CN104120112B - Cordyceps sinensis 3-Isopropylmalate dehydrogenase B, encoding gene and application thereof - Google Patents

Abstract

The invention provides a kind of 3 isopropylmalate dehydrogenase B, encoding gene and application thereof preparing 4 methyl 2 oxopentanoic acids from Cordyceps sinensis Hirsutella sinensis participation living things catalysis 3 isopropylmolic acid, described 3 isopropylmalate dehydrogenase B amino acid sequences are as shown in SEQ ID No.1, and encoding gene is as shown in SEQ ID No.1；The clone DNA of nucleotide sequence provided by the present invention can be used to proceed in engineering bacteria by transduction, conversion, the method for Conjugative tiansfer, by regulating the expression of 3 isopropylmalate dehydrogenase 1 B gene, give the high expressed of host 3 isopropylmalate dehydrogenase B, provide effective way for expanding the biologic applications of 3 isopropylmalate dehydrogenase B, there is major application prospect.

Description

Cordyceps sinensis 3-Isopropylmalate dehydrogenase B, encoding gene and application thereof

(1) technical field

The present invention relates to produce the 3-Isopropylmalate dehydrogenase B of bacterium Cordyceps sinensis Hirsutella sinensis from " hundred make " (3-isopropylmalate dehydrogenase), encoding gene and application thereof.

(2) background technology

Cordyceps sinensis (Cordyceps sinensis (Berk.) Sacc.) is that aweto colonizes in Lepidoptera (Lepidoptera) stroma on Hepialidae insect (Hepialus armoricanus Oberthur) larva and larva corpse Complex (including stroma and polypide) on body.Cordyceps sinensis is traditional fungi herb resource that a class is treasured, and has metabolism and produces Thing and the feature of diverse biological activities, show huge application and development prospect at biomedicine field.Cordyceps sinensis is with it Multiple medicinal efficacy is extensive, obvious and receives much concern, and worldwide enjoys high praise.The traditional Chinese medical science is thought, Cordyceps sinensis enters lung kidney Two warps, can tonifying lung cloudy, again can kidney-replenishing, cure mainly and suffer from a deficiency of the kidney, impotence and seminal emission, soreness of waist and knee joint, weak after being ill, chronic cough is weak, phthisical cough Phlegm blood, spontaneous sweating etc., is a kind of Chinese medicine that can balance simultaneously, regulate negative and positive.Modern pharmacology is it has proven convenient that the worm summer in winter Grass has immunological regulation, antibacterial, antitumor, anti-oxidant, anti-aging, reducing blood sugar and blood lipid, gonadotropic Effect etc. are biological widely Activity.

Aweto is a kind of sac fungus, has Conidial Stage (phorozoon) and ascospore in its history of life Stage (epigamous).And in the actual productions such as artificial cultivation, liquid fermentation, use the aweto in imperfect stage, because of And the qualification of Anamorph of Cordyceps Sinensis is extremely important.Chinese scholars is investigated at Cordyceps Resources, phorozoon confirmation, activity become Separate to analyze and do a lot of work with the mechanism of action, exploitation application aspect.Cordyceps sinensis Hirsutella sinensis has proved to be the winter The phorozoon existence form of worm summer grass, has the active component identical with natural cordyceps and drug effect.

But, to the almost blank of the research of 3-Isopropylmalate dehydrogenase B in Cordyceps sinensis Hirsutella sinensis, and 3-Isopropylmalate dehydrogenase B living things catalysis 3-isopropylmolic acid in Hirsutella sinensis is prepared 4-methyl-2-oxo The research of the effect of valeric acid.

3-Isopropylmalate dehydrogenase (IPMDH, EC:1.1.1.85) is one in biosynthesis leucine Key enzyme, is a kind of with NAD⁺Or NADP⁺For acceptor, the oxidoreducing enzyme that acts on donor CH-OH group.This Kind of enzyme can be catalyzed following enzymatic reaction: This reaction is actually made up of two steps: That is the product of above-mentioned first step reaction can react spontaneous decarboxylation by second step Produce 4-methyl-2-oxopentanoic acid.

1981, Tanaka et al. was cloned into a 3-from Thermophilic Bacterium Thermus thermophilus HB8 Isopropylmalate dehydrogenase, and with pBR322 as in carrier cloning to Escherichia coli.Carry the large intestine bar of recombinant plasmid The 3-Isopropylmalate dehydrogenase enzyme work of bacterium is 7 times of wild-type strain.

1986, Kazuhiro Hamasawa et al. was cloned into a 3-isopropyl from the gene library of Candida utilis Malate dehydrogenase gene, utilizes plasmid pYKL30 to be cloned in Escherichia coli and saccharomyces cerevisiae.The open reading code of this gene Frame size is 1089bp, encodes 363 amino acid residues.Southern hybridizes confirmation, and this fragment is to obtain from three Candida utilis.

1991, H Kirino et al. was cloned into a 3-from Thermophilic Bacterium Thermus aquaticus YT-1 Isopropylmalate dehydrogenase leuB, and expressed in Escherichia coli, it comprises 1035bp, encodes 344 amino The ORFs of acid residue.Nucleotides sequence with the 3-Isopropylmalate dehydrogenase of Thermophilic Bacteria T.thermophilus HB8 Row have 87.0% homology, and amino acid sequence has 91.3% homology.

1992, MatsEt al. from complementary yeast mutant leu2, be cloned into a 3-isopropyl Malate dehydrogenase gene, the albumen of this one 52kDa size of gene code, it has the chloroplast transit peptides of presumption.? External imported in chloroplaset by protein, concurrently protein cleavage.

2011, Sikdar et al. cloned from the genome of paddy rice and has obtained a 3-Isopropylmalate dehydrogenase base Cause, the opening code-reading frame of this gene can encode 389 amino acid, corresponding to the protein of about 41.2kD.This paddy rice source The amino acid sequence of 3-Isopropylmalate dehydrogenase and plant and the 3-Isopropylmalate dehydrogenase amino acid of bacterial origin Sequence very high homology.

But, current ncbi database is also retrieved at present less than 3-Isopropylmalate dehydrogenase B in Hirsutella sinensis Gene-correlation information.

(3) summary of the invention

The present invention seeks to for present on the not enough and technical issues that need to address, to " hundred makes " production bacterium winter worm Summer grass Hirsutella sinensis 3-Isopropylmalate dehydrogenase B prepares 4-methyl-2-oxo at living things catalysis 3-isopropylmolic acid Valeric acid is furtherd investigate, it is provided that " hundred make " produces a kind of 3-isopropylmolic acid dehydrogenation of bacterium Cordyceps sinensis Hirsutella sinensis Enzyme B, encoding gene and application thereof.

The technical solution used in the present invention is:

The present invention provides a kind of and prepares 4-from Cordyceps sinensis Hirsutella sinensis participation living things catalysis 3-isopropylmolic acid The 3-Isopropylmalate dehydrogenase B of methyl-2-oxopentanoic acid, its amino acid sequence (is designated as isoB as shown in SEQ ID No.1 Albumen).

SEQ ID No.1 sequence is as follows: MATVQSDLFK PAKFGGKYTV TLIPGDGIGA EVAESVKTVF KADNVPVEWE QIAVSGLDEA GSGRTDEAFR ESVASLKRNK LGLKGILHTP ISRSGHQSFN VAMRQELDIY ASISLIKNMP GYETRHRGVD LCIIRENTEG EYSGLEHQSV PGVVESLKII TRAKSERIAR FAFAFALANG RQKVTCIHKA NIMKLADGLF RNTFHAVAKE YPTLEVNDMI VDNASMQAVS RPQQFDVMVM PNLYGGILSN IGAALVGGPG IVPGCNRARD MPVFEPACRH VGLDIKGKDQ ANPTAMVLSG SMLLRHLGLD DPANRISKAM Y*

Due to the particularity of amino acid sequence, any containing the sheet of the peptide albumen of amino acid sequence shown in SEQ ID NO.1 Section or its variant, such as its examples of conservative variations, bioactive fragment or derivative, if the fragment of this peptide albumen or peptide protein variant With aforementioned amino acid sequences homology more than 90%, belong to the row of scope.Concrete described change can be wrapped Include amino acid whose disappearance in amino acid sequence, insert or replace；Wherein, the conservative for variant changes, the amino replaced Acid has the structure similar to original acid or chemical property, and as replaced isoleucine with leucine, variant also can have non-guarantor Keep and sexually revise, as replaced glycine with tryptophan.

The invention still further relates to described 3-Isopropylmalate dehydrogenase B and prepare 4-at living things catalysis 3-isopropylmolic acid Application in methyl-2-oxopentanoic acid.Right through the catalysis acquisition of 3-Isopropylmalate dehydrogenase B by 3-isopropylmolic acid The path answering 4-methyl-2-oxopentanoic acid is as follows:

Specifically, described 3-Isopropylmalate dehydrogenase B prepares 4-methyl-2-oxygen at living things catalysis 3-isopropylmolic acid For the application in valeric acid it is: obtain through Fiber differentiation with the 3-Isopropylmalate dehydrogenase B recombination engineering containing Cordyceps sinensis Wet thallus phosphate buffer (50mM, pH8.0) suspends, and after ultrasonication, is centrifuged by broken mixed liquor, takes supernatant for urging Agent, with 3-isopropylmalate aqueous acid as substrate, with cozymase (i.e. NADH) as cosubstrate, in the natural Tris-of pH In HCl buffer solution, 37 DEG C, react under the conditions of 150rpm, after reaction terminates, reactant liquor is centrifuged, take supernatant i.e. obtain containing The mixed liquor of 4-methyl-2-oxopentanoic acid, i.e. obtains 4-methyl-2-oxopentanoic acid by isolated and purified for mixed liquor；Described separation is pure The method changed is known in the art operation, generally uses affinity chromatography method；Described mixed liquor uses high performance liquid chromatography detection Product in mixed liquor, flowing phase: V (acetonitrile): V [pH3.0 (0.86%) phosphoric acid triethylamine]=55:45, wavelength 237nm, column temperature: 25 DEG C, flow 1mL/min；Sampling volume: 20uL, solvent: acetonitrile, chromatographic column: Diamonsul250mm × 4.6mm C18 post, Instrument: Shimadzu LC-20AT high performance liquid chromatograph.

The preparation method of described catalyst is: is inoculated in by the recombination engineering containing 3-Isopropylmalate dehydrogenase B and contains Have in the LB fluid nutrient medium of Kan resistance (final concentration 50 μ g/ml), 37 DEG C, 250r/min overnight incubation.Take 1mL culture, will Its switching (volumetric concentration inoculum concentration is 2%) in 50mL contains the LB fluid nutrient medium of Kan resistance (final concentration 50 μ g/ml), 37 DEG C, 250r/min cultivate to cell concentration OD600 and be about 0.6～about 0.8, in culture, add finite concentration (the denseest Degree 0.05mmol/L) IPTG Fiber differentiation 8h, collect wet thallus, by wet thallus under the conditions of power 40%, broken 1s stop 1s super Sound crushes 3 times, each 5min, takes clasmatosis mixed liquor and is centrifuged, takes supernatant and be catalyst.

One unit of enzyme activity (U) is defined as: 3-Isopropylmalate dehydrogenase B is under the conditions of 37 DEG C, and 1min is catalyzed 3- Isopropylmolic acid generates the enzyme amount needed for the 4-methyl-2-oxopentanoic acid of 1 μm ol.

The concentration of described substrate 3-isopropylmalate aqueous acid is 0.1M, and the initial concentration of described substrate is 0.02M, institute The volumetric usage stating catalyst is calculated as 10g/L (final concentration) with wet thallus quality before ultrasonication, described cozymase final concentration of 0.01g/L。

The invention still further relates to encode the gene of described 3-Isopropylmalate dehydrogenase B.Concrete, the nucleosides of described gene Acid sequence (is designated as isoB gene, isoB gene code isoB albumen) as shown in SEQ ID No.2.

Due to the particularity of nucleotide sequence, the variant of polynucleotides shown in any SEQ ID NO.2, as long as they are many with this Nucleotides has more than 90% homology, belongs to the row of scope.The variant of described polynucleotides refers to one There is the polynucleotide sequence that one or more nucleotides changes.The variant of these polynucleotides can make raw displacement variant or The variant of non-life, including replacing variant, Deletion variants and insertion variant.As known in the art, allelic variant Being the alternative forms of polynucleotides, it is probably the replacement of polynucleotides, lacks or insert, but will not be from substantially Change the function of the peptide albumen of its coding.

Described coding 3-Isopropylmalate dehydrogenase 1 B gene can living things catalysis 3-isopropylmolic acid system at structure Application in the genetic engineering bacterium of standby 4-methyl-2-oxopentanoic acid, to expand the application of 3-Isopropylmalate dehydrogenase B, tool Body is: build the recombinant vector containing described 3-Isopropylmalate dehydrogenase 1 B gene, converts described recombinant vector to large intestine In bacillus (preferably E.coli BL21 (DE3)), it is thus achieved that recombination engineering bacteria carry out Fiber differentiation, nutrient solution is isolated and purified Obtain the somatic cells containing 3-Isopropylmalate dehydrogenase 1 B gene.

The present invention is characterized by and provides shown in the amino acid sequence shown in SEQ ID NO.1 and SEQ ID NO.2 Nucleotide sequence, in the case of this amino acid sequence known and nucleotide sequence, this amino acid sequence and nucleotide sequence Obtain, and the acquisition of relevant carriers, host cell, the most all it is apparent from.

Can provide during the bacterial strain of Cordyceps sinensis 3-Isopropylmalate dehydrogenase B of the present invention and encoding gene thereof is State is compiled in China typical culture collection center, preservation by hair spore (Hirsutella sinensis) L0106, this culture presevation Number it is CCTCC No:M2011278, patent CN102373190A the most previously applied for discloses.

The beneficial effects are mainly as follows: the present invention from principle to 3-Isopropylmalate dehydrogenase B in The process that 4-methyl-2-oxopentanoic acid is prepared by living things catalysis 3-isopropylmolic acid in hair spore by state studies in detail, and carries " hundred make " has been supplied to produce 3-Isopropylmalate dehydrogenase B and encoding gene, the present invention of bacterium Cordyceps sinensis Hirsutella sinensis The clone DNA of the nucleotide sequence provided can be used to proceed in engineering bacteria by transduction, conversion, the method for Conjugative tiansfer, By regulating the expression of proteolytic enzyme gene, give the high expressed of host 3-Isopropylmalate dehydrogenase B, for expanding 3- The biologic applications of isopropylmalate dehydrogenase B provides effective way, has major application prospect.

(4) accompanying drawing explanation

Fig. 1 is the denaturing formaldehyde gel electrophoretogram that " hundred make " produces bacterium Cordyceps sinensis Hirsutella sinensis total serum IgE；

Fig. 2 is the catalytic process annotated map at leucine metabolic pathway and 3-Isopropylmalate dehydrogenase place；

Fig. 3 is 3-Isopropylmalate dehydrogenase 1 B gene pcr amplification product gel electrophoresis figure；

Fig. 4 is cloning vector pMD18-T Vector and expression vector pET-28a physical map；

Fig. 5 is restructuring cloned plasmids pMD18-T/isoB physical map；

Fig. 6 is recombinant expression plasmid pET-28a/isoB building process schematic diagram；

Fig. 7 is recombinant expression plasmid pET-28a/isoB physical map；

Fig. 8 is the SDS-PAGE figure of 3-Isopropylmalate dehydrogenase B albumen.

(5) detailed description of the invention

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in This:

Embodiment 1: " hundred make " produces the cultivation of bacterium Cordyceps sinensis Hirsutella sinensis

Bacterium source: first gather natural cordyceps from Qinghai, and bring it back into Hangzhou and carry out separation screening, obtain L0106 bacterial strain, and through this bacterial strain of strain idenfication be Hirsutella sinensis (Hirsutella sinensis), this culture presevation in State's Type Tissue Collection, deposit number is CCTCC No:M2011278, the patent the most previously applied for CN102373190A discloses.

This bacterial classification is inoculated in inclined-plane, and (this is the liquid formulations before solidification to culture medium prescription, good by following proportions Bevel the most again) be: glucose 2.0% (w/v, 1% represents containing 1g in 100mL culture medium, lower same), corn flour 1.0%, murphy juice 0.5%, dextrin 0.5%, dusty yeast 0.5%, wheat bran 1.0%, dried silkworm chrysalis meal 2.0%, peptone 1.0%, sulphur Acid magnesium 0.05%, potassium dihydrogen phosphate 0.05%, agar powder 1.0%, surplus is water；Cultivate 25 days at 12～16 DEG C；Then by bacterium Planting and be inoculated in fermentation medium, culture medium prescription is glucose 1.0%, molasses 1.0%, dried silkworm chrysalis meal 0.5%, soybean cake powder 1.0%, yeast extract 0.5%, magnesium sulfate 0.01%, potassium dihydrogen phosphate 0.02%, surplus is water；Be placed on shaking table, temperature 12～ 16 DEG C cultivate 25 days, cultivate terminate after aseptically, carry out separation of solid and liquid, and solid be placed in sterilized equipment, standby.

Embodiment 2: " hundred make " produces the extraction of bacterium Cordyceps sinensis Hirsutella sinensis total serum IgE

With TRIzol reagent extract total serum IgE, step particularly as follows:

1) liquid nitrogen grinding: take the new fresh thalli of 1g and put in mortar, repeatedly adds liquid nitrogen and is fully ground to powder, be dispensed into In the 1.5mL centrifuge tube of precooling, add 1mL TRIzol reagent, mixing, stand 5min on ice, make nucleic acid-protein compound complete Separate.

2) RNA separates: add 0.2mL chloroform, firmly concussion mixing 15s, stands 2～3min on ice, 4 DEG C, 12000rpm Centrifugal 15min, layering, take upper strata aqueous phase, about 600 μ L.

3) RNA precipitate: add 500 μ L isopropanols, stands 10min on ice, 4 DEG C, 12000rpm be centrifuged 10min, abandon Clearly.

4) RNA washing: add 1mL75% (v/v) ethanol, precipitation is hanged, stand 10min on ice, 4 DEG C, 7500rpm from Heart 15min；Repeat washing step above, then wash one time.

5) dissolve RNA: be placed in by centrifuge tube and open wide dry 5～10min on ice, add appropriate DEPC water and dissolve.

Embodiment 3: " hundred make " produces the order-checking of bacterium Cordyceps sinensis Hirsutella sinensis RNA sample

After extracting sample total serum IgE, with the enrichment with magnetic bead mRNA with Oligo (dT).Add fragmentation MRNA is broken into short-movie section (200～700bp) by buffer, with mRNA as template, with hexabasic base random primer (random Hexamers) synthesis Article 1 cDNA chain, then synthesis Article 2 cDNA chain, then purify also through QiaQuick PCR kit Do end reparation after adding EB buffer solution elution, add polyA and connect sequence measuring joints, then carry out sheet with agarose gel electrophoresis Duan great little selects, and finally carries out PCR amplification, and the sequencing library Illumina GA IIx built up checks order.Order-checking obtains Raw image data is converted into sequence data through base calling, i.e. raw data or raw reads.Remove primitive sequencer Containing only the reads of adaptor sequence in reads, standby with subsequent analysis.

Embodiment 4: " hundred make " produces bacterium Cordyceps sinensis Hirsutella sinensis RNA short reading sequence assembling

Use short reads composite software SOAPdenovo (Li, Zhu et al.De novo assembly of human genomes with massively parallel short read sequencing[J].Genome Res,2010,20: 265-272.) do transcript profile and from the beginning assemble.First the reads with certain length overlap is linked to be longer by SOAPdenovo The Contig fragment without N.Then Contig is returned in reads comparison, determined from same by paired-end reads Distance between the different Contig and these Contig of transcript, these Contig are connected together by SOAPdenovo, in Between unknown nucleotide sequence N represent, thus obtain Scaffold.Further with paired-end reads, Scaffold is mended Hole processes, and finally obtains containing N minimum, the Unigene sequence that two ends can not extend again.Finally, by Unigene sequence and albumen number Do blastx comparison (evalue < 0.00001) according to storehouse nr, Swiss-Prot, KEGG and COG, take the albumen that comparison result is best Determine the sequence direction of Unigene.If the comparison result between different sink is contradictory, then press nr, Swiss-Prot, KEGG and The priority of COG determines the sequence direction of Unigene, with above four storehouses all to the Unigene software ESTScan being less than (Iseli,Jongeneel et al.ESTScan:a program for detecting,evaluating,and reconstructing potential coding regions in EST sequences[J].In Proceedings of9th International Conference on Intelligent Systems for Molecular Biology.AAAIPress, Menlo Park, CA, pp.1999,138-148.) predict its code area and determine the side of sequence To.For can determine that the Unigene in sequence direction provides its sequence from 5' to 3' direction, for sequence direction cannot be determined Unigene provides the sequence that composite software obtains.

Embodiment 5: " hundred make " produces bacterium Cordyceps sinensis Hirsutella sinensis Unigene functional annotation

Functional annotation information provides the protein function annotation of Unigene, Pathway annotation, COG functional annotation and Gene Ontology (GO) functional annotation.First, by blastx by Unigene sequence alignment to albumen database nr, Swiss- Prot, KEGG and COG (evalue < 0.00001), obtain with given Unigene has the albumen of highest serial similitude, thus Obtain the protein function annotation information of this Unigene.The Pathway of Unigene can be obtained further according to KEGG annotation information Annotation.Unigene and COG database is compared, it was predicted that it is also done function statistic of classification by function that Unigene is possible. According to nr annotation information, use Blast2GO software (Conesa, Gotz et al.Blast2GO:a universal tool for annotation,visualization and analysis in functional genomics research[J] .Bioinformatics, 2005,21 (18): 3674-3676.) obtain the GO annotation information of Unigene.Obtain each After the GO annotation of Unigene, with WEGO software (Ye, Fang et al.WEGO:a web tool for plotting GO Annotations [J] .Nucleic Acids Research, 2006,34:293-297.) all Unigene are done GO function Statistic of classification, from the gene function distribution characteristics macroscopically recognizing these species.

Embodiment 6: leucine metabolic pathway and the analysis of 3-Isopropylmalate dehydrogenase B effect

Fig. 2 is leucine metabolic pathway and the catalytic step at 3-Isopropylmalate dehydrogenase B place and process annotated map, First, pyruvic acid synthesizes (S)-2-acetolactic acid under the catalytic action of acetolactate synthase, then at keto-alcohol acid reduction isomery Synthesize 3-hydroxyl-3 methyl-2-Oxobutyric acid under the effect of enzyme, after 5 step catalytic reactions, generate (2R, 3S)-3-isopropyl apple Tartaric acid, generates 4-methyl-2-oxopentanoic acid under the catalytic action of 3-Isopropylmalate dehydrogenase B, finally takes off at leucine Under the effect of hydrogen enzyme, catalysis generates L-Leu.3-is detected different from the order-checking of Hirsutella sinensis transcript profile and annotation information The Unigene of propyl group malic dehydrogenase B.By the ORF Finder software on-line checking in NCBI, have found this gene ORFs (SEQ ID No.2) and obtained corresponding protein sequence (SEQ ID No.1).

Embodiment 7: " hundred make " produces bacterium Cordyceps sinensis Hirsutella sinensis 3-Isopropylmalate dehydrogenase 1 B gene primer and set Meter

Use each gene open proofreading dna sequences Design that GENE RUNNER primer-design software obtains according to prediction Primer, is used for cloning " hundred make " and produces bacterium Hirsutella sinensis anabolism leucic 3-Isopropylmalate dehydrogenase 1 B gene, Primer is synthesized by Sani bio tech ltd, Shanghai, and primer sequence is listed below:

IsoB gene: forward primer 5 ' AGAGAATTCATGGCGACGGTGCAGTCGGA3 '

Reverse primer 5 ' ATAGCGGCCGCTTAGTACATGGCCTTGGAG3 '

IsoB mrna length is 966bp.

Embodiment 8: " hundred make " produces the preparation of bacterium Cordyceps sinensis Hirsutella sinensis cDNA the first chain

After the method first provided according to embodiment 1 turns out sutella sinensis fermented mycelium, carried according still further to embodiment 2 The method of confession carries out the extraction of total serum IgE to Hirsutella sinensis, carries out " hundred make " production bacterium Cordyceps sinensis by following after obtaining total serum IgE The synthesis of Hirsutella sinensis cDNA the first chain, for follow-up each gene cloning experimentation.

Use PrimeScript1st Strand cDNA Synthesis Kit kit (TaKaRa) from Total RNA Middle reverse transcription synthesis cDNA the first chain, experimental procedure is as follows:

1) in Microtube pipe, following mixed liquor is prepared.

2) sex change, annealing operation are conducive to the specific annealing of the sex change of template ribonucleic acid and reverse transcription primer and template, can Improving reverse transcription reaction efficiency, so carrying out sex change, annealing reaction in PCR instrument, condition setting is as follows:

65 DEG C, 5min

3) after annealing terminates, the centrifugal several seconds makes the mixed liquor of template ribonucleic acid/primer etc. be gathered in bottom Microtube pipe.

4) in above-mentioned Microtube pipe, following inverse transcription reaction liquid is prepared.

5) in PCR instrument, reverse transcription reaction is carried out by following condition.

42 DEG C 15～30min

70℃ 15min

Ordinary circumstance, has a PolyA structure at eukaryote mRNA 3 ' end, the quantity of A base ten to hundreds of Individual, utilize this structure can utilize Oligo (dT) primer, under the effect of reverse transcriptase, with mRNA as templated synthesis CDNA the first chain, the present invention uses sequence (the PrimeScript1st Strand in the dT region developed alone by TaKaRa CDNA Synthesis Kit provides) it is primer, if the mRNA integrality obtained is preferable, then can by process of reverse-transcription To obtain cDNA first chain of all zymoprotein encoding genes in species.Embodiment 9: " hundred make " produces bacterium Cordyceps sinensis China quilt The detection of clone, expression and the protein vigor of hair spore 3-Isopropylmalate dehydrogenase 1 B gene

1, the PCR amplification of 3-Isopropylmalate dehydrogenase 1 B gene

CDNA the first chain obtained in embodiment 8 is as template, with the 3-isopropylmolic acid dehydrogenation of synthesis in embodiment 7 Enzyme 1 B gene primer: 5 ' AGAGAATTCATGGCGACGGTGCAGTCGGA3 ' and 5 ' ATAGCGGCCGCTTAGTACATGGCCTTGGAG3 ' carries out Pfu archaeal dna polymerase pcr amplification reaction, and condition setting is as follows:

Pfu pcr amplification reaction system:

Pfu DNA Ploymerase PCR amplification condition:

2,3-Isopropylmalate dehydrogenase 1 B gene PCR primer detected through gel electrophoresis

Concrete detection method is:

1) it is made to be uniformly dissolved the Ago-Gel microwave-oven-heating of prepare 0.9%；

2) take 15mL gel, when gel is cooled to about 50 DEG C, add 1 μ L dyeing liquor Gold view, after mixing Pour on treatments of Electrophoretic Slab Gels, after removing bubble, insert point sample comb；

3) after gel sets, careful take out point sample comb, offset plate is put in electrophoresis tank (loading wells one end is near electrophoresis tank Negative pole), electrophoresis tank adds TAE electrophoretic buffer；

4) take 5 μ L sample (pcr amplification product that i.e. step 1 obtains), be subsequently adding 6 × Loading Buffer1.5 μ L And ddH₂Using liquid-transfering gun loading after O4 μ L mixing, applied sample amount is 10 μ L；

5) connecting the power line between electrophoresis tank and electrophoresis apparatus, the most red, negative pole is black；

6) power-on, starts electrophoresis, and ceiling voltage is less than 5V/cm；

7) electrophoresis can be terminated when sample ran the 2/3 of offset plate；

8) after cutting off the electricity supply, gel is taken out, put in gel imaging instrument and observe, take pictures.

Transcript profile checks order, it was predicted that the size of 3-Isopropylmalate dehydrogenase 1 B gene is 966bp, agarose gel electrophoresis Result shows that Successful amplification has gone out 3-Isopropylmalate dehydrogenase 1 B gene, and size is about 1000bp.Fig. 3 is that " hundred make " is raw Produce bacterium Hirsutella sinensis 3-Isopropylmalate dehydrogenase B functional gene PCR primer gel electrophoresis figure.

3, base A that adds of 3-Isopropylmalate dehydrogenase 1 B gene PCR primer processes and purifies

Owing to Pfu archaeal dna polymerase PCR primer end is flush end, thus also need to carry out to add after glue reclaims the process of base A, The most just can be used for carrier T to connect.It is as follows that glue recovery product adds base A system:

In PCR instrument, 72 DEG C add A base 20min, finally purify with AxyPrep PCR cleaning agents box.

4,3-Isopropylmalate dehydrogenase 1 B gene and the connection of cloning vector

Cloning vector pMD18-T Vector is purchased from TaKaRa company (TaKaRa code D101A), and its physical map is shown in Fig. 4, is connected step 3 3-Isopropylmalate dehydrogenase 1 B gene after purification with cloning vector, construction recombination plasmid pMD18- T/isoB, physical map is shown in that Fig. 5, linked system and condition of contact are as follows.

Linked system:

Condition of contact: 16 DEG C, 16h；Inactivation: 65 DEG C, 15min.

5, the conversion of 3-Isopropylmalate dehydrogenase B recombinant plasmid pMD18-T/isoB

Recombinant plasmid pMD18-T/isoB is proceeded in E. coli JM109, build and carry 3-isopropylmalate The recombinant bacterium E.coli JM109/pMD18-T/isoB of acidohydrogenase 1 B gene, concretely comprises the following steps: 1) by 10 μ L reaction systems (i.e. The connection product that step 4 obtains) go in competent cell E.coli JM109, ice bath 30min；2) thermal shock: 42 DEG C, 90s；3) Ice bath: 2～3min；4) 800 μ L LB fluid nutrient mediums are added, 37 DEG C, 250rpm, 1h；5) coating LB flat board (containing Amp resistance, Final concentration 50 μ g/ml)；6) 37 DEG C of incubator overnight incubation.

LB fluid nutrient medium forms: tryptone 10g/L, yeast extract 5g/L, sodium chloride 5g/L, solvent is water, pH Natural；LB flat board is LB fluid nutrient medium+final concentration 15g/L agar.

6, the screening of 3-Isopropylmalate dehydrogenase B E.coli JM109/pMD18-T/isoB positive recombinant bacterium

Bacterium colony PCR can extract genomic DNA, and the DNA exposed after being directly pyrolyzed with thalline carries out PCR expansion for template Increasing, whether the method is easy and simple to handle, quick, can be the positive bacterium colony containing purpose plasmid with Rapid identification bacterium colony, is converting mirror In Ding relatively conventional.In experiment, the single bacterium colony being inoculated in fluid nutrient medium correspondence is carried out bacterium colony PCR, to verify whether to turn Enter genes of interest.First, add in the 1.5mL centrifuge tube containing 50 μ L sterilized waters with toothpick picking list bacterium colony, boiling water bath 30min, Being then centrifuged for, using supernatant as template, carry out PCR amplification, PCR program setting is that Taq enzyme expands general procedure.Finally use The agarose gel electrophoresis detection bacterium colony PCR primer of 0.9%.

7, the order-checking of 3-Isopropylmalate dehydrogenase B recombinant plasmid pMD18-T/isoB

The positive recombinant bacterium LB fluid nutrient medium that bacterium colony PCR is detected, 37 DEG C, after 150rpm overnight incubation, take 4mL bacterium Liquid extracts plasmid, and method presses the operating instruction that AxyPrep DNA small volume of reagent box provides.Order-checking is by Shanghai Sani's biology section Skill Co., Ltd completes.Through sequence verification, sequence SEQ ID No.2 has recombinated to pMD18-T/isoB.

8, the structure of 3-Isopropylmalate dehydrogenase B recombinant expression plasmid pET-28a/isoB

Test according to foreign gene in the principle of expression in escherichia coli, and expression vector pET-28a and 3-isopropyl Malic dehydrogenase 1 B gene restriction enzyme site comparison situation, it is determined that isoB EcoR I/Not I double enzyme site, and big to restructuring Enterobacteria E.coli JM109/pMD18-T/isoB carries out the cultivation of liquid LB test tube shaker, recombinant plasmid extracts.

The recombinant plasmid pMD18-T/isoB and expression vector pET-28a of 3-Isopropylmalate dehydrogenase 1 B gene is respectively It is digested process 6h with EcoR I/Not I restriction enzyme respectively at 37 DEG C, is digested system as follows:

EcoR I/Not I double digestion system:

After being digested end, 65 DEG C of inactivation 15min, the most respectively with Axygen DNA gel reclaim kit carry out reclaiming, Purify.

3-Isopropylmalate dehydrogenase 1 B gene and expression vector pET-28a are through double digestion, use T4 ligase the most again 16 DEG C connect overnight, build recombinant expression plasmid pET-28a/isoB, and its building process is shown in Fig. 6, and it is recombinant expressed that structure obtains Fig. 7 is shown in by plasmid pET-28a/isoB collection of illustrative plates.Linked system composition is as follows:

Linked system:

9, the conversion of 3-Isopropylmalate dehydrogenase B recombinant expression plasmid and the screening of positive monoclonal

The expression plasmid that builds is heat-shock transformed to E.coli BL21 (DE3) Host Strains, it is then applied to containing card On the LB flat board of that mycin (Kan) resistance (final concentration 50 μ g/ml), 37 DEG C of overnight incubation.Random picking individual colonies from flat board, Carry out PCR amplification with the 3-Isopropylmalate dehydrogenase 1 B gene primer of synthesis in step 7, select positive colony.

10, the abduction delivering of 3-Isopropylmalate dehydrogenase B recombinant bacterium

The monoclonal being accredited as the positive is inoculated in the LB fluid nutrient medium that 5mL contains Kan resistance (final concentration 50 μ g/ml) In, 37 DEG C, 250r/min overnight incubation.Take 1mL culture, transferred and contain Kan resistance (final concentration 50 μ g/ml) in 50mL LB fluid nutrient medium in, 37 DEG C, 250r/min cultivates to cell concentration OD600 and be about 0.6～about 0.8.In culture It is separately added into the IPTG Fiber differentiation 8h of finite concentration (final concentration 0.05mmol/L).Collect thalline to live for electrophoretic analysis and enzyme Detection.

11,3-Isopropylmalate dehydrogenase B recombinant bacterium expression product SDS-PAGE analyzes

To proceed to E.coli BL21 (DE3) bacterium of empty carrier and not add the recombinant bacterium of derivant IPTG as comparison.Mirror It is set to the recombinant bacterium of the positive after IPTG Fiber differentiation 7h, takes 0.5mL Induced cultures, centrifugal, collect thalline, be resuspended in 50 μ L In distilled water, add 50 μ L sample-loading buffers, boil 10min after mixing, carry out SDS-PAGE electrophoretic analysis, " A " swimming in Fig. 8 Road is the SDS-PAGE figure of e. coli bl21 (DE3) ghost, and " B " swimming lane is recombinant bacterium E.coli BL21 (DE3)/pET- 28a adds the SDS-PAGE figure after IPTG induction, and " C " swimming lane is that recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB does not adds The comparison SDS-PAGE figure of IPTG, " D " swimming lane is recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB abduction delivering SDS-PAGE schemes.Show in recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB containing 3-Isopropylmalate dehydrogenase B (through its amino acid sequence of sequence verification as shown in SEQ ID No.1).

12, the protein vigor detection of 3-Isopropylmalate dehydrogenase B recombinant bacterium

Prepared by enzyme liquid: weigh recombinant bacterium E.coli BL21 (DE3)/pET-28a/isoB2g that step 10 is collected, use phosphoric acid Salt buffer (50mM, pH8.0) 100mL suspends, high pressure cracker (model FS-600, Shanghai Sheng Xi ultrasonic instrument Co., Ltd) 3 times (35Kpa) is crushed under the conditions of power 40%, broken 1s stop 1s, each 5min, it is centrifuged off thalline, collects supernatant and get final product To crude enzyme liquid 84.2ml.

3-Isopropylmalate dehydrogenase B transformation system: prepare a clean 50mL and convert bottle, be separately added into E.coli The 3-isopropylmalate aqueous acid 1mL of BL21 (DE3)/pET-28a/isoB crude enzyme liquid 2mL, 0.1M, Tris-HCl buffer solution (pH7.0) the cozymase 1mL of 1mL and 0.05g/L.37 DEG C, react 1h under the conditions of 150rpm, after reaction terminates, by reactant liquor from The heart, takes the content of supernatant detection 4-methyl-2-oxopentanoic acid.

The content of high performance liquid chromatography detection product 4-methyl-2-oxopentanoic acid, flowing phase: V (acetonitrile): V [pH3.0 (0.86%) phosphoric acid triethylamine]=55:45, wavelength 237nm, column temperature: 25 DEG C, flow 1mL/min；Sampling volume: 20uL, molten Agent: acetonitrile, chromatographic column: Diamonsul250mm × 4.6mm C18 post, instrument: Shimadzu LC-20AT high performance liquid chromatograph.

One unit of enzyme activity (U) is defined as: 3-Isopropylmalate dehydrogenase B is under the conditions of 37 DEG C, and 1min is catalyzed 3- Isopropylmolic acid generates the enzyme amount needed for the 4-methyl-2-oxopentanoic acid of 1 μm ol.

The blank that detection 3-Isopropylmalate dehydrogenase B enzyme is lived is to boil the crude enzyme liquid of inactivation after 20min to substitute Enzyme liquid.It addition, after also have detected E.coli BL21 (DE3) and E.coli BL21 (DE3)/pET-28a induction under similarity condition The vigor of crude enzyme liquid, be all not detected by 3-Isopropylmalate dehydrogenase B enzyme and live.

Utilizing Coomassie Brilliant Blue to record the protein content in 3-Isopropylmalate dehydrogenase B crude enzyme liquid is 0.285mg/ ML, by Bandscan software, is analyzed the crude enzyme liquid band content in SDS-PAGE, 3-Isopropylmalate dehydrogenase B accounts for the 16.5% of total protein, thus the 3-Isopropylmalate dehydrogenase B participating in catalytic reaction be 0.285mg/mL × 2mL × 0.165=0.094mg.Living according to enzyme and define, the maximum specific enzyme activity of 3-Isopropylmalate dehydrogenase B is: 81.4 μm ol/ (0.094mg × 60min)=14.4 μm o1/mg/min=14.4U/mg.Therefore, above-mentioned 3-Isopropylmalate dehydrogenase B weight The maximum specific enzyme activity of group 3-Isopropylmalate dehydrogenase B expressed by bacterium is 25.8U/mg, and the conversion ratio of above-mentioned reaction is 81.4%.Specific enzyme activity computing formula is: the Tot Prot of specific enzyme activity=enzyme work/enzyme.Conversion ratio computing formula is: conversion ratio= (initial concentration-equilibrium concentration)/initial concentration.

Claims (9)

1. a Cordyceps sinensis 3-Isopropylmalate dehydrogenase B, it is characterised in that the amino acid sequence of described dehydrogenase B is such as Shown in SEQ ID No.1.

2. Cordyceps sinensis 3-Isopropylmalate dehydrogenase B as claimed in claim 1 is at living things catalysis 3-isopropylmolic acid Prepare the application in 4-methyl-2-oxopentanoic acid.

Apply the most as claimed in claim 2, it is characterised in that described application is: with Cordyceps sinensis isopropylmolic acid Han 3- The wet thallus pH8.0 phosphate buffer that dehydrogenase B recombination engineering obtains through Fiber differentiation suspends, after ultrasonication, and will Broken mixed liquor is centrifuged, and taking supernatant is catalyst, with 3-isopropylmalate aqueous acid as substrate, with cozymase for the auxiliary end Thing, in Tris-HCl buffer solution, 37 DEG C, react under the conditions of 150rpm, after reaction terminates, is centrifuged reactant liquor, takes supernatant I.e. obtain the mixed liquor containing 4-methyl-2-oxopentanoic acid, mixed liquor is isolated and purified, it is thus achieved that 4-methyl-2-oxopentanoic acid.

Apply the most as claimed in claim 3, it is characterised in that: described substrate 3-isopropylmolic acid concentration of aqueous solution is 0.1M, in described reaction system, the initial concentration of substrate is 0.02M, and the volumetric usage of described catalyst is with bacterium wet before ultrasonication Weight is calculated as 0.01g/L, the final concentration of 10g/L of described cozymase.

Apply the most as claimed in claim 3, it is characterised in that described catalyst is prepared as follows: 3-isopropyl apple will be contained The recombination engineering of tartaric acid dehydrogenase B is inoculated in the LB fluid nutrient medium of the Kan resistance containing final concentration 50 μ g/ml, 37 DEG C, 250r/min overnight incubation, takes culture, transfers in resisting containing final concentration 50 μ g/ml Kan with the inoculum concentration of volumetric concentration 2% Property LB fluid nutrient medium in, 37 DEG C, 250r/min cultivate to cell concentration OD600 be 0.6～0.8, in culture add The IPTG Fiber differentiation 8h of final concentration 0.05mmol/L, collects wet thallus, by wet thallus under the conditions of power 40%, broken 1s stop 1s Ultrasonication, takes clasmatosis mixed liquor and is centrifuged, take supernatant and be catalyst.

6. one kind encodes the gene of 3-Isopropylmalate dehydrogenase B described in claim 1.

7. gene as claimed in claim 6, it is characterised in that the nucleotide sequence of described gene is as shown in SEQ ID No.2.

Gene the most as claimed in claims 6 or 7 is building and can prepare 4-methyl-2-oxygen by living things catalysis 3-isopropylmolic acid For the application in the genetic engineering bacterium of valeric acid.

Apply the most as claimed in claim 8, it is characterised in that described application is: build containing described 3-isopropylmolic acid The recombinant vector of dehydrogenase 1 B gene, converts described recombinant vector in Escherichia coli, it is thus achieved that recombination engineering bacteria carry out Fiber differentiation, the isolated and purified acquisition of nutrient solution contains the somatic cells of 3-Isopropylmalate dehydrogenase 1 B gene.