CN106916815A - A kind of promoter and its application - Google Patents

A kind of promoter and its application Download PDF

Info

Publication number
CN106916815A
CN106916815A CN201611087638.9A CN201611087638A CN106916815A CN 106916815 A CN106916815 A CN 106916815A CN 201611087638 A CN201611087638 A CN 201611087638A CN 106916815 A CN106916815 A CN 106916815A
Authority
CN
China
Prior art keywords
promoter
box
gene
phaeodactylum tricornutum
algae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201611087638.9A
Other languages
Chinese (zh)
Other versions
CN106916815B (en
Inventor
李宏业
邹立功
陈嘉雯
杨维东
刘洁生
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jinan University
Original Assignee
Jinan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jinan University filed Critical Jinan University
Priority to CN201611087638.9A priority Critical patent/CN106916815B/en
Publication of CN106916815A publication Critical patent/CN106916815A/en
Application granted granted Critical
Publication of CN106916815B publication Critical patent/CN106916815B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/405—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6463—Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/649—Biodiesel, i.e. fatty acid alkyl esters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to genetic engineering field, more particularly to a kind of promoter and its application.The present invention clones the promoter of gene Pt48882 from Phaeodactylum tricornutum, and its nucleotide sequence is as shown in SEQ ID NO.1.Promoter PPt48882 of the invention can start downstream gene high efficient expression in the growth cycle of microalgae cell, therefore can be applied in genetic engineering, there is good application prospect in genetic engineering.

