CN104120114B - Cordyceps 3-Isopropylmalate dehydrogenase A, encoding gene and application thereof - Google Patents

Abstract

The invention provides a kind of 3 isopropylmalate dehydrogenase A, encoding gene and application thereof preparing 4 methyl 2 oxopentanoic acids from Cordyceps China pilose spore participation living things catalysis 3 isopropylmolic acid, described 3 isopropylmalate dehydrogenase A aminoacid sequences are as shown in SEQ ID No.1, and encoding gene is as shown in SEQ IDNo.2；The clone DNA of nucleotide sequence provided by the present invention can be used to proceed in engineering bacteria by transduction, conversion, the method for Conjugative tiansfer, by regulating the expression of 3 isopropylmalate dehydrogenase A genes, give the high expressed of host 3 isopropylmalate dehydrogenase A, provide effective way for expanding the biologic applications of 3 isopropylmalate dehydrogenase A, there is major application prospect.

Description

Cordyceps 3-Isopropylmalate dehydrogenase A, encoding gene and application thereof

(1) technical field

The present invention relates to produce the 3-Isopropylmalate dehydrogenase A of bacterium Cordyceps China pilose spore from " hundred make " (3-isopropylmalate dehydrogenase), encoding gene and application thereof.

(2) background technology

Cordyceps (Cordyceps sinensis (Berk.) Sacc.) is that Cordyceps fungus colonizes in Lepidoptera (Lepidoptera) Stroma on Hepialidae insecticide (Hepialus armoricanus Oberthur) larva and larva corpse Complex (including Stroma and polypide) on body.Cordyceps is traditional fungus herb resource that a class is treasured, and has metabolism and produces Thing and the feature of diverse biological activities, show huge application and development prospect at biomedicine field.Cordyceps is with it Multiple medicinal efficacy is extensive, obvious and receives much concern, and worldwide enjoys high praise.The traditional Chinese medical science is thought, Cordyceps enters lung kidney Two warps, can tonifying the lung cloudy, again can kidney-replenishing, cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough Expectorant blood, spontaneous sweating etc., is a kind of Chinese medicine that can balance simultaneously, regulate negative and positive.Modern pharmacology is it has proven convenient that the worm summer in winter Grass has immunomodulating, antibacterial, antitumor, antioxidation, defying age, reducing blood sugar and blood lipid, gonadotropic Effect etc. are biological widely Activity.

Cordyceps fungus is a kind of ascomycetes, has Conidial Stage (phorozoon) and ascospore in its life cycle Stage (epigamous).And in the actual production such as artificial culture, liquid fermentation, use the Cordyceps fungus in imperfect stage, because of And the qualification of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is investigated at Cordyceps Resources, phorozoon confirmation, activity become Separate to analyze and do a lot of work with the mechanism of action, exploitation application aspect.Cordyceps China pilose spore has proved to be the winter The phorozoon existence form of worm summer grass, has the active component identical with natural cordyceps and drug effect.

But, to the almost blank of the research of 3-Isopropylmalate dehydrogenase A in Cordyceps China pilose spore, and 3-Isopropylmalate dehydrogenase A living things catalysis 3-isopropylmolic acid in China pilose spore is prepared 4-methyl-2-oxo The research of the effect of valeric acid.

3-Isopropylmalate dehydrogenase (IPMDH, EC:1.1.1.85) is a key enzyme in biosynthesis leucine, is a kind of with NAD⁺ Or NADP+ be receptor, the oxidoreductase that acts on donor CH-OH group.This enzyme can be catalyzed following enzymatic reaction: This reacts real It is made up of two steps on border: With That is the product of above-mentioned first step reaction Thing can react spontaneous decarboxylation by second step and produce 4-methyl-2-oxopentanoic acid.

1981, Tanaka et al. was cloned into a 3-from Thermophilic Bacterium Thermus thermophilus HB8 Isopropylmalate dehydrogenase, and with pBR322 as in carrier cloning to escherichia coli.Carry the large intestine bar of recombiant plasmid The 3-Isopropylmalate dehydrogenase enzyme work of bacterium is 7 times of wild-type strain.

1986, Kazuhiro Hamasawa et al. was cloned into a 3-isopropyl from the gene library of Candida utilis Malate dehydrogenase gene, utilizes plasmid pYKL30 to be cloned in escherichia coli and saccharomyces cerevisiae.The open reading code of this gene Frame size is 1089bp, encodes 363 amino acid residues.Southern hybridizes confirmation, and this fragment is to obtain from three Candida utilis.

1991, H Kirino et al. was cloned into a 3-from Thermophilic Bacterium Thermus aquaticus YT-1 Isopropylmalate dehydrogenase leuB, and expressed in escherichia coli, it comprises 1035bp, encodes 344 amino The open reading frame of acid residue.Nucleotides sequence with the 3-Isopropylmalate dehydrogenase of Thermophilic Bacteria T.thermophilus HB8 Row have 87.0% homology, and aminoacid sequence has 91.3% homology.

1992, MatsEt al. from complementary yeast mutant leu2, be cloned into a 3-isopropyl Malate dehydrogenase gene, the albumen of this one 52kDa size of gene code, it has the chloroplast transit peptides of presumption.? External imported in chloroplast by protein, concurrently protein cleavage.

2011, Sikdar et al. cloned from the genome of Oryza sativa L. and has obtained a 3-Isopropylmalate dehydrogenase base Cause, the opening code-reading frame of this gene can encode 389 aminoacid, corresponding to the protein of about 41.2kD.This Oryza sativa L. source The aminoacid sequence of 3-Isopropylmalate dehydrogenase and plant and the 3-Isopropylmalate dehydrogenase aminoacid of bacterial origin Sequence very high homology.

But, current ncbi database is also retrieved at present less than 3-Isopropylmalate dehydrogenase A in China pilose spore Gene-correlation information.

(3) summary of the invention

The present invention seeks to for present on the not enough and technical issues that need to address, to " hundred makes " production bacterium winter worm Summer grass China pilose spore 3-Isopropylmalate dehydrogenase A prepares 4-methyl-2-oxo at living things catalysis 3-isopropylmolic acid Valeric acid is furtherd investigate, it is provided that " hundred make " produces a kind of 3-isopropylmolic acid dehydrogenation of bacterium Cordyceps China pilose spore Enzyme A, encoding gene and application thereof.

The technical solution used in the present invention is:

The present invention provides a kind of and prepares 4-from Cordyceps China pilose spore participation living things catalysis 3-isopropylmolic acid The 3-Isopropylmalate dehydrogenase A of methyl-2-oxopentanoic acid, its aminoacid sequence (is designated as isoA as shown in SEQ ID No.1 Albumen).

SEQ ID No.1 sequence is as follows: LIEGDGIGPE ISQSVKDIFA AAKTPISWES VDVTPIIKDG KTAIPDAAIE NIKKNKIALK GPLATPIGKG HVSLNLTLRR TFNLFANLRP CRSVAGFKTP YDDVDTVLIR ENTEGEYSGI EHVVVDGVVQ SIKLITREAS ERVLRFAFQH AESIGRKKVR VVHKATIMKM SDGLFLSVAR RVAKDFPAIE FDAELLDNTC LKMVTDPDPY NDKVLVMPNL YGDILSDMCA GLIGGLGLTP SGNIGDECSI FEAVHGSAP*

Due to the particularity of aminoacid sequence, any containing the sheet of the peptide protein of aminoacid sequence shown in SEQ ID NO.1 Section or its variant, such as its examples of conservative variations, bioactive fragment or derivant, if the fragment of this peptide protein or peptide protein variant With aforementioned amino acid sequences homology more than 90%, belong to the row of scope.Concrete described change can be wrapped Include amino acid whose disappearance in aminoacid sequence, insert or replace；Wherein, the conservative for variant changes, the amino replaced Acid has the structure similar to original acid or chemical property, and as replaced isoleucine with leucine, variant also can have non-guarantor Keep and sexually revise, as replaced glycine with tryptophan.

The invention still further relates to described 3-Isopropylmalate dehydrogenase A and prepare 4-at living things catalysis 3-isopropylmolic acid Application in methyl-2-oxopentanoic acid.Right through the catalysis acquisition of 3-Isopropylmalate dehydrogenase A by 3-isopropylmolic acid The path answering 4-methyl-2-oxopentanoic acid is as follows:

Specifically, described Cordyceps 3-Isopropylmalate dehydrogenase A prepares 4-at living things catalysis 3-isopropylmolic acid Application in methyl-2-oxopentanoic acid is: to train through induction containing Cordyceps 3-Isopropylmalate dehydrogenase A recombination engineering Support the wet thallus phosphate buffer (50mM, pH8.0) obtained to suspend, after ultrasonication, broken mixed liquor is centrifuged, takes Clear liquid is catalyst, with 3-isopropylmalate aqueous acid as substrate, with cozymase (i.e. NADH) as cosubstrate, in Tris- In HCl (pH natural) buffer, 37 DEG C, react under the conditions of 150rpm, after reaction completely, reactant liquor is centrifuged, it is thus achieved that supernatant Liquid is the mixed liquor containing 4-methyl-2-oxopentanoic acid；Mixed liquor is isolated and purified i.e. obtains 4-methyl-2-oxopentanoic acid；Described Isolated and purified method is known in the art operation, generally uses affinity chromatograph method；Described mixed liquor uses high-efficient liquid phase color Spectrum detection product assay, flowing phase: V (acetonitrile): V [pH3.0 (0.86%) phosphoric acid triethylamine]=55:45, wavelength 237nm, post Temperature: 25 DEG C, flow 1mL/min；Sampling volume: 20uL, solvent: acetonitrile, chromatographic column: Diamonsul250mm × 4.6mm C18 Post, instrument: Shimadzu LC-20AT high performance liquid chromatograph.

The preparation method of described catalyst is: is inoculated in by the recombination engineering containing 3-Isopropylmalate dehydrogenase A and contains Have in the LB fluid medium of Kan resistance (final concentration 50 μ g/ml), 37 DEG C, 250r/min overnight incubation.Take 1mL culture, will Its switching (volume inoculum concentration is 2%) in 50mL contains the LB fluid medium of Kan resistance (final concentration 50 μ g/ml), 37 DEG C, 250r/min cultivates and is about 0.6～about 0.8 to cell concentration OD600, adds finite concentration (final concentration in culture IPTG inducing culture 8h 0.05mmol/L), collects wet thallus, by wet thallus under the conditions of power 40%, broken 1s stop 1s ultrasonic Broken 3 times, each 5min, take cell breakage mixed liquor and be centrifuged, take supernatant and be catalyst.

One unit of enzyme activity (U) is defined as: 3-Isopropylmalate dehydrogenase A is under the conditions of 37 DEG C, and 1min is catalyzed 3- Isopropylmolic acid generates the enzyme amount needed for the 4-methyl-2-oxopentanoic acid of 1 μm ol.

The concentration of described substrate 3-isopropylmalate aqueous acid is 0.1M, and the initial concentration of described substrate is 0.02M, institute The volumetric usage stating catalyst is calculated as 0.01g/L (final concentration), the final concentration of described cozymase with wet thallus quality before ultrasonication For 0.01g/L.

The invention still further relates to encode the gene of described 3-Isopropylmalate dehydrogenase A.Concrete, the nucleoside of described gene Acid sequence (is designated as isoA gene, isoA gene code isoA albumen) as shown in SEQ ID No.2.

Due to the particularity of nucleotide sequence, the variant of polynucleotide shown in any SEQ ID NO.2, as long as they are many with this Nucleotide has more than 90% homology, belongs to the row of scope.The variant of described polynucleotide refers to one There is the polynucleotide sequence that one or more nucleotide changes.The variant of these polynucleotide can make raw displacement variant or The variant of non-life, including replacing variant, Deletion variants and insertion variant.As known in the art, allelic variant Being the alternative forms of polynucleotide, it is probably the replacement of polynucleotide, lacks or insert, but will not be from substantially Change the function of the peptide protein of its coding.

Described coding described 3-Isopropylmalate dehydrogenase A gene can living things catalysis 3-isopropylmalate at structure Processed with acid is for the application in the genetic engineering bacterium of 4-methyl-2-oxopentanoic acid, to expand answering of 3-Isopropylmalate dehydrogenase A With, particularly as follows: build the recombinant vector containing described 3-Isopropylmalate dehydrogenase A gene, described recombinant vector is converted To escherichia coli, it is thus achieved that recombination engineering bacteria carry out inducing culture, the isolated and purified acquisition of culture fluid contains 3-isopropyl The somatic cells of malic dehydrogenase A gene.

The present invention is characterized by and provides shown in the aminoacid sequence shown in SEQ ID NO.1 and SEQ ID NO.2 Nucleotide sequence, in the case of this aminoacid sequence known and nucleotide sequence, this aminoacid sequence and nucleotide sequence Obtain, and the acquisition of relevant carriers, host cell, the most all it is apparent from.

Can provide during the bacterial strain of Cordyceps 3-Isopropylmalate dehydrogenase A of the present invention and encoding gene thereof is State is compiled in China typical culture collection center, preservation by hair spore (Hirsutella sinensis) L0106, this culture presevation Number it is CCTCC No:M2011278, patent CN102373190A the most previously applied for discloses.

The beneficial effects are mainly as follows: the present invention from principle to 3-Isopropylmalate dehydrogenase A in The process that 4-methyl-2-oxopentanoic acid is prepared by living things catalysis 3-isopropylmolic acid in hair spore by state studies in detail, and carries " hundred make " has been supplied to produce 3-Isopropylmalate dehydrogenase A and encoding gene, the present invention of bacterium Cordyceps China pilose spore The clone DNA of the nucleotide sequence provided can be used to proceed in engineering bacteria by transduction, conversion, the method for Conjugative tiansfer, By regulating the expression of proteolytic enzyme gene, give the high expressed of host 3-Isopropylmalate dehydrogenase A, for expanding 3- The biologic applications of isopropylmalate dehydrogenase A provides effective way, has major application prospect.

(4) accompanying drawing explanation

Fig. 1 is the denaturing formaldehyde gel electrophoretogram that " hundred make " produces bacterium Cordyceps China pilose spore total serum IgE；

Fig. 2 is the catalytic process annotated map at leucine metabolic pathway and 3-Isopropylmalate dehydrogenase place；

Fig. 3 is 3-Isopropylmalate dehydrogenase A gene PCR amplified production gel electrophoresis figure；

Fig. 4 is cloning vehicle pMD18-T Vector and expression vector pET-28a physical map；

Fig. 5 is restructuring cloned plasmids pMD18-T/isoA physical map；

Fig. 6 is recombinant expression plasmid pET-28a/isoA building process schematic diagram；

Fig. 7 is recombinant expression plasmid pET-28a/isoA physical map；

Fig. 8 is the SDS-PAGE figure of 3-Isopropylmalate dehydrogenase A albumen.

(5) detailed description of the invention

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in This:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps China pilose spore

Bacterium source: first gather natural cordyceps from Qinghai, and bring it back into Hangzhou and carry out separation screening, obtain L0106 bacterial strain, and through this bacterial strain of strain identification be China pilose spore (Hirsutella sinensis), this culture presevation in State's Type Tissue Collection, deposit number is CCTCC No:M2011278, the patent the most previously applied for CN102373190A discloses.

This strain is inoculated in inclined-plane, and (this is the liquid formulations before solidification to culture medium prescription, good by following proportions Bevel the most again) be: glucose 2.0% (w/v, 1% represents containing 1g in 100mL culture medium, lower same), Semen Maydis powder 1.0%, murphy juice 0.5%, dextrin 0.5%, yeast powder 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, sulfur Acid magnesium 0.05%, potassium dihydrogen phosphate 0.05%, agar powder 1.0%, surplus is water；Cultivate 25 days at 12～16 DEG C；Then by bacterium Planting and be inoculated in fermentation medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract 0.5%, magnesium sulfate 0.01%, potassium dihydrogen phosphate 0.02%, surplus is water；Be placed on shaking table, temperature 12～ 16 DEG C cultivate 25 days, cultivate terminate after aseptically, carry out solid-liquid separation, and solid be placed in sterilized equipment, standby.

Embodiment 2: " hundred make " produces the extraction of bacterium Cordyceps China pilose spore total serum IgE

With TRIzol reagent extract total serum IgE, step particularly as follows:

1) liquid nitrogen grinding: take the new fresh thalli of 1g and put in mortar, repeatedly adds liquid nitrogen and is fully ground to powder, be dispensed into In the 1.5mL centrifuge tube of pre-cooling, add 1mL TRIzol reagent, mixing, stand 5min on ice, make nucleic acid-protein complex complete Separate.

2) RNA separates: add 0.2mL chloroform, firmly concussion mixing 15s, stands 2～3min on ice, 4 DEG C, 12000rpm Centrifugal 15min, layering, take upper strata aqueous phase, about 600 μ L.

3) RNA precipitate: add 500 μ L isopropanols, stands 10min on ice, 4 DEG C, 12000rpm be centrifuged 10min, abandon Clearly.

4) RNA washing: add 1mL75% (v/v) ethanol, precipitation is hanged, stand 10min on ice, 4 DEG C, 7500rpm from Heart 15min；Repeat washing step above, then wash one time.

5) RNA is dissolved: be placed in by centrifuge tube and open wide dry 5～10min on ice, add appropriate DEPC water dissolution.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps China pilose spore RNA sample

After extracting sample total serum IgE, with the enrichment with magnetic bead mRNA with Oligo (dT).Add fragmentationbuffer MRNA is broken into short-movie section (200～700bp), with mRNA as template, with hexabasic base random primer (random hexamers) Synthesis Article 1 cDNA chain, then synthesis Article 2 cDNA chain, then through QiaQuickPCR kits and add EB buffer Do end reparation after eluting, add polyA and connect sequence measuring joints, then carry out clip size choosing with agarose gel electrophoresis Selecting, finally carry out PCR amplification, the sequencing library Illumina GA IIx built up checks order.The original image that order-checking obtains Data are converted into sequence data through base calling, i.e. raw data or raw reads.In removing primitive sequencer reads only Containing the reads of adaptor sequence, standby with subsequent analysis.

Embodiment 4: " hundred make " produces bacterium Cordyceps China pilose spore RNA short reading sequence assembling

Use short reads composite software SOAPdenovo (Li, Zhu et al.De novo assembly of human genomes with massively parallel short read sequencing[J].Genome Res,2010,20: 265-272.) do transcript profile and from the beginning assemble.First the reads with certain length overlap is linked to be longer by SOAPdenovo The Contig fragment without N.Then Contig is returned in reads comparison, determined from same by paired-end reads Distance between the different Contig and these Contig of transcript, these Contig are connected together by SOAPdenovo, in Between unknown nucleotide sequence N represent, thus obtain Scaffold.Further with paired-end reads, Scaffold is mended Hole processes, and finally obtains containing N minimum, the Unigene sequence that two ends can not extend again.Finally, by Unigene sequence and albumen number Do blastx comparison (evalue < 0.00001) according to storehouse nr, Swiss-Prot, KEGG and COG, take the albumen that comparison result is best Determine the sequence direction of Unigene.If the comparison result between different sink is contradictory, then press nr, Swiss-Prot, KEGG and The priority of COG determines the sequence direction of Unigene, with above four storehouses all to the Unigene software ESTScan being less than (Iseli,Jongeneel et al.ESTScan:a program for detecting,evaluating,and reconstructing potential coding regions in EST sequences[J].In Proceedings of9th International Conference on Intelligent Systems for Molecular Biology.AAAIPress, Menlo Park, CA, pp.1999,138-148.) predict its coding region and determine the side of sequence To.For can determine that the Unigene in sequence direction provides its sequence from 5' to 3' direction, for sequence direction cannot be determined Unigene provides the sequence that composite software obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps China pilose spore Unigene functional annotation

Functional annotation information provides the protein function annotation of Unigene, Pathway annotation, COG functional annotation and Gene Ontology (GO) functional annotation.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss- Prot, KEGG and COG (evalue < 0.00001), obtain with given Unigene has the albumen of highest serial similarity, thus Obtain the protein function annotation information of this Unigene.The Pathway of Unigene can be obtained further according to KEGG annotation information Annotation.Unigene and COG data base is compared, it was predicted that it is also done function classified statistic by function that Unigene is possible. According to nr annotation information, use Blast2GO software (Conesa, Gotz et al.Blast2GO:a universal tool for annotation,visualization and analysis in functional genomics research[J] .Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.Obtain each After the GO annotation of Unigene, with WEGO software (Ye, Fang et al.WEGO:a web tool for plotting GO Annotations [J] .Nucleic Acids Research, 2006,34:293-297.) all Unigene are done GO function Classified statistic, from the gene function distribution characteristics macroscopically recognizing these species.

Embodiment 6: leucine metabolic pathway and the analysis of 3-Isopropylmalate dehydrogenase A effect

Fig. 2 is leucine metabolic pathway and the catalytic step at 3-Isopropylmalate dehydrogenase A place and process annotated map, First, acetone acid synthesizes (S)-2-acetolactic acid under the catalytic action of acetolactate synthase, then at keto-alcohol acid reduction isomery Synthesize 3-hydroxyl-3 methyl-2-Oxobutyric acid under the effect of enzyme, after 5 step catalytic reactions, generate (2R, 3S)-3-isopropyl Herba Marsileae Quadrifoliae Fruit acid, generates 4-methyl-2-oxopentanoic acid under the catalytic action of 3-Isopropylmalate dehydrogenase A, finally takes off at leucine Under the effect of hydrogen enzyme, catalysis generates L-Leu.3-is detected different from the order-checking of China pilose spore transcript profile and annotation information The Unigene of propyl group malic dehydrogenase A.By the ORFFinder software on-line checking in NCBI, have found this gene Open reading frame (SEQ ID No.2) has also obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces bacterium Cordyceps China pilose spore 3-Isopropylmalate dehydrogenase A gene primer and set Meter

Use each gene open proofreading dna sequential design that GENE RUNNER primer-design software obtains according to prediction Primer, is used for cloning " hundred make " and produces bacterium China pilose spore anabolism leucic 3-Isopropylmalate dehydrogenase A gene, Primer is synthesized by Sani bio tech ltd, Shanghai, and primer sequence is listed below:

IsoA gene: forward primer 5 ' AGAGAATTCCTGATCGAAGGCGACGGCAT3 '

Reverse primer 5 ' ATAGCGGCCGCTTAAGGGGCGGAGCCGTG3 '

IsoA mrna length is 780bp.

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps China pilose spore cDNA the first chain

After the method first provided according to embodiment 1 turns out sutella sinensis fermented mycelium, carried according still further to embodiment 2 The method of confession carries out the extraction of total serum IgE to China pilose spore, carries out " hundred make " production bacterium Cordyceps by following after obtaining total serum IgE The synthesis of China pilose spore cDNA the first chain, for follow-up each gene cloning experimentation.

Use PrimeScript1st Strand cDNA Synthesis Kit test kit (TaKaRa) from Total RNA Middle reverse transcription synthesis cDNA the first chain, experimental procedure is as follows:

1) in Microtube pipe, following mixed liquor is prepared.

2) degeneration, annealing operation are conducive to the degeneration of template ribonucleic acid and the specificity annealing of reverse transcription primer and template, can Improving reverse transcription reaction efficiency, so carrying out degeneration, annealing reaction in PCR instrument, condition setting is as follows:

65 DEG C, 5min

3) after annealing terminates, the centrifugal several seconds makes the mixed liquor of template ribonucleic acid/primer etc. be gathered in bottom Microtube pipe.

4) in above-mentioned Microtube pipe, following inverse transcription reaction liquid is prepared.

5) in PCR instrument, reverse transcription reaction is carried out by following condition.

42 DEG C 15～30min

70℃ 15min

Ordinary circumstance, has a PolyA structure at eukaryote mRNA 3 ' end, the quantity of A base ten to hundreds of Individual, utilize this structure can utilize Oligo (dT) primer, under the effect of reverse transcription, with mRNA as templated synthesis CDNA the first chain, the present invention uses sequence (the PrimeScript1st Strand in the dT region developed alone by TaKaRa CDNA Synthesis Kit provides) it is primer, if the mRNA integrity obtained is preferable, then can by process of reverse-transcription To obtain cDNA first chain of all pheron encoding genes in species.Embodiment 9: " hundred make " produces bacterium Cordyceps China quilt The detection of clone, expression and the protein vigor of hair spore 3-Isopropylmalate dehydrogenase A gene

1, the PCR amplification of 3-Isopropylmalate dehydrogenase A gene

CDNA the first chain obtained in embodiment 8 is as template, with the 3-isopropylmolic acid dehydrogenation of synthesis in embodiment 7 Enzyme A gene primer: 5 ' AGAGAATTCCTGATCGAAGGCGACGGCAT3 ' and 5 ' ATAGCGGCCGCTTAAGGGGCGGAGCCGT G3 ' carries out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase PCR amplification condition:

2,3-Isopropylmalate dehydrogenase A gene PCR product detected through gel electrophoresis

Concrete detection method is:

1) it is made to be uniformly dissolved the agarose gel microwave-oven-heating of prepare 0.9%；

2) take 15mL agarose gel, when agarose gel is cooled to about 50 DEG C, add 1 μ L dyeing liquor Gold View, pours into after mix homogeneously on treatments of Electrophoretic Slab Gels, inserts point sample comb after removing bubble；

3) after gel sets on treatments of Electrophoretic Slab Gels, the careful point sample that takes out is combed, and treatments of Electrophoretic Slab Gels is put into (point in electrophoresis tank One end, sample hole is near the negative pole of electrophoresis tank), electrophoresis tank adds TAE electrophoretic buffer；

4) take 5 μ L sample (pcr amplification product that i.e. step 1 obtains), be subsequently adding 6 × Loading Buffer1.5 μ L And ddH₂Using liquid-transfering gun loading after O4 μ L mixing, applied sample amount is 10 μ L；

5) connecting the power line between electrophoresis tank and electrophresis apparatus, the most red, negative pole is black；

6) power-on, starts electrophoresis, and ceiling voltage is less than 5V/cm；

7) electrophoresis can be terminated when sample ran the 2/3 of treatments of Electrophoretic Slab Gels；

8) after cutting off the electricity supply, gel on treatments of Electrophoretic Slab Gels is taken out, put in gel imaging instrument and observe, take pictures.

Transcript profile checks order, it was predicted that the size of 3-Isopropylmalate dehydrogenase A gene is 780bp, agarose gel electrophoresis Result shows that Successful amplification has gone out 3-Isopropylmalate dehydrogenase A gene, and size is about 800bp.Fig. 3 is that " hundred make " produces Bacterium China pilose spore 3-Isopropylmalate dehydrogenase A functional gene PCR primer gel electrophoresis figure.

3, base A that adds of 3-Isopropylmalate dehydrogenase A gene PCR product processes and purification

Owing to Pfu archaeal dna polymerase PCR primer end is flush end, so also needing to carry out adding at base A after gel reclaims Manage, the most just can be used for carrier T connection.It is as follows that gel recovery product adds base A system:

In PCR instrument, 72 DEG C add A base 20min, finally purify with AxyPrep PCR cleaning agents box.

4,3-Isopropylmalate dehydrogenase A gene and the connection of cloning vehicle

Cloning vehicle pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), and its physical map is shown in Fig. 4, is connected step 3 3-Isopropylmalate dehydrogenase A gene after purification with cloning vehicle, construction recombination plasmid pMD18- T/isoA, physical map is shown in that Fig. 5, linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 DEG C, 16h；Inactivation: 65 DEG C, 15min.

5, the conversion of 3-Isopropylmalate dehydrogenase A recombiant plasmid pMD18-T/isoA

Recombiant plasmid pMD18-T/isoA is proceeded in E. coli JM109, build and carry 3-isopropylmalate The recombinant bacterium E.coli JM109/pMD18-T/isoA of acidohydrogenase A gene, concretely comprises the following steps: 1) by 10 μ L reaction systems (i.e. The connection product that step 4 obtains) go in competent cell E.coli JM109, ice bath 30min；2) thermal shock: 42 DEG C, 90s；3) Ice bath: 2～3min；4) 800 μ L LB fluid mediums are added, 37 DEG C, 250rpm, 1h；5) coating LB flat board (containing Amp resistance, Final concentration 50 μ g/ml)；6) 37 DEG C of incubator overnight incubation.

LB fluid medium forms: tryptone 10g/L, yeast extract 5g/L, sodium chloride 5g/L, solvent is water, pH Natural；LB flat board is LB fluid medium+final concentration 15g/L agar.

6, the screening of the E.coli JM109/pMD18-T/isoA positive recombinant bacterium of 3-Isopropylmalate dehydrogenase A

Bacterium colony PCR can extract genomic DNA, and the DNA exposed after being directly pyrolyzed with thalline carries out PCR expansion for template Increasing, whether the method is easy and simple to handle, quick, can be the positive bacterium colony containing purpose plasmid with Rapid identification bacterium colony, is converting mirror In Ding relatively conventional.In experiment, the single bacterium colony being inoculated in fluid medium correspondence is carried out bacterium colony PCR, to verify whether to turn Enter genes of interest.First, add in the 1.5mL centrifuge tube containing 50 μ L sterilized water with toothpick picking list bacterium colony, boiling water bath 30min, Being then centrifuged for using supernatant as template, carry out PCR amplification, PCR program setting is that Taq enzyme expands general procedure.Finally use The agarose gel electrophoresis detection bacterium colony PCR primer of 0.9%.

7, the order-checking of 3-Isopropylmalate dehydrogenase A recombiant plasmid pMD18-T/isoA

The positive recombinant bacterium inoculation LB fluid medium that step 6 bacterium colony PCR is detected, 37 DEG C, 150rpm overnight incubation After, taking 4mL bacterium solution and extract plasmid, method presses the operating instruction that AxyPrep plasmid DNA small volume of reagent box provides.Order-checking is by Shanghai Sani bio tech ltd completes.Through sequence verification, sequence SEQ ID No.2 has recombinated to pMD18-T/isoA.

8, the structure of 3-Isopropylmalate dehydrogenase A recombinant expression plasmid pET-28a/isoA

Test according to exogenous gene in the principle of expression in escherichia coli, and expression vector pET-28a and 3-isopropyl Malic dehydrogenase A gene restriction enzyme site comparison situation, it is determined that isoA EcoR I/Not I double enzyme site, and big to restructuring Enterobacteria E.coli JM109/pMD18-T/isoA carries out the cultivation of liquid LB test tube shaker, recombiant plasmid extracts.

The recombiant plasmid pMD18-T/isoA and expression vector pET-28a of 3-Isopropylmalate dehydrogenase A gene is respectively Processing 6h with EcoR I/Not I restricted enzyme at 37 DEG C of enzyme action, enzyme action system is as follows:

EcoR I/Not I double digestion system:

Enzyme action terminates rear 65 DEG C of inactivation 15min, the most respectively with Axygen DNA gel reclaim test kit carry out reclaiming, pure Change.

3-Isopropylmalate dehydrogenase A gene and expression vector pET-28a are through double digestion, use T4 ligase the most again 16 DEG C connect overnight, build recombinant expression plasmid pET-28a/isoA, and its building process is shown in Fig. 6, and it is recombinant expressed that structure obtains Fig. 7 is shown in by plasmid pET-28a/isoA collection of illustrative plates.Linked system composition is as follows:

Linked system:

9, the conversion of 3-Isopropylmalate dehydrogenase A recombinant expression plasmid and the screening of positive monoclonal

The expression plasmid that builds is heat-shock transformed to E.coli BL21 (DE3) Host Strains, it is then applied to containing card On the LB flat board of that mycin (Kan) resistance (final concentration 50 μ g/ml), 37 DEG C of overnight incubation.Random choose list bacterium colony from flat board, Carry out PCR amplification with the 3-Isopropylmalate dehydrogenase A gene primer of synthesis in step 7, select positive colony.

10, the abduction delivering of 3-Isopropylmalate dehydrogenase A recombinant bacterium

The monoclonal being accredited as the positive is inoculated in the LB fluid medium that 5mL contains Kan resistance (final concentration 50 μ g/ml) In, 37 DEG C, 250r/min overnight incubation.Take 1mL culture, transferred and contain Kan resistance (final concentration 50 μ g/ml) in 50mL LB fluid medium in, 37 DEG C, 250r/min cultivates to cell concentration OD600 and be about 0.6～about 0.8.In culture It is separately added into the IPTG inducing culture 8h of finite concentration (final concentration 0.05mmol/L).Collect wet thallus, for electrophoretic analysis and Enzyme activity assay.

11,3-Isopropylmalate dehydrogenase A recombinant bacterium expression product SDS-PAGE analyzes

To proceed to E.coli BL21 (DE3) bacterium of empty carrier and not add the recombinant bacterium of derivant IPTG as comparison.Mirror It is set to the recombinant bacterium of the positive after IPTG inducing culture 7h, takes 0.5mL Induced cultures, centrifugal collect thalline, be resuspended in 50 μ L In distilled water, add 50 μ L sample-loading buffers, boil 10min after mixing, carry out SDS-PAGE electrophoretic analysis, " A " swimming in Fig. 8 Road is the SDS-PAGE figure of e. coli bl21 (DE3) ghost, and " B " swimming lane is recombinant bacterium E.coli BL21 (DE3)/pET- 28a adds the SDS-PAGE figure after IPTG induction, and " C " swimming lane is that recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoA does not adds The comparison SDS-PAGE figure of IPTG, " D " swimming lane is recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoA abduction delivering SDS-PAGE schemes.Show the A Han 3-Isopropylmalate dehydrogenase in recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoA (through its aminoacid sequence of sequence verification as shown in SEQ ID No.1).

12, the protein vigor detection of 3-Isopropylmalate dehydrogenase A recombinant bacterium

Prepared by enzyme liquid: weigh recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoA2g that step 10 is collected, use phosphoric acid Salt buffer (50mM, pH8.0) 100mL suspends, high pressure cracker (model FS-600, Shanghai Sheng Xi ultrasonic instrument company limited) 3 times (35Kpa) is crushed under the conditions of power 40%, broken 1s stop 1s, each 5min, it is centrifuged off thalline, obtains crude enzyme liquid 80.5ml。

3-Isopropylmalate dehydrogenase A transformation system: prepare a clean 50mL and convert bottle, be separately added into E.coli The 3-isopropylmalate aqueous acid 1mL of BL21 (DE3)/pET-28a/isoA crude enzyme liquid 2mL, 0.1M, Tris-HCl buffer (pH7.0) the cozymase 1mL of 1mL and 0.05g/L.37 DEG C, react 1h under the conditions of 150rpm, after reaction terminates, by reactant liquor from The heart, takes the content of supernatant detection 4-methyl-2-oxopentanoic acid.

The content of high performance liquid chromatography detection product 4-methyl-2-oxopentanoic acid, flowing phase: V (acetonitrile): V [pH3.0 (0.86%) phosphoric acid triethylamine]=55:45, wavelength 237nm, column temperature: 25 DEG C, flow 1mL/min；Sampling volume: 20uL, molten Agent: acetonitrile, chromatographic column: Diamonsul250mm × 4.6mm C18 post, instrument: Shimadzu LC-20AT high performance liquid chromatograph.

One unit of enzyme activity (U) is defined as: 3-Isopropylmalate dehydrogenase A is under the conditions of 37 DEG C, and 1min is catalyzed 3- Isopropylmolic acid generates the enzyme amount needed for the 4-methyl-2-oxopentanoic acid of 1 μm ol.

The blank that detection 3-Isopropylmalate dehydrogenase A enzyme is lived is to boil the crude enzyme liquid of inactivation after 20min to substitute Enzyme liquid.It addition, after also have detected E.coli BL21 (DE3) and E.coli BL21 (DE3)/pET-28a induction under similarity condition The vigor of crude enzyme liquid, be all not detected by 3-Isopropylmalate dehydrogenase A enzyme and live.

Utilizing Coomassie Brilliant Blue to record the protein content in 3-Isopropylmalate dehydrogenase A crude enzyme liquid is 0.315mg/ ML, by Bandscan software, is analyzed the crude enzyme liquid band content in SDS-PAGE, 3-Isopropylmalate dehydrogenase A accounts for the 18.6% of total protein, thus the 3-Isopropylmalate dehydrogenase A participating in catalytic reaction be 0.315mg/mL × 2mL × 0.186=0.117mg.Living according to enzyme and define, the maximum specific enzyme activity of 3-Isopropylmalate dehydrogenase A is: 82.3 μm ol/ (60min × 0.117mg)=11.7 μm o1/min/mg=11.7U/mg.Therefore, above-mentioned 3-Isopropylmalate dehydrogenase A weight The maximum specific enzyme activity of group 3-Isopropylmalate dehydrogenase A expressed by bacterium is 22.4U/mg, and the conversion ratio of above-mentioned reaction is 82.3%.Specific enzyme activity computing formula is: the Tot Prot of specific enzyme activity=enzyme work/enzyme.Conversion ratio computing formula is: conversion ratio= (initial concentration-equilibrium concentration)/initial concentration.

Claims (9)

1. a Cordyceps 3-Isopropylmalate dehydrogenase A, it is characterised in that described 3-Isopropylmalate dehydrogenase A's Aminoacid sequence is as shown in SEQ ID No.1.

2. Cordyceps 3-Isopropylmalate dehydrogenase A as claimed in claim 1 is at living things catalysis 3-isopropylmolic acid Prepare the application in 4-methyl-2-oxopentanoic acid.

Apply the most as claimed in claim 2, it is characterised in that described application is: with containing Cordyceps 3-isopropylmolic acid The wet thallus pH8.0 phosphate buffer that dehydrogenase A recombination engineering obtains through inducing culture suspends, after ultrasonication, and will Broken mixed liquor is centrifuged, and taking supernatant is catalyst, with 3-isopropylmalate aqueous acid as substrate, with cozymase for the auxiliary end Thing, in Tris-HCl buffer, 37 DEG C, react under the conditions of 150rpm, after reaction terminates, is centrifuged reactant liquor, takes supernatant I.e. obtain the mixed liquor containing 4-methyl-2-oxopentanoic acid, mixed liquor is isolated and purified, it is thus achieved that 4-methyl-2-oxopentanoic acid.

Apply the most as claimed in claim 3, it is characterised in that: the concentration of described substrate 3-isopropylmalate aqueous acid is 0.1M, the initial concentration of described substrate is 0.02M, and the volumetric usage of described catalyst is calculated as with wet thallus quality before ultrasonication 0.01g/L, the final concentration of 10g/L of described cozymase.

Apply the most as claimed in claim 3, it is characterised in that described catalyst is prepared as follows: 3-isopropyl Herba Marsileae Quadrifoliae will be contained The recombination engineering of fruit acid dehydrogenase A is inoculated in the LB fluid medium of the Kan resistance containing final concentration 50 μ g/ml, 37 DEG C, 250r/min overnight incubation, the inoculum concentration taking culture by volume concentration 2% is transferred in containing final concentration 50 μ g/ml Kan resistance LB fluid medium in, 37 DEG C, 250r/min cultivates to cell concentration OD600 is 0.6～0.8, add eventually in culture The IPTG inducing culture 8h of concentration 0.05mmol/L, collects wet thallus, is surpassed by wet thallus under the conditions of power 40%, broken 1s stop 1s Sound crushes, and takes cell breakage mixed liquor and is centrifuged, takes supernatant and be catalyst.

6. one kind encodes the gene of 3-Isopropylmalate dehydrogenase A described in claim 1.

7. gene as claimed in claim 6, it is characterised in that the nucleotide sequence of described gene is as shown in SEQ ID No.2.

Gene the most as claimed in claims 6 or 7 is building and can prepare 4-methyl-2-oxygen by living things catalysis 3-isopropylmolic acid For the application in the genetic engineering bacterium of valeric acid.

Apply the most as claimed in claim 8, it is characterised in that described application is: build containing described 3-isopropylmolic acid The recombinant vector of dehydrogenase A gene, converts described recombinant vector in escherichia coli, it is thus achieved that recombination engineering bacteria carry out Inducing culture, culture fluid is isolated and purified, it is thus achieved that containing the somatic cells of 3-Isopropylmalate dehydrogenase A gene.