtc gaccctgctg ccattactca aaaggtcatc 240

tcgggtgtct atagcggcgt gacgacggtc cagctcgatg atctcgctgc tgagacggct 300

gcctatatga cggtcaccca ccccgactat gccatcctgg cggcccgcat tgccgtctca 360

aacctacaca agcagaccaa gaagcagtgg tcgtcggtca ttagcgacct gtaccactac 420

gtcaacccca agaatgaccg ggcgtcgccc atgatctcgc aagagacgta cgagtgcgtc 480

atgaagcaca aggatgacct cgactcggcc atcgtctacg accgcgactt caactatcag 540

tactttggct tcaagaccct ggagcgctcc tacctgctca agctcaacgg caagatcgta 600

gagcgtccgc aacacatgat tatgcgtgtc gctgttggca tctggagaga cgacattgag 660

cgcgtcgtcg agacctacaa cttcatgtcc agcaagttct tcactcacgc ctctcccacc 720

ctcttcaacg cccggcactc cccaggccca gctgtcgtct tgcttcctcg tcgacatgaa 780

ggaagacagc atcgatggca tctacgatac cctcaagacc tgcgccatga tctccaagat 840

ggctggcggc atcgggcctc aacgtccacc gcatccgcgc caccgggagc ctacattgcc 900

ggcaccaacg gcacctccaa cggcgtcgtc cccatgctg 939

<210> 3

<211> 255

<212> PRT

<213> Hirsutella Sinensis

<400> 3

Met Gly Ser Thr Ala Ile Val Thr Asn Val Lys His Phe Gly Gly Met

1 5 10 15

Gly Ser Ala Leu Arg Leu Ser Glu Ala Gly His Thr Val Ala Cys His

20 25 30

Asp Glu Ser Phe Lys His Lys Asp Glu Leu Glu Ala Phe Ala Glu Thr

35 40 45

Tyr Pro Gln Leu Lys Pro Met Ser Glu Gln Glu Pro Ala Glu Leu Ile

50 55 60

Glu Ala Val Thr Ser Ala Phe Gly Gln Val Asp Val Leu Val Ser Asn

65 70 75 80

Asp Ile Phe Ala Leu Glu Phe Arg Pro Ile Asp Lys Tyr Ala Val Glu

85 90 95

Asp Tyr Arg Gly Ala Val Glu Ala Leu Gln Ile Arg Pro Phe Ala Leu

100 105 110

Val Asn Ala Val Ala Ser Gln Met Lys Lys Arg Lys Ser Gly His Ile

115 120 125

Ile Phe Ile Thr Ser Ala Ala Pro Phe Gly Pro Trp Lys Glu Leu Ser

130 135 140

Thr Tyr Ser Ser Ala Arg Ala Gly Ala Ser Ala Leu Ala Asn Ala Leu

145 150 155 160

Ser Lys Glu Leu Gly Glu Tyr Asn Ile Pro Val Phe Ala Ile Gly Pro

165 170 175

Asn Tyr Leu His Ser Glu Asp Ser Pro Tyr Tyr Tyr Pro Thr Glu Pro

180 185 190

Trp Lys Ile Asn Pro Glu His Val Ala His Val Lys Lys Val Thr Ala

195 200 205

Leu Gln Arg Leu Gly Thr Gln Lys Glu Leu Gly Glu Leu Val Ala Phe

210 215 220

Leu Ala Ser Gly Ser Cys Asp Tyr Leu Thr Gly Gln Val Phe Trp Leu

225 230 235 240

Ala Gly Gly Phe Pro Val Ile Glu Arg Trp Pro Gly Met Pro Glu

245 250 255

<210> 4

<211> 768

<212> DNA

<213> Hirsutella Sinensis

<400> 4

atgggttcta ctgcgatcgt aactaatgta aaacacttcg gtggcatggg ttctgctctg 60

cgtctgtctg aggcaggcca tactgtggct tgtcacgatg aaagcttcaa acacaaggat 120

gaactggaag ccttcgcgga aacctaccct cagctgaaac cgatgtctga acaggaaccg 180

gctgagctga tcgaggcggt tacctctgcg ttcggccagg ttgacgttct ggttagcaac 240

gacatctttg cgctggagtt tcgtccgatc gataagtatg ctgttgagga ttaccgtggc 300

gcggttgaag ctctgcaaat ccgcccgttc gctctggtca acgcggtggc aagccagatg 360

aagaaacgca agtccggcca cattattttc attaccagcg cagcgccttt cggtccgtgg 420

aaagaactga gcacctatag ctccgcgcgt gctggtgcaa gcgcgctggc taacgcgctg 480

tctaaggaac tgggcgagta caacatcccg gtgttcgcta ttggcccaaa ctatctgcac 540

tccgaagata gcccatacta ctacccaacc gaaccgtgga aaatcaaccc tgagcatgtg 600