Description

A kind of promoter and its application
Technical field
The present invention relates to genetic engineering field, more particularly to a kind of promoter and its application.
Background technology
Currently, worldwide energy shortage and environmental pollution has become the huge challenge that human society is faced, therefore, seek Look for a kind of new renewable and clean energy resource for substituting fossil energy, it has also become the common recognition of countries in the world.Biodiesel (Biodiesel), its performance is substantially suitable with petrifaction diesel, and with the good feature of environmental protection and biological degradability, it has also become it is international Upper preferable regenerative resource most widely used, with fastest developing speed.At present, biodiesel refer to the grease from organism (predominantly Triglycerides) monoalkyl fatty acid ester is formed through ester interchange with alcohols (methyl alcohol or ethanol).
The principle of microalgae biodiesel is that, using the high efficient expression of microalgae grease synthesis related gene, lifting grease contains Amount, the grease in microalgae cell is transformed into using either physically or chemically then extracellular, then refinement processing is carried out, so that Produce biodiesel.Microalgae is the low water plant of photoautotrophy type, and its species is various, is distributed extremely extensive.It has Photosynthetic efficiency is high, and growth is quick, the features such as biomass is big.And fat content is more objective, it has also become prepare biodiesel High-quality natural material, be future biological diesel oil development study hotspot.At present, the energy consumption of microalgae biodiesel and high Cost is the key issue for hindering its industrialization.
Marine diatom is rich in grease, typically constitutes from the 40%-60% of dry cell weight, and SCFA (C14 and C16) is accounted for always 67%-70% of aliphatic acid or so.2008, marine diatom Phaeodactylum tricornutum genome was surveyed, and was diatom biological study Pattern algae.Its fat content is general in 20%-30% or so, is the quality raw materials for preparing biodiesel.By genetic engineering Technological means construct fat content high engineering microalgae be expected to improve biodiesel yield.
At present, the oil-producing Phaeodactylum tricornutum high for being obtained by genetic engineering means, most of is all certain lipid of overexpression What related key gene was obtained.However, the oil-producing effect of the engineering microalgae algae strain of this method acquisition is limited.Currently, In the research of Phaeodactylum tricornutum oil-producing, wide variety of promoter only has one kind, and this hinders microalgae genetic engineering significantly Development.
Promoter is one section of DNA sequence dna positioned at gene 5' ends upstream, can activate RNA polymerase, is allowed to and template DNA It is combined exactly and the specificity with transcription initiation.Promoter is typically made up of core promoter element and upstream element. TATA box positioned at -20~-30bp of transcription initiation site upstream places are core promoter element, are rich in the conservative sequence for having AT Row area, it is relevant with unwinding for DNA (DNA) double-strand, and the selection of transcripting start point is determined, it is most plants Promoter is correctly necessary to expression.The conserved sequence of TATA box upstreams is referred to as promoter upstream element, including upstream -75bp The general upstream promoter element such as GC box near the CAAT box and -80--110bp at place and other special upstream elements. Lot of documents show the species of promoter element, quantity and to each other Hu Shunxu and distance may all influence the transcription of gene with No or transcription degree, the length of different genes its promoters is had nothing in common with each other, and contained Hu element is also had nothing in common with each other, therefore, start The length of son is relevant with the transcription of its promotor gene.
At present, the oil-producing engineering microalgae algae high strain for being obtained by genetic engineering is typically all to use Phaeodactylum tricornutum Endogenous Type Promoter fcp (fucoxanthin, chlorophyll a/c-binding protein, bladder-wrack chlorophyll a/c combination eggs Gene cluster in vain), this promoter has realized the stabilization expression of multiple reporter genes and genes of interest.If however, thinking that expression is more simultaneously Individual lipid key gene, only one of which promoter is inadequate, in animal, while the technology phase of overexpression multiple genes Work as maturation.As long as there is different promoters, just can be while the different gene of overexpression.But, it is only few in Phaeodactylum tricornutum Number promoter is proved and extensive use.
The content of the invention
In view of this, the present invention provides a kind of promoter and its application.The promoter can start downstream gene in triangle High efficient expression in the cell growth cycle of brown algae.
In order to realize foregoing invention purpose, the present invention provides following technical scheme：
The invention provides a kind of promoter, including basic element, peculiar element and induced element；
The peculiar element is selected from 3-AF3binding site, Box 4, Box-W1, P-box, TC-richrepeats, W box；
The basic element is selected from TATA-box or CAAT-box；
The induced element is selected from photoinduction cis-acting elements, photoinduction transcriptional elements, thermal induction element, reaction of Salmon-Saxl core Heart element or plastid PatpB gene promoter core parts.
In some specific embodiments of the invention, photoinduction cis-acting elements described in the promoter for- 10promoter element；The photoinduction transcriptional elements are selected from T-box or GT-1box；The thermal induction element is CCAAT box；The reaction of Salmon-Saxl core parts are SURE；The plastid PatpB gene promoters core parts are Box II.
In some specific embodiments of the invention, the promoter has the nucleotides shown in (I), (II) or (III) In sequence any one：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:Sequence shown in 1 is modified, replace, lack or add what one or several nucleotides were obtained Nucleotide sequence.
In some specific embodiments of the invention, be substituted by described in the promoter substitution 1,2,3,4 It is individual, 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20, 21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36 Individual, 37 or 38 nucleotides.
Starting downstream gene answering in high efficient expression in the micro algae growth cycle present invention also offers the promoter With.
In some specific embodiments of the invention, the microalgae is Phaeodactylum tricornutum；The downstream gene is triangle It is brown to refer to prediction GFP Pt48882.
Phaeodactylum tricornutum of the invention predicts GFP Pt48882, is in the gene group # of GenBank PHATRDRAFT_48882, the present invention clones the upstream region in the predictive coding area of the gene, is named as promoter PPt48882. Its transcriptional expression that can efficiently start reporter gene in the growth cycle of microalgae.Phaeodactylum tricornutum of the invention predicts albumen Gene Pt48882 High-expression promoters are located on No. 19 chromosomes of Phaeodactylum tricornutum, total length 1103bp, on chromosome position It is：568482--569585.
Present invention also offers a kind of expression vector, containing the promoter that the present invention is provided.Preferably, the table Also include Reporter gene GUS up to carrier.This promoter is connected with Reporter gene GUS, is building up to (rich next mould with resistant gene Element) plasmid in, by shock by electricity etc. method, recombinant plasmid is incorporated into the genome of Phaeodactylum tricornutum, only need to verify GUS's Expression is able to verify that the starting efficiency of promoter.
Preferably, the expression vector includes Ori, PPt48882, GUS, TfcpA, Pnr, Ble and Tnr successively.
Present invention also offers a kind of host cell, contain the expression vector.Preferably, the host cell is micro- Algae.Preferably, the host cell is diatom.It is furthermore preferred that the host cell is Phaeodactylum tricornutum.
Present invention also offers the preparation method of the host cell, comprise the following steps：
Step 1：There is the promoter of any one in the nucleotide sequence shown in (I), (II) or (III)：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:Sequence shown in 1 is modified, replace, lack or add what one or several nucleotides were obtained Nucleotide sequence；
Step 2：The DNA molecular that step 1 is obtained is merged with expression vector, recombinant expression carrier is built, place is converted Chief cell.
The application in microalgae in the yield of purpose product is being improved present invention also offers the host cell.
Present invention also offers application of the host cell in biodiesel is produced.
Present invention also offers a kind of method for producing biodiesel, the grease of the host cell provided using the present invention is closed Into the high efficient expression of related gene, fat content is lifted, for producing biodiesel.
Specifically, present invention also offers the preparation method of the host cell, comprising the following steps：
Step 1：There is the promoter of any one in the nucleotide sequence shown in (I), (II) or (III)：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:Sequence shown in 1 is modified, replace, lack or add what one or several nucleotides were obtained Nucleotide sequence；
Step 2：The DNA molecular that step 1 is obtained is merged with expression vector, recombinant expression carrier is built, place is converted Chief cell；
Step 3：Using the high efficient expression of the oil synthesis related gene of the host cell containing recombinant expression carrier, lifting oil Fat content, for producing biodiesel.
The study find that promoter sequence there is no any document report mistake, do not have in public databases such as GenBank yet Any annotation is the promoter of promoter and which kind of feature.The present invention to have found first and identifies the function of the promoter, start Efficiency.The present invention clones the promoter of gene Pt48882 from Phaeodactylum tricornutum：Phaeodactylum tricornutum prediction GFP PPt48882 promoters, the promoter can start downstream gene can efficient table in the cell growth cycle of Phaeodactylum tricornutum Reach, be applied in genetic engineering, the engineering microalgae algae strain of acquisition can significantly improve biomass.Especially improve biological bavin The yield of oil, significantly saves production cost.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing The accompanying drawing to be used needed for having technology description is briefly described.
Fig. 1 shows recombinant vector collection of illustrative plates；
Fig. 2 shows PCR the results, wherein, TC is conversion algae, and WT is wild algae；
Fig. 3 shows conversion algae GUS colored graphs, wherein, 1 is control algae, and 2 is conversion algae；
Fig. 4 shows Phaeodactylum tricornutum stained cells aspect graph, wherein, A is wild algae, and B is conversion algae；
Fig. 5 shows first, fourth, eight days wild algaes and conversion algae GUS Colors, wherein, the 1st, 3,5 is first, fourth, eight days Wild algae, the 2nd, 4,6 is first, fourth, eight days normal condition conversion algaes；
Fig. 6 shows first day RT-PCR analysis result；
Fig. 7 shows the 4th day RT-PCR analysis result；
Fig. 8 shows the 8th day RT-PCR analysis result；
Fig. 9 shows the promoter of present invention offer.
Specific embodiment
The invention discloses a kind of promoter and its application, those skilled in the art can use for reference present disclosure, suitably change Enter technological parameter realization.In particular, all similar replacements and change are for a person skilled in the art aobvious And be clear to, they are considered as being included in the present invention.The method of the present invention and application are carried out by preferred embodiment Description, related personnel can substantially be carried out not departing from present invention, spirit and scope to method described herein and application Change or suitably change with combining and realize and apply the technology of the present invention.
First purpose of the invention is to provide a kind of Phaeodactylum tricornutum gene Pt48882 High-expression promoters.
Described Phaeodactylum tricornutum gene Pt48882 High-expression promoters, it is characterised in that its nucleotide sequence such as SEQ Shown in ID NO.1.
Phaeodactylum tricornutum gene Pt48882 of the invention, is PHATRDRAFT_ in the gene group # of GenBank 48882, the present invention clones the upstream region in the predictive coding area of the gene, is named as promoter PPt48882.It is in microalgae Can efficiently start the transcriptional expression of reporter gene in growth cycle.Phaeodactylum tricornutum Lhcf15 gene high expressions of the invention are opened Mover is located on No. 19 chromosomes of Phaeodactylum tricornutum, total length 1103bp, and position is on chromosome：568482--569585.
By PLACE (A Database of Plant Cis-acting Regulatory DNA Elements) and PLANTCARE forecasting softwares are analyzed to the promoter (1103bp), it is found that the sequence has the basic composition unit of promoter Part TATA-box, CAAT-box, and comprising multiple induced elements, photoinduction cis-acting elements：-10promoter element；Photoinduction transcriptional elements：T-box、GT-1box；Thermal induction element：CCAAT box；Reaction of Salmon-Saxl core parts： SURE；Plastid PatpB gene promoter core parts：Box II.
Wherein, the peculiar element for containing is selected from 3-AF3binding site, Box 4, Box-W1, P-box, TC-rich repeats、W box。
Preferably, peculiar element and its number for containing are as follows：(numeral in bracket is opening that the present invention is provided Contain the number of the peculiar element in mover)：
3-AF3binding site(1)、Box 4(1)、Box-W1(1)、P-box(2)、TC-richrepeats(1)、W box(1)。
This patent is connected this promoter with Reporter gene GUS, is building up to the plasmid with resistant gene (bleomycin) In, by methods such as electric shocks, recombinant plasmid is incorporated into the genome of Phaeodactylum tricornutum, only need to verify that the expression of GUS can Verify the starting efficiency of promoter.
UidA is (also referred to as during wide variety of gus gene is by E. coli bacterial strain K12 in the genetically modified plants at present GusA) locus coding.The GUSB of the gene code, systematic naming method is β-D-glucuronide glucuronosohydrolase(EC 3.2.1.31).The enzyme is a kind of circumscribed hydrolase, can be catalyzed various β-D-Glucose glycosides Acid is hydrolyzed to D-Glucose aldehydic acid and aglycone.Jefferson in 1987 etc. has cloned gus gene and has been surveyed Sequence, thus develops the system as gene fusion marker with gus gene.Due to not existing in the intracellular of most plants Endogenous GUS activity, and gus gene expression product has, and detection method is simple, sensitivity is high, be easy to quantitative and positioning point The advantages of analysing, can be merged with other protein genes so that gus gene turns into recent years should in plant genetic engineering research With one of most commonly used reporter.
The zymolyte for being usually used in GUS Histochemical localizations at present is the chloro- 3- indolyl glucuronides (5- of the bromo- 4- of 5- Bromo-4-chloro-3-indolyl glucuronide, abbreviation X-Gluc).This substrate can be formed in enzyme active sites Blue precipitate.The initial product that GUSB acts on X-Gluc is colourless indole derivatives, through peroxidating two Dimerization acts on forming undissolved 5,5 '-two bromo- 4, the dark indigo color substance of 4 '-dichloro so that the position with GUS activity It is presented blue.
Promoter PPt48882 of the invention is Phaeodactylum tricornutum endogenesis promoter, starts the expression of Lhcf15, therefore, this Invention demonstrates the promoter efficiency after the normal condition in one growth and breeding cycle of Phaeodactylum tricornutum and heat shock.It is utilized respectively GUS stained tissues decoration method and real-time fluorescence PCR (Real-timeqPCR) method detect the efficiency of the promoter.
Real-time qPCR are exactly in PCR amplification procedures, by fluorescence signal, real-time detection to be carried out to PCR processes. Due to the exponential time base expanded in PCR, there is linear relationship in the Ct values of template and the starting copy number of the template, so turning into fixed The foundation of amount.Real-time qPCR are easy to operate due to its, and sensitivity is high, develop the advantages of reproducible very fast.If The every field of life science is being had been directed to, such as the Differential expression analysis of gene, SNP is detected, allele Detection, drug development, clinical diagnosis, transgenic research etc..The result produced to RT-PCR, uses 2 during analysis-CTMethod, i.e., according to Equation below is calculated：
1. average value ± the standard deviation of Δ Ct (genes of interest Ct-internal reference Ct)；
2. average value ± the mark of Δ Δ Ct (genes of interest Δ Ct in genes of interest Δ Ct-reference sample in testing sample) Quasi- deviation；
3. relative expression quantity (2-ΔΔCt) average value ± standard deviation；
Second object of the present invention is to provide a kind of expression vector, it is characterised in that contain above-mentioned Phaeodactylum tricornutum Lhcf15 gene PPt48882 High-expression promoters.
Third object of the present invention is to provide a kind of host cell, it is characterised in that contain above-mentioned expression vector.
Described host cell is preferably Phaeodactylum tricornutum.
Fourth object of the present invention is to provide above-mentioned promoter PPt48882 and is starting downstream gene in Phaeodactylum tricornutum Cell growth cycle in high efficient expression application.
Described microalgae is preferably Phaeodactylum tricornutum.
Described downstream gene is preferably Phaeodactylum tricornutum gene Pt48882.
The study find that promoter sequence there is no any document report mistake, do not have in public databases such as GenBank yet Any annotation is the promoter of promoter and which kind of feature.The present invention to have found first and identifies the function of the promoter, start Efficiency.The present invention clones the promoter of gene Pt48882 from Phaeodactylum tricornutum：Phaeodactylum tricornutum Lhcf15 genes PPt48882 promoters, the promoter can start downstream gene equal energy in the growth cycle of the cell growth of Phaeodactylum tricornutum High efficient expression, therefore can be applied in genetic engineering and have good application prospect in genetic engineering.
Raw materials used and reagent can be bought by market in a kind of promoter of present invention offer and its application.
With reference to embodiment, the present invention is expanded on further：
Embodiment 1：The clone of promoter and gus gene
First, the genomic DNA of Phaeodactylum tricornutum is extracted, is carried out using the plant DNA extraction kit of Magene companies. Primer is synthesized by Shanghai Sheng Gong bioengineering Co., Ltd, is purified through PAGE methods, and 100 μM are diluted to when using.Promoter PPt48882 is cloned in Phaeodactylum tricornutum DNA, and gus gene is in universal support pCAMBIA1301 (in the prompt orchid biotechnology in Shanghai Co., Ltd buys) middle clone.Wherein clone condition use PCR method, using KOD-plus-Neo enzymes (TOYOBO, JAPAN) PCR is obtained, and as shown in table 1, PCR reaction systems are respectively such as table 2 for the PCR primer of promoter PPt48882 and gus gene With shown in table 3, the promoter of Phaeodactylum tricornutum gene Pt48882 does not confirm, the present invention is predicted by multiple forecasting softwares The core parts of PPt48882 promoters, and wherein 1103bp is taken for promoter region, design primer in this region.
Table 1.PCR primers
Table 2.PCR reaction systems (20l)
Table 3.GUS gene PCRs reaction system (20l)
Reaction condition is：Predegeneration：94℃,2min.
By PLACE (A Database of Plant Cis-acting Regulatory DNA Elements) and PLANTCARE forecasting softwares are analyzed to the sequence of above-mentioned clone, it is found that the sequence has the basic element of promoter TATA-box, CAAT-box, and comprising multiple induced elements, photoinduction cis-acting elements：-10promoter element； Photoinduction transcriptional elements：T-box、GT-1box；Thermal induction element：CCAAT box；Reaction of Salmon-Saxl core parts：SURE；Plastid PatpB gene promoter core parts：Box II.The sequence is named as promoter PPt48882.
Embodiment 2：Build recombinant vector
The above-mentioned promoter PPt48882 for cloning, gus gene and fcpA terminators, (277bp gives birth to work by Shanghai Biological Co., Ltd's synthesis) by using ClonExpress MultiS One Step Cloning kits (Vazyme Biotech Co., Ltd, nanjing) method of homologous recombination is connected to the carrier containing blasticidin resistance expression cassette, contains The carrier of blasticidin resistance expression cassette be by pPt-ApCAT carriers (construction step of pPt-ApCAT carriers with reference to Niu etc., 2011) chloramphenicol resistance gene is substituted for bleomycin base by conventional gene engineering means well known to those skilled in the art Because obtaining, the recombinant expression carrier (as shown in Figure 1) containing promoter PPt48882 and gus gene is obtained.The kit of use The one step cloning KIT of Shi Nuoweizan bio tech ltd.
Embodiment 3：Phaeodactylum tricornutum converts and converts the screening of algae
Recombinant vector is incorporated into Phaeodactylum tricornutum genome with reference to the electric-shocking method of Niu etc. (2012).By 4-5 times The screening of bleomycin obtains resistant conversion algae.
Embodiment 4：Convert the checking of algae
The first step, is verified on a molecular scale, and 100ml is converted algae and 100ml wild type Phaeodactylum tricornutums 3000g centrifugations 5min is collected, and 3 times is cleaned with PBS solution and extracts genomic DNA with the plant DNA extraction kit of Magene companies afterwards, is used GUS-F primers (as shown in SEQ ID No.6, F:5 ' ATGTTACGTCCTGTAGAAA 3 ') and GUS-R primers (such as SEQ ID Shown in No.7, R:5 ' TGTTTGCCTCCCTGCTGCGGT 3 ') enter performing PCR, as a result as shown in Fig. 2 the 2nd row are conversion algae, the 1st Row are wild type algaes, and conversion algae has band at general 1.8kb, and wild type algae does not have, it is known that contained GUS bases in conversion algae Cause.
Second step, is verified on apparent, and 100ml is converted algae and 100ml wild type Phaeodactylum tricornutums 3000g centrifugations 5min Collect, algae precipitation GUS 37 DEG C of stained over night of staining kit, then 5000g centrifugations are abandoned supernatant, add 1ml fixer (second Alcohol：Acetic acid=3:1) 30min is eluted, as a result as shown in figure 3,1 is control algae, without color change after dyeing, 2 is conversion algae, dye Blue precipitate is formed after color, it follows that conversion algae can express gus gene.
3rd step, observes from cellular morphology.Conversion algae by GUS dye after, take 10 μ l algae solution be placed in be inverted it is micro- Sem observation cellular morphology, as shown in Figure 4.A does not have colors blue for the frustule of wild type, and B is the conversion whole cell of frustule Levelling au bleu.
Embodiment 5：GUS dyeing checking promoter efficiency
Reporter gene GUS to converting algae carries out apparent checking.Wild type algae and conversion algae are individually positioned in new training Support base in and algae density domination in 1x106Individual/ml, takes the microalgae of first day, the 4th day and the 8th day, the quantity control of microalgae respectively System is in 2.2x108It is individual.Supernatant is abandoned in algae precipitation GUS 37 DEG C of stained over night of staining kit, then 5000g centrifugations, adds 1ml to consolidate Determine liquid (ethanol：Acetic acid=3:1) taken pictures after wash-out 30min.Result is as shown in figure 5, as shown in Figure 5, conversion algae GUS contaminates within first day Color shows that closest to blue-green GUS dyeing in the 4th, the 8th day is blueness, thus it is speculated that reason is, initial in growth of Phaeodactylum tricornutum week The gus gene efficiency that phase starts expression is not high compared to the later stage, logarithmic phase and stationary phase starting efficiency highest.
Embodiment 6：RT-PCR detects promoter efficiency
The present invention carries out fluorescence real-time quantitative analysis to the Reporter gene GUS for converting algae.Wild type algae and conversion algae are placed In new culture medium and algae density domination is in 1x106Individual/ml, takes the microalgae of first day, the 4th day and the 8th day respectively, microalgae Quantity is controlled in 3x108It is individual.3000g is centrifuged 5min, in -80 ° of preservations.Obtained using the plant RNA extraction kit of Omega companies Phaeodactylum tricornutum RNA, the reverse transcription reagent box of TAKARA companies is by RNA reverse transcriptions into cDNA.For the special of gus gene Primers F:5 ' GCCAAAAGCCAGACAGAGTG3 ' (as shown in SEQ ID No.8)；R:5’TGACGACCAAAGCCAGTAAAG 3 ' (as shown in SEQ ID No.9), for real-time quantitative amplification.Fluorescence probe SYBR qPCR Mix used are public purchased from TAKARA Department, experiment testing equipment used is the CFX96Touch of Bio-Rad companies of the U.S.TMFluorescence quantitative PCR detection system.Result is such as Shown in Fig. 6-8.As can be seen here, the promoter can efficiently start destination gene expression within the growth of Phaeodactylum tricornutum cycle, and And can conspicuousness raising destination gene expression.Real-time quantitative PCR result understands that PPt48882 promoters are given birth in Phaeodactylum tricornutum The expression of the efficient promotor gene of energy in growth cycle long.
Embodiment 7
Control group：Beta-tubulin (TUB) promoter；
Experimental group：The promoter PPt48882 that the present invention is provided；
The promoter in control group and experimental group is built into recombinant vector respectively, conversion algae is obtained.Conversion algae places new In culture medium and algae density domination is 1 × 106Individual/ml, takes the microalgae of first day, the 4th day and the 8th day, the number of microalgae respectively Amount control is 3 × 108It is individual.3000g is centrifuged 5min, in -80 DEG C of preservations.Obtained using the plant RNA extraction kit of Omega companies Phaeodactylum tricornutum RNA, the reverse transcription reagent box of TAKARA companies is by RNA reverse transcriptions into cDNA.Used from corresponding primer In real-time quantitative amplification.Fluorescence probe SYBR qPCR Mix used are purchased from TAKARA companies, and experiment testing equipment used is U.S. The CFX96Touch of Bio-Rad companies of stateTMFluorescence quantitative PCR detection system.Real-time quantitative PCR the results are shown in Table 4.
The real-time quantitative PCR result of table 4
Group Control group Experimental group
First day 20.12 162.80**
4th day 50.86 483.66**
8th day 300.80 753.35**
Note：Compared with control group, * shows that P ＜ 0.05, * * show P ＜ 0.01.
As seen from the results in Table 4, at first day, the 4th day and the 8th day, the promoter of experimental group is in growth of Phaeodactylum tricornutum Destination gene expression can efficiently be started in cycle, and can conspicuousness raising destination gene expression.Experimental group and control group Compare, with pole significant difference (P ＜ 0.01).
Embodiment 8
Control group：Beta-tubulin (TUB) promoter；
Experimental group：The promoter PPt48882 that the present invention is provided；
The promoter in control group and experimental group is built into recombinant vector respectively, conversion algae is obtained.
Using the high efficient expression of microalgae grease synthesis related gene obtained in control group and experimental group, fat content is lifted, Then the grease in microalgae cell is transformed into using either physically or chemically extracellular, then refinement processing is carried out, so as to produce Go out biodiesel.Result is as shown in table 5.
The yield of biodiesel of table 5 and cost
Group Control group Experimental group
The yield (%) of biodiesel 10.20 24.70*
Biodiesel fractional yield 1 2.86*
Note：Compared with control group, * shows that P ＜ 0.05, * * show P ＜ 0.01.
As seen from the results in Table 5, the promoter of experimental group starts genes of interest in the growth of Phaeodactylum tricornutum cycle by efficient Expression, the yield of the biodiesel for significantly improving significantly has saved production cost.Experimental group is respectively provided with aobvious compared with control group Write difference (P ＜ 0.05).
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Ji'nan University
<120>A kind of promoter and its application
<130> MP1618582
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 1163
<212> DNA
<213>Artificial sequence
<400> 1
gagtagatca aacgtaaagg agaaataaga gagaatctat ttattacgtc ttcttgatct 60
gagtagatca aacgtaaagg agaaataaga gagaatctat ttattacgtc tctgttgtca 120
gctagtaatc gtatatttat gtgaccaatt tcttgatctt gatgctgcgt tccttcgcgt 180
tcttcggaag tcctcctaac agtgaactcc attcacatgt ccatgttccc tgccttttgt 240
gagctgtcgt atcgtaggtt cgggccacac ctatttacaa ttggcactat ctagccgcta 300
ctagagagag gctttcgcta taagcaatct ccatagaatc ggtatgaatc cctttttcga 360
atcaatgtca taaaatcgta tatttatgtg accaatttct tgatgttgac accgcgttcc 420
tcgcgttctt tggatatcct ttagaatttc attcacaggt caatgtccag tgcattttgt 480
gagctgtcgc aggttcgggt tctacttatt tacagtattg actagccaac cttgaggctt 540
tcgctgcgac cgttttacag caatcagttt tgattatgcg cattctccat taatctggta 600
tgattccctt tttagaatca gtgtcattaa atcgtatgtt catgtgacca atttcttgaa 660
gttgacaccg cgttccttcg cgttcttcgg aaatcctcct gaatccattt tcaaccccaa 720
gttccgtgcc ttttgtgagc tgtcgtaggt tcggctttac ttatttaaag gaagcaatag 780
ccagcttagg ctttcgctgc gactatttca cggcagtcct tatgcttcaa ttgatctagc 840
ttgacagctc gacgcaactg tcgctgaatc ttgatttaca ttagctctca atttcgagtc 900
attagtgaag gtactggtac atcaatagtt aattaagcaa aacaaattcc tttgtattct 960
tactagcttt ccttcaacac attcgtcccc aggatcttct cactggactt attgtcggag 1020
tctatcaaaa atacctgact gtgaatgaca tgactgcgtg cactatattg aagttttcct 1080
tcaactggga tcctgaaaaa gtcacgccac cgtgggaacc atgtatagcc tgatttgccc 1140
aaagccccac agtgaattcg aag 1163
<210> 2
<211> 47
<212> DNA
<213>Artificial sequence
<400> 2
ctggaaagcg ggcagtgaga gtagatcaaa cgtaaaggag aaataag 47
<210> 3
<211> 37
<212> DNA
<213>Artificial sequence
<400> 3
ttgttggtaa ttgttcttcg aattcactgt ggggctt 37
<210> 4
<211> 44
<212> DNA
<213>Artificial sequence
<400> 4
aattacaatc cagtggtacc atgttacgtc ctgtagaaac ccca 44
<210> 5
<211> 39
<212> DNA
<213>Artificial sequence
<400> 5
cgtccttgta gtccaggtgt tgtttgcctc cctgctgcg 39
<210> 6
<211> 19
<212> DNA
<213>Artificial sequence
<400> 6
atgttacgtc ctgtagaaa 19
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence
<400> 7
tgtttgcctc cctgctgcgg t 21
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
gccaaaagcc agacagagtg 20
<210> 9
<211> 21
<212> DNA
<213>Artificial sequence
<400> 9
tgacgaccaa agccagtaaa g 21

Claims (10)

1. a kind of promoter, it is characterised in that including basic element, peculiar element and induced element；
The peculiar element is selected from 3-AF3 binding site, Box 4, Box-W1, P-box, TC-rich repeats, W box；
The basic element is selected from TATA-box or CAAT-box；
The induced element is selected from photoinduction cis-acting elements, photoinduction transcriptional elements, thermal induction element, reaction of Salmon-Saxl core unit Part or plastid PatpB gene promoter core parts.
2. promoter according to claim 1, it is characterised in that the photoinduction cis-acting elements for- 10promoter element；The photoinduction transcriptional elements are selected from T-box or GT-1 box；The thermal induction element is CCAAT box；The reaction of Salmon-Saxl core parts are SURE；The plastid PatpB gene promoters core parts are Box II.
3. promoter according to claim 1 and 2, it is characterised in that it has the nucleosides shown in (I), (II) or (III) In acid sequence any one：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:Sequence shown in 1 is modified, replace, lack or add the nucleosides that one or several nucleotides are obtained Acid sequence.
4. the promoter according to any one of claims 1 to 3, it is characterised in that it is described be substituted by substitution 1,2,3 It is individual, 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20 It is individual, 21,22,23,24,25,26,27,28,29,30,31,32,33,34,35, 36,37 or 38 nucleotides.
5. the promoter according to any one of Claims 1-4 is starting downstream gene efficient table within the micro algae growth cycle Application in reaching.
6. application according to claim 5, it is characterised in that the microalgae is Phaeodactylum tricornutum；The downstream gene is Phaeodactylum tricornutum refers to prediction GFP Pt48882.
7. a kind of expression vector, it is characterised in that contain the promoter as described in any one of Claims 1-4.
8. a kind of host cell, it is characterised in that contain expression vector as claimed in claim 7.
9. host cell according to claim 8 is improving the application in microalgae in the yield of purpose product.
10. a kind of method for producing biodiesel, it is characterised in that using the grease of host cell as claimed in claim 8 The high efficient expression of synthetic gene, lifts fat content, obtains biodiesel.
CN201611087638.9A 2016-11-30 2016-11-30 Promoter and application thereof Active CN106916815B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611087638.9A CN106916815B (en) 2016-11-30 2016-11-30 Promoter and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611087638.9A CN106916815B (en) 2016-11-30 2016-11-30 Promoter and application thereof

Publications (2)

Publication Number Publication Date
CN106916815A true CN106916815A (en) 2017-07-04
CN106916815B CN106916815B (en) 2020-07-21

Family

ID=59454260

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611087638.9A Active CN106916815B (en) 2016-11-30 2016-11-30 Promoter and application thereof

Country Status (1)

Country Link
CN (1) CN106916815B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111826376A (en) * 2020-06-24 2020-10-27 广东工业大学 Plant promoter and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105838715A (en) * 2016-04-26 2016-08-10 暨南大学 Microalgae constitutive expression promoter and application thereof
CN106047873A (en) * 2016-04-26 2016-10-26 暨南大学 A phaeodactylum tricornutum bohlin highly expressed promoter and applications thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105838715A (en) * 2016-04-26 2016-08-10 暨南大学 Microalgae constitutive expression promoter and application thereof
CN106047873A (en) * 2016-04-26 2016-10-26 暨南大学 A phaeodactylum tricornutum bohlin highly expressed promoter and applications thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NCBI: "Phaeodactylum tricornutum CCAP 1055/1 protein fucoxanthin chlorophyll a/c protein(Lhcf15),mRNA;XM_002183345.1", 《NCBI》 *
SCHELLENBERGER COSTA B,ET AL: "Blue light is essential for high light acclimation and photoprotection in the diatom Phaeodactylum tricornutum", 《J EXP BOT》 *
张梦晗: "三角褐指藻遗传转化表达体系的建立", 《中国优秀硕士学位论文全文数据库》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111826376A (en) * 2020-06-24 2020-10-27 广东工业大学 Plant promoter and application thereof
CN111826376B (en) * 2020-06-24 2021-11-26 广东工业大学 Plant promoter and application thereof

Also Published As

Publication number Publication date
CN106916815B (en) 2020-07-21

Similar Documents

Publication Publication Date Title
CN105838715B (en) A kind of microalgae composition type expression promoter and its application
CN106047873B (en) A kind of Phaeodactylum tricornutum High-expression promoter and its application
CN106867967A (en) The LM3 cell lines and its construction method of Midkine stable low-expressions
Cui et al. Cloning and characterization of a novel diacylglycerol acyltransferase from the diatom Phaeodactylum tricornutum
Abel et al. Transient gene expression in protoplasts of Arabidopsis thaliana
CN103834692B (en) A kind of lentiviral vectors for expressing lncRNA and application thereof
CN103756985A (en) Myrmecia incisa Reisigl diacylglycerol acyltransferase gene sequence and use thereof
CN105132423B (en) The promoter and its application that a kind of controlling gene is expressed in secreting type glandular hairs
CN106916815A (en) A kind of promoter and its application
CN106754926A (en) MiRNA and its application for regulating apple spot defoliation resistance
CN103173481A (en) Plasmid vector containing 3&#39;UTR (untranslated regions) sequence of ABCB1 gene and reporter gene as well as construction method and use of plasmid vector
CN108265074A (en) A kind of construction method of endogenetic fungus Efficient Genetic system and its application
CN105969768A (en) KLF7 gene promoter as well as activity and application thereof
CN102191249B (en) Silkworm Bmlp3 gene promoter and use thereof
CN107012143A (en) A kind of promoter and its application
CN107058314A (en) A kind of promoter and its application
CN103820453B (en) A kind of can by the Pif promoter of pteria martensii MSX gene activation and application thereof
CN106834309B (en) DNA sequence and application thereof
CN103173480B (en) Method for screening multidrug resistance related microRNA (ribonucleic acid) by using dual-luciferase report genes
CN113881678B (en) C/EBPZ gene promoter and application thereof
CN106754647B (en) A kind of separation, culture and the identification method of giant salamander skin epidermal cells
CN111100868B (en) Female promotion gene FERR and female inhibition gene FERR-R of populus deltoides and application thereof
CN103589730A (en) ShRNA (short hairpin ribonucleic acid) suppressing IRS1 (insulin receptor substrate 1) gene expression and application
CN106520766A (en) Seaweed endogenesis constructive promoter and application thereof
US5998167A (en) Expression control polynucleotides derived from spliceosomal protein gene promoters

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant