CN104593362B - DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof - Google Patents
DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof Download PDFInfo
- Publication number
- CN104593362B CN104593362B CN201510007643.3A CN201510007643A CN104593362B CN 104593362 B CN104593362 B CN 104593362B CN 201510007643 A CN201510007643 A CN 201510007643A CN 104593362 B CN104593362 B CN 104593362B
- Authority
- CN
- China
- Prior art keywords
- host cell
- miclo
- nucleotide sequence
- grain
- oil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a DNA sequence for encoding myrmecia incisa caleosin (MiClo). The DNA sequence is a nucleotide sequence (a) as shown in the SEQ ID NO.1 or SEQ ID NO.2 or a nucleotide sequence (b) which is complementary to the nucleotide sequence (a). The invention further provides a recombinant expression vector with the nucleotide sequence, a genetically engineered host cell and application of the genetically engineered host cell. According to the invention the full-length cDNA sequence and the full-length DNA sequence of the gene of the MiClo are selected and obtained, and the fusion expression of the gene with an eYFP (enhanced yellow fluorescent protein) in a eukaryotic model organism yeast strain BY4741 shows that the protein encoded by the gene is really positioned on the oil body of a yeast cell, and MiClo encoded by the gene can be anchored on the oil body accurately to fulfill the function of keeping the structure of the oil body intact.
Description
Technical field
The present invention relates to gene engineering technology field, specifically, is related to a kind of coding and incises edge chlorella caleosin protein
(MiClo) DNA sequence and its application.
Background technology
The energy is the basis of human social development.The whole world is faced with energy crisis at present, and petroleum resources are in short supply, and
Recyclability makes the exploitation of bioenergy increasingly be paid close attention to by society.Microalgae biodiesel with its do not strive with people grain, not with
The unique advantage that grain strives ground, do not strive material with poultry has attracted the concern of more and more researchers.Make to improve various oil plants
The oil production of thing, oil body (oil body, OB) and oil-body-associated proteins (protein associated oil bodies) by
Gradually become the recent studies on target of Plant Biotechnology.The ability of different types of microalgae accumulation oil droplet is different, its green algae, diatom
Fat content Deng eucaryon microalgae is higher, promises to be the production algae kind of biodiesel.Edge is incised used in experiment
Chlorella (Myrmecia incisa Reisigl H4301) is a kind of unicellular microalgae of fresh water, is subordinate to Chlorophyta
(Chlorophyta).The algae can accumulate triacylglycerol (TAG) in a large number, and especially under the conditions of nitrogen stress, these TAG are wrapped in half
In unit membrane in the form of oil droplet in cell, it is potential microalgae biodiesel algae kind.
The oil body of cell is also referred to as liposome (lipid body, LB) or fat drips (lipid droplet, LD), and they will be
The following growth of cell provides stored carbon source and energy.Intracellular oil body is in order to avoid melting with plasma membrane and intercellular membrane
Close, oil-body-associated proteins are inlayed in its half unit membrane.Research shows, the caleosin protein in these oil-body-associated proteins
(caleosin) funguses or unicellular alga are primarily present in, and oleosin (oleosin) is primarily present in higher plant
In.For example the plant such as mosses, cycad is also using caleosin protein to some rudimentary plants rather than oleosin is used as them
Main oil-body-associated proteins.This shows that caleosin protein has the conservative function of maintaining oil body structure integrity.Plant is particularly
Oil body in its seed can be used to the protein for expressing high added value or carry hydrophobic medicine, by oil-body-associated proteins
The glucuronic acid enzyme (GUS) with biological activity, xylanase and hirudin etc. can be successfully produced out.Additionally, vegetable oils
Associated proteins can also by with the foreign protein or peptide fusion being of high nutritive value, improve seed nutritional labeling, improve kind
Son is edible and the quality as feedstuff, plays at the aspect such as high crop yield and genetic engineering safety and acts on.
The content of the invention
The purpose of the present invention is for deficiency of the prior art, there is provided a kind of detached DNA sequence.
Another purpose of the present invention is to provide the purposes of above-mentioned detached DNA sequence.
Another purpose of the present invention is to provide a kind of expression recombinant vector.