gctcatgtta aaaaggtaac cgccctgcag cgcctgggta ctcagaaaga actgggcgaa 660

ctggtagcct tcctggccag cggctcctgc gattacctga ccggccaggt cttctggctg 720

gctggcggct tcccggtgat cgaacgttgg ccgggcatgc cggaataa 768

Claims (10)

1. a Cordyceps sinensis ribonucleotide reductase is characterized in that described enzyme has aminoacid sequence 90% above homology shown in SEQ ID No.1 or the SEQ ID No.3.

2. Cordyceps sinensis ribonucleotide reductase as claimed in claim 1, the aminoacid sequence that it is characterized in that described enzyme is shown in SEQ ID No.1 or the SEQ ID No.3.

3. the Cordyceps sinensis ribonucleotide reductase prepares application in the deoxidation bisphosphate pyrimidine nucleoside at biocatalysis bisphosphate pyrimidine nucleoside as claimed in claim 1.

4. application as claimed in claim 3, it is characterized in that described being applied as: to contain the broken mixed solution of wet thallus after cytoclasis that Cordyceps sinensis ribonucleotide reductase thalline fermentation culture obtains as catalyzer, take the bisphosphate pyrimidine nucleoside as substrate, be in the transformation system that consists of of 6.5 ~ 8.5 buffered soln in pH, conversion reaction 2 ~ 3h under 30 ℃, 150rpm condition, after reaction finishes, with reacting liquid filtering, get the crude product that filtrate being contains deoxidation bisphosphate pyrimidine nucleoside, described crude product separation and purification obtains deoxidation bisphosphate pyrimidine nucleoside.

5. application as claimed in claim 3, the starting point concentration that it is characterized in that described substrate is 10g/L, and the volumetric usage of described catalyzer is the 100mL/g substrate, and the dry mycelium concentration of described catalyzer is 6.7mg/mL.

6. gene of the described enzyme of claim 1 of encoding.

7. gene as claimed in claim 6 is characterized in that described gene has nucleotide sequence 90% above homology shown in SEQ ID No.2 or the SEQ ID No.4.

8. gene as claimed in claim 6 is characterized in that the nucleotides sequence of described gene is classified as shown in SEQ ID No.2 or the SEQ ID No.4.

9. such as the application of gene as described in one of claim 6 ~ 8 in making up the genetic engineering bacterium that can biocatalysis bisphosphate pyrimidine nucleoside prepares deoxidation bisphosphate pyrimidine nucleoside.

10. application as claimed in claim 9, it is characterized in that described being applied as: make up the recombinant vectors that contains described Cordyceps sinensis ribonucleotide reductase gene, described recombinant vectors is converted in the intestinal bacteria, the recombination engineering bacteria that obtains carries out inducing culture, and the nutrient solution separation and purification obtains to contain the somatic cells of Cordyceps sinensis ribonucleotide reductase.

Images