Fourth object of the present invention is to provide the purposes of above-mentioned recombinant expression carrier.
5th purpose of the present invention is to provide a kind of genetically engineered host cell.
6th purpose of the present invention is to provide the purposes of the host cell of said gene through engineering approaches.
For achieving the above object, the present invention is adopted the technical scheme that：
A kind of detached DNA sequence, described DNA sequence is：
A) nucleotide sequence described in SEQ ID NO.1 or SEQ ID NO.2；Or
The nucleotide sequence of the nucleotide sequence complementary described in b) and a).
To realize above-mentioned second purpose, the present invention is adopted the technical scheme that：
The stability or increase grain of DNA sequence as above oil body in coding caleosin protein, enhancing grain and oil crop
Application in the grease yield of oily crop.
To realize above-mentioned 3rd purpose, the present invention is adopted the technical scheme that：
A kind of recombinant expression carrier, described carrier are constructed with plasmid or virus by nucleotide sequence as above
Recombinant expression carrier.
Preferably, described plasmid is pYES2 plasmids.
To realize above-mentioned 4th purpose, the present invention is adopted the technical scheme that：
The recombinant expression carrier as above stability of oil body or increasing in coding caleosin protein, enhancing grain and oil crop
Plus the application in the grease yield of grain and oil crop.
To realize above-mentioned 5th purpose, the present invention is adopted the technical scheme that：
A kind of genetically engineered host cell, described host cell are selected from one of the following：
A) host cell for being converted with nucleotide sequence as above or being transduceed and its progeny cell；
B) host cell for being converted with recombinant expression carrier as above or being transduceed and its progeny cell.
Described host cell is the offspring of bacterial cell, fungal cell, or these host cells.
Preferably, described host cell is yeast cells.
To realize above-mentioned 6th purpose, the present invention is adopted the technical scheme that：
The stability or increase grain of host cell as above oil body in coding caleosin protein, enhancing grain and oil crop
Application in the grease yield of oily crop.
The invention provides incising edge chlorella caleosin protein (MiClo) gene order and carrying out Function Identification to which.Should
Gene is the structural protein that specificity is anchored to oil body surface, and in grain and oil crop, overexpression can strengthen the stability of oil body, because
And crossing for oil body can be caused to accumulate to increase grease yield.
The invention has the advantages that：
1st, the present invention filters out one with known oil body calcium egg based on the high-throughout sequencing data of edge chlorella transcript profile is incised
White gene has the fragment of a long 810bp of very high similarity.Primer is designed based on the fragment sequence and utilizes cDNA ends fast
Speed amplification (RACE) technology is cloned into the full length cDNA sequence of the gene, determines that the gene is caleosin protein by homologous comparison
This is named as MiClo, and further obtains the DNA full length sequences of MiClo by gene family.
2nd, the present invention by eucaryon model organism yeast BY4741 bacterial strains with enhancement mode yellow fluorescence protein (eYFP)
The experiment of the amalgamation and expression gene, i.e. gene overexpression, it is found that the gene coded protein is positively located on the oil body of yeast cells,
So as to the albumen for confirming MiClo coded by said gene can be anchored on oil body exactly, with maintenance oil body structure integrity
Function.
Description of the drawings
Accompanying drawing 1 is the gene structure display for incising edge chlorella MiClo, and in figure, grey lines are non-translated region, and black line is
Intron, black box are exon.
Accompanying drawing 2 is the fluorescence picture of yeast cells, is followed successively by yeast strain BY4741 from top to bottom, turns to carry eYFP carriers
The BY4741 bacterial strains of pY-eYFP, turn the BY4741 bacterium of the eYFP fusion expression vector pY-MiClo-eYFP of carrying genes of interest
Strain.Bright is light field figure, and Yellow is the yellow fluorescence protein signal graph of eYFP transmittings, and Red is to send out after Nile Red are dyeed
The red fluorescent figure penetrated, Merged are the stacking chart of above three width figures.
Accompanying drawing 3 is pMD19T Vector maps.
Accompanying drawing 4 is pYES2 Vector maps.
Specific embodiment
Below in conjunction with the accompanying drawings the specific embodiment that the present invention is provided is elaborated.
The present invention technology path be：
1) temperature be 25 DEG C, intensity of illumination be 115 μm of ol photons m-2s-1Under conditions of, in BG-11 culture medium
Edge chlorella is incised in middle culture.Frustule is collected, and extracts genomic DNA and RNA.
2) incising certainly screening in edge chlorella transcript profile sequencing data and obtaining one has very high with known caleosin protein gene
The fragment of the long 810bp of similarity, based on the fragment sequence, obtains the cDNA sequence of caleosin protein gene using RACE technologies
Total length, we are named as MiClo.Then, using incise edge chlorella RNA reverse transcriptions cDNA be masterplate to MiClo's
CDNA full length sequences carry out the sequence verification.
3) primer is designed according to the cDNA sequence of MiClo total lengths, enters performing PCR expansion as masterplate by the use of edge chlorella DNA is incised
Increase, obtain the DNA full length sequences of MiClo.
4) cDNA full length sequences and eYFP (the enhanced yellow fluorescent according to MiClo
Protein, enhancement mode yellow fluorescence protein) primers, using PCR build pMD19T/MiClo and pMD19T/
EYFP plasmids.
5) double digestion (EcoRI/XbaI) is carried out to pYES2 carriers and pMD19T/eYFP plasmids, purpose fragment is reclaimed, then
Obtain carrying the recombinant expression carrier pY-eYFP of eYFP with the connection of T4 ligases.
6) double digestion (HindIII/EcoRI) is then carried out to pY-eYFP carriers and pMD19T/MiClo plasmids, mesh is reclaimed
Fragment, then obtain carrying the recombinant vector pY-MiClo-eYFP of genes of interest and eYFP amalgamation and expressions with the connection of T4 ligases.
7) respectively by recombinant vector pY-eYFP and pY-MiClo-eYFP electroporation apparatuss electric shocking method transformed yeast BY4741,
Using synthetic medium (SC-U) the screening transformant of uracil-deficient, screening obtains transgenic yeast pY-eYFP and pY-
MiClo-eYFP。
8) genes of interest will be turned, will turn the yeast of empty carrier (only carrying the pYES2 carriers of eYFP) and non-transgenic
BY4741 is inoculated in SC culture medium, collects yeast after culture 72h.
9) yeast strain and transgenic yeast are carried out carefully using oil body specific fluorescence dye Nile red (Nile Red)
Born of the same parents dye, and are found using confocal laser scanning microscope：Yellow fluorescence is in disperse shape in the yeast cells for turn pY-eYFP；
And in yeast cells of the genes of interest MiClo with eYFP fusion expression vectors are turned, the red fluorescence of yellow fluorescence and dye oil body
Overlap.The result demonstrates the albumen coded by MiClo and is positioned on oil body, with the function of maintaining oil body structure integrity.
Embodiment
1st, experiment material
1) edge chlorella (Myrmecia incisa Reisigl H4301) is incised purchased from Prague, CZE Charles university algae
Class Culture Center (CAUP).Temperature be 25 DEG C, intensity of illumination be 115 μm of ol photons m-2·s-1, light dark ratio is 12h/
Cultivate under conditions of 12h, culture medium is BG-11, purchased from Shanghai Hu Yu bio tech ltd.
2) pMD19T carriers (Vector map is shown in Fig. 3), pYES2 carriers (Vector map is shown in Fig. 4) are public purchased from Invitrogen
Department.Yeast defect strain BY4741 (Mata his3 Δ leu2 Δ met15 Δ ura3 Δs) is purchased from German EUROSCARF.Yeast is connect
Plant in SC culture medium, with 200 revs/min of (rpm) speed oscillation cultures at 30 DEG C.SC culture medium is purchased from the enzyme-linked biological section in Shanghai
Skill company limited.
2nd, experimental technique
1) the fresh edge chlorella cells of incising of 100mg are taken to be placed in the mortar of pre-cooling, adds liquid nitrogen to be fully ground.
2) CTAB methods (cetyl trimethylammonium bromide method) are utilized respectively and TRIzol methods extracts the genome of frustule
DNA and total serum IgE, -20 DEG C save backup.
3) one and Auxenochlorella are screened in edge chlorella transcript profile high-flux sequence data base is incised
The caleosin protein code sequence of this chlorellas of protothecoides shows the long 810bp fragments of 81% similarity
(Contig2882_5), according to its primers, using the SMART of Clontech companiesTMRACEcDNA amplification kits
Enter performing PCR amplification.5 '-RACE Cai Yong Testis formulas PCR, the PCR reaction conditions of the first round are：94 DEG C of degeneration 30s, 68 DEG C of annealing 30s
And 72 DEG C extension 2min, 20 circulation, primer be GSP1 (AGCACAGTTCTGTTGGCACTGGGTTTG, SEQ ID NO.3) and
UPM in test kit；Second wheel PCR reactions take 1.5 μ L first round PCR primers directly as the second wheel reaction template, react bar
Part is 94 DEG C of degeneration 30s, 1min and 72 DEG C of extension 2min of 70 DEG C of annealing, and totally 30 circulate, and primer is GSP2
NUPM in (TCTGGGTATTCCCGTGTCACTGTCTTG, SEQ ID NO.4) and test kit.3 '-RACE reaction conditions are same
The condition of the wheel PCR reactions of 5 '-RACE second, primer is GSP (CTTTGTGCCTGAGAAGTTTGAGGAGAT, SEQ ID NO.5)
And UPM.PMD19T carriers are connected to after PCR primer is carried out glue reclaim, bacillus coli DH 5 alpha competent cell, blue white macula is converted
Screening, picking positive colony, bacterium colony PCR checkings, bacterium solution are sent to the sequencing of Shanghai Sheng Gong biological engineering company limited.Sequencing is obtained
5 '-and 3 '-fragment spliced with known sequence fragment, obtain encode MiClo genes full length cDNA sequence.
4) the cDNA full length sequences design primer of MiClo is obtained according to RACE technologies：Forward primer F1：
CGCCTACTCAAACCG(SEQ ID NO.6)；Downstream primer R1：CCCTGCCTAGTCCAAA (SEQ ID NO.7), enters performing PCR
Amplification.PCR response procedures are 94 DEG C of denaturations 5min, and 35 circulate comprising 94 DEG C of degeneration 30s, 57 DEG C of annealing 45s, 72 DEG C of extensions
2min, last 72 DEG C of extensions 10min.Carry out according to the method described above glue reclaim, TA clone, bacterium colony PCR checking after, bacterium solution is sent to
Hai Shenggong biological engineering company limited is sequenced, it was demonstrated that incise the cDNA full length sequences (SEQ IDNO.1) of edge chlorella MiClo.
5) using MiClo full length cDNA sequences checking primer (i.e. F1 and R1) of above-mentioned design, to incise edge chlorella DNA it is
Masterplate enters performing PCR amplification.Amplification condition is 94 DEG C of denaturations 5min, 35 circulations comprising 94 DEG C of degeneration 45s, 60 DEG C of annealing 45s,
72 DEG C of extension 2min, last 72 DEG C of extensions 10min.PCR primer Jing glue reclaims, TA clones and bacterium colony PCR checkings as stated above
Afterwards, the sequencing of Hai Sheng works bio-engineering corporation is served, obtains incising the DNA full length sequences (SEQ ID NO.2) of edge chlorella MiClo.
6) primer with HindIII and EcoRI restriction enzyme sites is designed according to the cDNA full length sequences of MiClo：
Forward primer YF1 (SEQ ID NO.8)：AagcttATGTTGTGCAAGCTGCAAGG, wherein lower case are
HindIII restriction enzyme sites；
Downstream primer YR1 (SEQ ID NO.9)：GaattcGCGCCTGCCCCCCTT, wherein lower case are EcoRI enzymes
Enzyme site.
The primer with EcoRI and XbaI enzyme cutting site according to eYFP sequential designs：
Forward primer YF2 (SEQ ID NO.10)：GaattcATGGTGAGCAAGGG, wherein lower case are EcoRI enzymes
Enzyme site；
Downstream primer YR2 (SEQ ID NO.11)：TctagaTTTACTTGTACAGCTCG, wherein lower case are XbaI
Restriction enzyme site.
Using the above-mentioned primer respectively containing HindIII/EcoRI and EcoRI/XbaI restriction enzyme sites, built using PCR
PMD19T/MiClo and pMD19T/eYFP plasmids.Ex Taq buffer of the pcr amplification reaction system of 25 μ L comprising 2.5 μ L, 2 μ
The Mg of the dNTP of L, 2 μ L2+, the cDNA masterplates of 2 μ L, the primer of 1 μ L, the Ex Taq enzymes of 0.25 μ L and 14.5 μ L sterilized water.Amplification
Condition is 94 DEG C of denaturations 5min, 35 circulations comprising 94 DEG C of degeneration 45s, 64 DEG C of (eYFP annealing temperatures are 60 DEG C) annealing 45s,
72 DEG C of extension 2min, last 72 DEG C of extensions 10min.Jing glue reclaims, TA are cloned PCR primer as stated above, serve the raw work life in sea
Thing engineering company is sequenced to guarantee the accuracy of sequence.
7) the extracting pMD19T/MiClo and pMD19T/eYFP plasmids from bacillus coli DH 5 alpha.Use restricted enzyme
EcoRI and XbaI carries out double digested reaction to pMD19T/eYFP, while it is double that EcoRI/XbaI is also carried out to pYES2 plasmids
Digestions reaction.Reaction system is 10 × M buffer of 4 μ L, the 0.1%BSA of 4 μ L, DNA about 2 μ g, XbaI and EcoRI each 1
μ L, plus without RNase water to 20 μ L.37 DEG C of digestion reaction 4h.The purpose fragment after enzyme action is reclaimed in rubber tapping, and uses T4DNA ligases
EYFP fragments after enzyme action are connected with pYES2 fragments and obtain recombinant vector pY-eYFP.Coupled reaction system is the slow of 2.5 μ L
Rush liquid, the DNA about 0.3pmol of eYFP, the DNA about 0.03pmol of carrier pYES2, the T of 1 μ L4DNA ligase, plus without RNase water
To 25 μ L.16 DEG C of connections are overnight.Bacillus coli DH 5 alpha competent cell is converted after connection, carries out according to the method described above cloning, bacterium
The PCR that falls is verified and is sequenced.PY-eYFP plasmids are extracted from bacillus coli DH 5 alpha, -20 DEG C save backup.Then with restricted
Enzyme cutting HindIII and EcoRI carries out double digested reaction respectively to pMD19T/MiClo and pY-eYFP plasmids, using with it is upper
State identical method and obtain recombinant vector pY-MiClo-eYFP.
8) prepared by competent yeast cells.By yeast-inoculated in SC culture medium, 30 DEG C of recovery overnight incubations, then by 1:
100 amplification culture, with 200rpm speed oscillations culture to cell density about 1 × 108Cells/mL (about 4～5h).It is cold on ice
But 15min makes cell stop growing, and collects yeast cells, the aseptic washing of pre-cooling with 5000rpm rotating speeds centrifugation 5min under the conditions of 4 DEG C
Cell 3 times is washed, is collected by centrifugation under similarity condition.The 1M sorbitol washes cell of 20mL pre-coolings 1 time, is then dissolved in 0.5mL pre-coolings
1M Sorbitol, adjust the concentration of cell 1 × 1010cells/mL.Cell is preserved on ice, is easy to electric shock to use.
9) shocked by electricity using electroporation apparatuss (Bio-Rad), recombinant vector pY-MiClo-eYFP transformed yeasts BY4741 is experienced
State cell.It is taken at about 5～10 μ L (5～200ng) of DNA and ferment of the recombinant vector pY-MiClo-eYFP to be transformed of pre-cooling on ice
Female competent cell is mixed, and the pre-cooling on ice together with the electric shock cup of 0.2cm, then DNA is transferred to cell mixture pre-
Cold electric shock cup is gently mixed, and after ice bath 5min, option program Sc2 shocks by electricity once, removes electric shock cup, is added immediately 1mL pre-coolings
1M Sorbitol, be gently transferred in new YPD culture medium, 30 DEG C of slight oscillatory 5h coat bacterium solution containing 1M Sorbitol
Uracil-deficient synthetic medium (SC-U) on, 30 DEG C inversion quiescent culture 48-72h, picking colony in liquid SC-U cultivate
Cultivate in base.After bacterium colony PCR checkings, strain is preserved with the SC-U culture medium containing 2% glucose.In addition, in same way as described above
Unloaded pY-eYFP electricity is gone on BY4741.
10) viable yeast is contaminated with oil body specific fluorescent dye Nile Red (Genmed Scientifics Inc.USA)
Color, with laser confocal microscope (Carl Zeiss LSM 710, Germany) observation, takes pictures.Wherein NileRed fluorescent dyes institute
It is 543nm with excitation wavelength, excitation wavelength used by yellow fluorescence protein is 514nm.
3rd, experimental result
1) obtained according to RACE technologies and verified through PCR amplifications, obtain incising the cDNA full length sequences of edge chlorella MiClo
(SEQ ID NO.1)；The long 142bp in its 5 '-untranslated region (UTR), 3 '-non-transcribed head of district 711bp, open the long 840bp of frame frame, the
143-145bp is start codon, and 980-982bp is termination codon, encodes an egg being made up of 279 aminoacid
In vain.Pcr amplification reaction is carried out for masterplate using edge chlorella genomic DNA is incised, product obtains MiClo's Jing after sequence analysis
DNA full length sequences (SEQ ID NO.2)；, there are 4 introns in its overall length 2099bp, the length of these introns from 5 '-end to
3 '-end respectively is 140bp (at 345bp to 484bp), 93bp (at 614bp to 706bp), 94bp (the
At 891bp to 984bp) and 102bp (at 1068bp to 1169bp), so as to the coded sequence of the gene is separated into 5
Individual exon (Fig. 1)；Wherein, 143-145bp is start codon, and 1408-1410bp is termination codon.
2) yeast and transgenic yeast be after galactose inducing culture, using oil body specific fluorescent dye NileRed pair
Its cell is dyeed, and is observed under different excitation wavelengths by laser confocal microscope.In the ferment for turning zero load pY-eYFP
In blast cell, it is found that yellow fluorescence diffuses the whole cell spaces of other than the cores；Turning genes of interest MiClo and eYFP fusion tables
In the yeast for reaching, yellow fluorescence is concentrated mainly on the region (Fig. 2) for specifically being launched red fluorescence by Nile Red.Explanation is melted
EYFP can be concentrated on oil body by the MiClo for closing expression from other intracellular positions, so as to demonstrate MiClo coded by said gene
Albumen can be anchored on oil body exactly, with maintain oil body structure integrity function.
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
Member, on the premise of without departing from the inventive method, can also make some improvement and supplement, and these improve and supplement also should be regarded as
Protection scope of the present invention.
Claims (9)
1. a kind of detached DNA sequence, it is characterised in that described DNA sequence is：
A) nucleotide sequence described in SEQ ID NO.1 or SEQ ID NO.2；Or
The nucleotide sequence of the nucleotide sequence complementary described in b) and a).
2. the stability of oil body or the increase in coding caleosin protein, enhancing grain and oil crop of the DNA sequence described in claim 1
Application in the grease yield of grain and oil crop.
3. a kind of recombinant expression carrier, it is characterised in that described carrier is by the nucleotide sequence and matter described in claim 1
Recombinant expression carrier constructed by grain or virus.
4. recombinant expression carrier according to claim 3, it is characterised in that described plasmid is pYES2 plasmids.
5. oil body is stablized in coding caleosin protein, in strengthening grain and oil crop for recombinant expression carrier described in claim 3 or 4
Property or increase grain and oil crop grease yield in application.
6. a kind of genetically engineered host cell, it is characterised in that the host cell is selected from one of the following：
A) host cell for being converted with the nucleotide sequence described in claim 1 or being transduceed and its progeny cell；
B) host cell for being converted with the recombinant expression carrier described in claim 3 or 4 or being transduceed and its progeny cell.
7. host cell according to claim 6, it is characterised in that described host cell is that bacterial cell, funguses are thin
Born of the same parents, or the offspring of these host cells.
8. host cell according to claim 6, it is characterised in that described host cell is yeast cells.
9. the stability of oil body or the increasing in coding caleosin protein, enhancing grain and oil crop of the host cell described in claim 6
Plus the application in the grease yield of grain and oil crop.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510007643.3A CN104593362B (en) | 2015-01-08 | 2015-01-08 | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510007643.3A CN104593362B (en) | 2015-01-08 | 2015-01-08 | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104593362A CN104593362A (en) | 2015-05-06 |
| CN104593362B true CN104593362B (en) | 2017-05-03 |
Family
ID=53119417
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510007643.3A Active CN104593362B (en) | 2015-01-08 | 2015-01-08 | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104593362B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107556373B (en) * | 2017-10-24 | 2019-08-06 | 上海海洋大学 | Incise the gene order and its application of the main fat drips albumen of edge green alga |
| CN112210520A (en) * | 2019-07-11 | 2021-01-12 | 王峥鉴 | Biocontrol bacterium for expressing yellow-green fluorescent protein and construction method thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100317073A1 (en) * | 2007-12-04 | 2010-12-16 | The Ohio State University Research Foundation | Molecular approaches for the optimization of biofuel production |
| WO2011127118A1 (en) * | 2010-04-06 | 2011-10-13 | Algenetix, Inc. | Methods of producing oil in non-plant organisms |
| WO2012162368A1 (en) * | 2011-05-26 | 2012-11-29 | E. I. Du Pont De Nemours And Company | Expression of caleosin in recombinant oleaginous microorganisms to increase oil content therein |
-
2015
- 2015-01-08 CN CN201510007643.3A patent/CN104593362B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104593362A (en) | 2015-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2016247159B2 (en) | Tailored oils produced from recombinant oleaginous microorganisms | |
| BRPI0811967A2 (en) | oil production in microorganisms | |
| US20140030771A1 (en) | Compositions and methods for increasing oil production and secretion | |
| CN102943081B (en) | Deoxyribose nucleic acid (DNA) sequence for encoding parietchloris incise diacylglycerol acyltransferase and application thereof | |
| US20120088279A1 (en) | Algal lipid production | |
| CN104651236B (en) | It is a kind of to be used to improve transgenosis chlamydomonas, construction method of Chlamydomonas reinhardtii content of fatty acid and application thereof | |
| KR101952470B1 (en) | Filamentous fungi having an altered viscosity phenotype | |
| AU2010224029A1 (en) | Engineering salt tolerance in photosynthetic microorganisms | |
| CN103756985B (en) | Myrmecia incisa Reisigl diacylglycerol acyltransferase gene sequence and use thereof | |
| CN104593362B (en) | DNA sequence for encoding myrmecia incisa caleosin (MiClo) and application thereof | |
| US20230080079A1 (en) | Mutant lipase and use thereof | |
| US8940508B2 (en) | Enhancement of biomass production by disruption of light energy dissipation pathways | |
| CN107556373B (en) | Incise the gene order and its application of the main fat drips albumen of edge green alga | |
| CN104004760B (en) | A kind of expression equipment and its aspergillus oryzae genetic engineering bacterium being used in Aspergillus oryzae cell secreting, expressing foreign protein | |
| WO2021239071A1 (en) | Cultivation method for improving yield of microalgae triacylglycerol (tag) and application thereof | |
| JPWO2020135763A5 (en) | ||
| CN105924512B (en) | One kind GhLPAAT5-like albumen relevant to fat content and its encoding gene and application | |
| CN105274068B (en) | It is a kind of to encode DNA sequence dna and its application for incising 9 fatty acid desaturase of edge green alga Δ | |
| CN113736806A (en) | Gene for improving oil synthesis of marine nannochloropsis and application thereof | |
| CN108588099B (en) | Incise edge green alga Diacrylglycerol acyl transferase (MiDGAT2C) gene order and Function Identification | |
| CN105132391B (en) | A kind of polypeptide of triacylglycerol synthesis capability for improving MiDGAT1 in brewer's yeast and application thereof | |
| CN105602953A (en) | Agaricus-bisporus inducible promoter, expression vector and application of agaricus-bisporus inducible promoter | |
| CN106434512B (en) | A kind of thermophilic esterase and its expression from Aquifex aeolicus bacterial strain | |
| US20230250406A1 (en) | Mutant lipase and use thereof | |
| CN105177027A (en) | Peach fatty acid desaturase gene PpFAD2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |