CN107012143A - A kind of promoter and its application - Google Patents
A kind of promoter and its application Download PDFInfo
- Publication number
- CN107012143A CN107012143A CN201611087639.3A CN201611087639A CN107012143A CN 107012143 A CN107012143 A CN 107012143A CN 201611087639 A CN201611087639 A CN 201611087639A CN 107012143 A CN107012143 A CN 107012143A
- Authority
- CN
- China
- Prior art keywords
- promoter
- gene
- box
- present
- phaeodactylum tricornutum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/405—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
- C12P7/6445—Glycerides
- C12P7/6463—Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/34—Vector systems having a special element relevant for transcription being a transcription initiation element
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to genetic engineering field, more particularly to a kind of promoter and its application.The present invention clones gene Pt47667 promoter from Phaeodactylum tricornutum, and its nucleotide sequence is as shown in SEQ ID NO.1.The promoter PPt47667 of the present invention can start downstream gene high efficient expression in microalgae cell growth cycle, therefore can be applied in genetic engineering, there is good application prospect in genetic engineering.
Description
Technical field
The present invention relates to genetic engineering field, more particularly to a kind of promoter and its application.
Background technology
Currently, worldwide energy shortage and environmental pollution have become the huge challenge that human society is faced, and therefore, seek
Look for a kind of new renewable and clean energy resource for substituting fossil energy, it has also become the common recognition of countries in the world.Biodiesel
(Biodiesel), its performance is substantially suitable with petrifaction diesel, and with the good feature of environmental protection and biological degradability, it has also become it is international
Upper preferable regenerative resource most widely used, with fastest developing speed.At present, biodiesel refers to the grease from organism (predominantly
Triglycerides) monoalkyl fatty acid ester is formed through ester interchange with alcohols (methanol or ethanol).
The principle of microalgae biodiesel is the high efficient expression using microalgae grease synthesis related gene, and lifting grease contains
Amount, then the grease in microalgae cell is transformed into using either physically or chemically extracellular, then carries out refinement processing, so that
Produce biodiesel.Microalgae is the low water plant of photoautotrophy type, and its species is various, is distributed extremely extensive.It has
Photosynthetic efficiency is high, and growth is quick, the features such as biomass is big.And fat content is more objective, it has also become prepare biodiesel
High-quality natural material, be future biological diesel oil development study hotspot.At present, the energy consumption of microalgae biodiesel and high
Cost is to hinder the key issue of its industrialization.
Marine diatom is rich in grease, typically constitutes from the 40%-60% of dry cell weight, and short chain fatty acids (C14 and C16) are accounted for always
67%-70% of aliphatic acid or so.2008, marine diatom Phaeodactylum tricornutum genome was surveyed, and was diatom biological study
Pattern algae.Its fat content is general in 20%-30% or so, is the quality raw materials for preparing biodiesel.Pass through genetic engineering
Technological means construct high fat content engineering microalgae be expected to improve biodiesel yield.
At present, the high oil-producing Phaeodactylum tricornutum obtained by genetic engineering means, most of is all to be overexpressed some lipid
What related key gene was obtained.However, the oil-producing effect for the engineering microalgae algae strain that this method is obtained is limited.Currently,
In the research of Phaeodactylum tricornutum oil-producing, wide variety of promoter only has one kind, and this hinders microalgae genetic engineering significantly
Development.
Promoter is one section of DNA sequence dna positioned at gene 5' ends upstream, can activate RNA polymerase, be allowed to and template DNA
It is combined exactly and the specificity with transcription initiation.Promoter is typically made up of core promoter element and upstream element.
It is core promoter element positioned at -20~-30bp of the transcription initiation site upstream TATA box located, is rich in the conservative sequence for having AT
Area is arranged, it is relevant with unwinding for DNA (DNA) double-strand, and the selection of transcripting start point is determined, it is most plants
Promoter is correctly necessary to expression.The conserved sequence of TATA box upstreams is referred to as promoter upstream element, including upstream -75bp
The general upstream promoter element such as GC box near the CAAT box and -80--110bp at place and other special upstream elements.
Lot of documents show the species of promoter element, quantity and to each other Hu Shunxu and apart from may all influence the transcription of gene with
No or transcription degree, the length of its promoter of different genes is had nothing in common with each other, and contained Hu element is also had nothing in common with each other, therefore, is started
The length of son is relevant with the transcription of its promotor gene.
At present, the high oil-producing engineering microalgae algae strain obtained by genetic engineering is typically all to use Phaeodactylum tricornutum Endogenous Type
Promoter fcp (fucoxanthin, chlorophyll a/c-binding protein, bladder-wrack chlorophyll a/c combination eggs
Gene cluster in vain), this promoter has realized the stable expression of multiple reporter genes and target gene.If however, thinking while expression is more
Individual lipid key gene, only one of which promoter is inadequate, in animal, while being overexpressed the technologies of multiple genes phase
Work as maturation.As long as there are different promoters, different genes can be just overexpressed simultaneously.But, it is only few in Phaeodactylum tricornutum
Number promoter is proved and extensive use.
The content of the invention
In order to realize foregoing invention purpose, the present invention provides following technical scheme：
The invention provides a kind of promoter, including basic element, peculiar element and induced element；
The peculiar original paper is selected from A-box, ABRE, ACE, GAG-motif, HSE, TATCCAT/C-motif, WUN-
Motif or as1；
The basic element is selected from TATA-box or CAAT-box；
The induced element is selected from photoinduction cis-acting elements, photoinduction transcriptional elements, thermal induction element, reaction of Salmon-Saxl core
Heart element or plastid PatpB gene promoter core parts.
The present invention some specific embodiments in, photoinduction cis-acting elements described in the promoter for-
10promoter element；The photoinduction transcriptional elements are selected from T-box or GT-1box；The thermal induction element is CCAAT
box；The reaction of Salmon-Saxl core parts are SURE；The plastid PatpB gene promoters core parts are Box II.
In some specific embodiments of the present invention, the promoter has the nucleotides shown in (I), (II) or (III)
Any one in sequence：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:What sequence shown in 1 was obtained through modifying, replacing, lack or adding one or several nucleotides
Nucleotide sequence.
The present invention some specific embodiments in, be substituted by described in the promoter substitution 1,2,3,4
It is individual, 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,
21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36
Individual, 37 or 38 nucleotides.
Starting downstream gene answering in high efficient expression within the micro algae growth cycle present invention also offers the promoter
With.
In some specific embodiments of the present invention, the microalgae is Phaeodactylum tricornutum；The downstream gene is triangle
It is brown to refer to prediction GFP Pt47667.
The Phaeodactylum tricornutum prediction albumen Pt47667 genes of the present invention, be in GenBank gene group #
PHATRDRAFT_47667, the present invention clones the upstream region in the predictive coding area of the gene, is named as promoter PPt47667.
It can efficiently start the transcriptional expression of reporter gene in the growth cycle of microalgae.The Phaeodactylum tricornutum prediction albumen of the present invention
Gene Pt47667 High-expression promoters are located on No. 14 chromosomes of Phaeodactylum tricornutum, total length 847bp, and position is on chromosome：
471390--473573。
Present invention also offers a kind of expression vector, the promoter provided containing the present invention.Preferably, the table
Also include Reporter gene GUS up to carrier.This promoter is connected with Reporter gene GUS, is building up to (rich next mould with resistant gene
Element) plasmid in, by shock by electricity etc. method, recombinant plasmid is incorporated into the genome of Phaeodactylum tricornutum, only need to verify GUS's
Expression is able to verify that the starting efficiency of promoter.
Preferably, the expression vector includes Ori, PPt47667, GUS, TfcpA, Pnr, Ble and Tnr successively.
Present invention also offers a kind of host cell, contain the expression vector.Preferably, the host cell is micro-
Algae.It is preferred that, the host cell is diatom.It is furthermore preferred that the host cell is Phaeodactylum tricornutum.
Present invention also offers the preparation method of the host cell, comprise the following steps：
Step 1：There is the promoter of any one in the nucleotide sequence shown in (I), (II) or (III)：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:What sequence shown in 1 was obtained through modifying, replacing, lack or adding one or several nucleotides
Nucleotide sequence；
Step 2：The DNA molecular that step 1 is obtained is merged with expression vector, builds recombinant expression carrier, converts place
Chief cell.
The application in microalgae in the yield of purpose product is being improved present invention also offers the host cell.
Present invention also offers application of the host cell in production biodiesel.
Present invention also offers a kind of method for producing biodiesel, the grease of the host cell provided using the present invention is closed
Into the high efficient expression of related gene, fat content is lifted, for producing biodiesel.
Specifically, present invention also offers the preparation method of the host cell, comprising the following steps：
Step 1：There is the promoter of any one in the nucleotide sequence shown in (I), (II) or (III)：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:What sequence shown in 1 was obtained through modifying, replacing, lack or adding one or several nucleotides
Nucleotide sequence；
Step 2：The DNA molecular that step 1 is obtained is merged with expression vector, builds recombinant expression carrier, converts place
Chief cell；
Step 3：Utilize the high efficient expression of the oil synthesis related gene of the host cell containing recombinant expression carrier, lifting oil
Fat content, for producing biodiesel.
The study find that promoter sequence there is no any document report mistake, do not have in public databases such as GenBank yet
Any annotation is the promoter of promoter and which kind of feature.The present invention is to find and identify the function of the promoter first, start
Efficiency.The present invention clones the promoter of Pt47667 genes from Phaeodactylum tricornutum：Phaeodactylum tricornutum prediction GFP
PPt47667 promoters, the promoter can start downstream gene can efficient table in the cell growth cycle of Phaeodactylum tricornutum
Reach, be applied in genetic engineering, the engineering microalgae algae strain of acquisition can significantly improve raising biomass.Especially improve life
The yield of thing diesel oil, significantly saves production cost.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
There is the accompanying drawing used required in technology description to be briefly described.
Fig. 1 shows recombinant vector collection of illustrative plates；
Fig. 2 shows PCR the results, wherein, TC is conversion algae, and WT is wild algae；
Fig. 3 shows conversion algae GUS colored graphs, wherein, 1 is control algae, and 2 be conversion algae；
Fig. 4 shows Phaeodactylum tricornutum stained cells aspect graph, wherein, A is wild algae, and B is conversion algae；
Fig. 5 shows first, fourth, eight days wild algaes and conversion algae GUS Colors, wherein, the 1st, 3,5 be first, fourth, eight days
Wild algae, the 2nd, 4,6 be first, fourth, eight days normal condition conversion algaes；
Fig. 6 shows first day RT-PCR analysis result；
Fig. 7 shows the 4th day RT-PCR analysis result；
Fig. 8 shows the 8th day RT-PCR analysis result；
Fig. 9 shows the promoter that the present invention is provided.
Embodiment
The invention discloses a kind of promoter and its application, those skilled in the art can use for reference present disclosure, suitably change
Enter technological parameter realization.In particular, all similar replacements and change be aobvious for a person skilled in the art
And be clear to, they are considered as being included in the present invention.The method of the present invention and application are carried out by preferred embodiment
Description, related personnel can substantially not depart from present invention, method described herein and application carried out in spirit and scope
Change or suitably change with combining, to realize and apply the technology of the present invention.
First purpose of the present invention is to provide a kind of Phaeodactylum tricornutum prediction GFP Pt47667 height expression and started
Son.
Described Phaeodactylum tricornutum prediction GFP Pt47667 High-expression promoters, it is characterised in that its nucleotides sequence
Row are as shown in SEQ ID NO.1.
The Phaeodactylum tricornutum prediction albumen Pt47667 genes of the present invention, be in GenBank gene group #
PHATRDRAFT_47667, the present invention clones the upstream region in the predictive coding area of the gene, is named as promoter PPt47667.
It can efficiently start the transcriptional expression of reporter gene in the growth cycle of microalgae.The Phaeodactylum tricornutum prediction albumen of the present invention
Gene Pt47667 High-expression promoters are located on No. 14 chromosomes of Phaeodactylum tricornutum, total length 847bp, and position is on chromosome：
471390--473573。
By PLACE (A Database of Plant Cis-acting Regulatory DNA Elements) and
PLANTCARE forecasting softwares are analyzed the promoter (847bp), it is found that the sequence has the basic element of promoter
TATA-box, CAAT-box, and include multiple induced elements, photoinduction cis-acting elements：-10promoter element；
Photoinduction transcriptional elements：T-box、GT-1box；Thermal induction element：CCAAT box；Reaction of Salmon-Saxl core parts：SURE；Plastid
PatpB gene promoter core parts：Box II.
Wherein, the peculiar element contained be selected from A-box, ABRE, ACE, GAG-motif, HSE, TATCCAT/C-motif,
WUN-motif or as1.
Preferably, peculiar element and its number contained are as follows：(numeral in bracket is opening that the present invention is provided
Number containing the peculiar element in mover)：
A-box(1)、ABRE(1)、ACE(1)、GAG-motif(1)、HSE(1)、TATCCAT/C-motif(1)、WUN-
motif(1)、as1(1)。
This patent is connected this promoter with Reporter gene GUS, is building up to the plasmid with resistant gene (bleomycin)
In, by methods such as electric shocks, recombinant plasmid is incorporated into the genome of Phaeodactylum tricornutum, only need to verify that GUS expression can
Verify the starting efficiency of promoter.
Current gus gene wide variety of in genetically modified plants uidA in E. coli bacterial strain K12 (is also referred to as
GusA) locus is encoded.The beta-glucuronidase of the gene code, systematic naming method is β-D-glucuronide
glucuronosohydrolase(EC 3.2.1.31).The enzyme is a kind of circumscribed hydrolase, can be catalyzed a variety of β-D-Glucose glycosides
Acid is hydrolyzed to D-Glucose aldehydic acid and aglycone.Jefferson in 1987 etc. has cloned gus gene and surveyed
Sequence, thus develops the system as gene fusion marker with gus gene.Due to being not present in the intracellular of most plants
Endogenous GUS activity, and gus gene expression product has that detection method is simple, sensitivity is high, be easy to quantitative and positions point
The advantages of analysing, can be merged with other protein genes so that gus gene turns into recent years should in plant genetic engineering research
With one of most commonly used reporter.
The zymolyte for being usually used in GUS Histochemical localizations at present is the chloro- 3- indolyl glucuronides (5- of the bromo- 4- of 5-
Bromo-4-chloro-3-indolyl glucuronide, abbreviation X-Gluc).This substrate can be formed in enzyme active sites
Blue precipitate.The initial product that beta-glucuronidase acts on X-Gluc is colourless indole derivatives, through peroxidating two
Dimerization acts on forming undissolved 5,5 '-two bromo- 4, the dark indigo color substance of 4 '-dichloro so that the position with GUS activity
Blueness is presented.
The promoter PPt47667 of the present invention is Phaeodactylum tricornutum endogenesis promoter, starts the expression of prediction albumen, therefore,
The present invention demonstrates the promoter efficiency after the normal condition in one growth and breeding cycle of Phaeodactylum tricornutum and heat shock.It is sharp respectively
The efficiency of the promoter is detected with GUS stained tissues decoration method and real-time fluorescence PCR (Real-timeqPCR) method.
Real-time qPCR are exactly that in PCR amplification procedures, by fluorescence signal, PCR processes are detected in real time.
Due to the exponential time base expanded in PCR, there is linear relationship in the Ct values of template and the starting copy number of the template, so as fixed
The foundation of amount.Real-time qPCR are easy to operate due to its, and sensitivity is high, develops the advantages of reproducible very fast.If
The every field of life science is being had been directed to, such as the Differential expression analysis of gene, SNP is detected, allele
Detection, drug development, clinical diagnosis, transgenic research etc..The result produced to RT-PCR, uses 2 during analysis-CTMethod, i.e., according to
Equation below is calculated：
1. Δ Ct (target gene Ct-internal reference Ct) average value ± standard deviation；
2. Δ Δ Ct (target gene Δ Ct in target gene Δ Ct-reference sample in testing sample) average value ± mark
Quasi- deviation；
3. relative expression quantity (2-ΔΔCt) average value ± standard deviation；
Second object of the present invention is to provide a kind of expression vector, it is characterised in that pre- containing above-mentioned Phaeodactylum tricornutum
Survey GFP Pt47667 High-expression promoters.
Third object of the present invention is to provide a kind of host cell, it is characterised in that contain above-mentioned expression vector.
Described host cell is preferably Phaeodactylum tricornutum.
Fourth object of the present invention is to provide above-mentioned promoter PPt47667 and is starting downstream gene in Phaeodactylum tricornutum
Cell growth cycle in high efficient expression application.
Described microalgae is preferably Phaeodactylum tricornutum.
Described downstream gene is preferably Phaeodactylum tricornutum prediction albumen Pt47667 genes.
The study find that promoter sequence there is no any document report mistake, do not have in public databases such as GenBank yet
Any annotation is the promoter of promoter and which kind of feature.The present invention is to find and identify the function of the promoter first, start
Efficiency.The present invention clones the promoter of Pt47667 genes from Phaeodactylum tricornutum：Phaeodactylum tricornutum predicts GFP
Pt47667 promoter, the promoter can start downstream gene can be efficiently in the cell growth cycle of Phaeodactylum tricornutum
Expression, therefore can be applied in genetic engineering and have good application prospect in genetic engineering.
Raw materials used and reagent can be bought by market in a kind of promoter that the present invention is provided and its application.
With reference to embodiment, the present invention is expanded on further：
Embodiment 1：The clone of promoter and gus gene
First, the genomic DNA of Phaeodactylum tricornutum is extracted, is carried out using the plant DNA extraction kit of Magene companies.
Primer is synthesized by Shanghai Sheng Gong bioengineering Co., Ltd, is purified through PAGE methods, 100 μM are diluted to when using.Promoter
PPt47667 is cloned in Phaeodactylum tricornutum DNA, and gus gene is in universal support pCAMBIA1301 (in the prompt blue biotechnology in Shanghai
Co., Ltd buys) middle clone.Wherein clone condition use PCR method, using KOD-plus-Neo enzymes (TOYOBO,
JAPAN) PCR is obtained, and as shown in table 1, PCR reaction systems are respectively such as table 2 for the PCR primer of promoter PPt47667 and gus gene
With shown in table 3, the promoter of Phaeodactylum tricornutum Pt47667 genes does not confirm, the present invention is predicted by multiple forecasting softwares
The core parts of PPt47667 promoters, and take wherein 847bp to be promoter region, design primer in this region.
Table 1.PCR primers
Table 2.PCR reaction systems (20L)
Table 3.GUS gene PCRs reaction system (20L)
Reaction condition is：Pre-degeneration：94℃,2min.
By PLACE (A Database of Plant Cis-acting Regulatory DNA Elements) and
PLANTCARE forecasting softwares are analyzed the sequence of above-mentioned clone, it is found that the sequence has the basic element of promoter
TATA-box, CAAT-box, and include multiple induced elements, photoinduction cis-acting elements：-10promoter element；
Photoinduction transcriptional elements：T-box、GT-1box；Thermal induction element：CCAAT box；Reaction of Salmon-Saxl core parts：SURE；Plastid
PatpB gene promoter core parts：Box II.The sequence is named as promoter PPt47667.
Embodiment 2：Build recombinant vector
Above-mentioned promoter PPt47667, gus gene and the fcpA terminators cloned, (277bp gives birth to work by Shanghai
Biological Co., Ltd's synthesis) by using ClonExpress MultiS One Step Cloning kits (Vazyme
Biotech Co., Ltd, nanjing) method of homologous recombination is connected to the carrier containing blasticidin resistance expression cassette, contains
The carrier of blasticidin resistance expression cassette be by pPt-ApCAT carriers (construction step of pPt-ApCAT carriers with reference to Niu etc.,
2011) chloramphenicol resistance gene is substituted for bleomycin base by conventional gene engineering means well known to those skilled in the art
Because obtaining, the recombinant expression carrier (as shown in Figure 1) containing promoter PPt47667 and gus gene is obtained.The kit of use
It is the one step cloning KIT of Nuo Weizan bio tech ltd.
Embodiment 3：Phaeodactylum tricornutum converts and converted the screening of algae
Recombinant vector is incorporated into Phaeodactylum tricornutum genome with reference to Niu etc. (2012) electric-shocking method.By 4-5 times
The screening of bleomycin obtains resistant conversion algae.
Embodiment 4：Convert the checking of algae
The first step, is verified on a molecular scale, and 100ml is converted algae and 100ml wild type Phaeodactylum tricornutums 3000g is centrifuged
5min is collected, and the plant DNA extraction kit extraction genomic DNA with Magene companies after 3 times is cleaned with PBS solution, is used
GUS-F primers (as shown in SEQ ID No.6, F:5 ' ATGTTACGTCCTGTAGAAA 3 ') and GUS-R primers (such as SEQ ID
Shown in No.7, R:5 ' TGTTTGCCTCCCTGCTGCGGT 3 ') enter performing PCR, as a result as shown in Fig. 2 the 1st row are conversion algae, the 2nd
Row are wild type algaes, and conversion algae has band at general 1.8kb, and wild type algae does not have, it is known that contain GUS bases in conversion algae
Cause.
Second step, is verified on apparent, and 100ml is converted algae and 100ml wild type Phaeodactylum tricornutums 3000g centrifuges 5min
Collect, algae precipitation GUS 37 DEG C of stained over night of staining kit, then 5000g centrifugations abandon supernatant, add 1ml fixer (second
Alcohol：Acetic acid=3:1) 30min is eluted, as a result as shown in figure 3,1 is control algae, without color change after dyeing, 2 be conversion algae, dye
Blue precipitate is formed after color, it follows that conversion algae can express gus gene.
3rd step, from cellular morphology.After conversion algae is dyed by GUS, take 10 μ l algae solution to be placed in and be inverted micro-
Sem observation cellular morphology, as shown in Figure 4.A does not have colors blue for the frustule of wild type, and B is the conversion whole cell of frustule
Levelling au bleu.
Embodiment 5：GUS dyeing checking promoter efficiency
Apparent checking is carried out to the Reporter gene GUS for converting algae.Wild type algae and conversion algae are individually positioned in new training
Support in base and algae density domination is in 1x106Individual/ml, takes the microalgae of first day, the 4th day and the 8th day, the quantity control of microalgae respectively
System is in 2.2x108It is individual.Supernatant is abandoned in algae precipitation GUS 37 DEG C of stained over night of staining kit, then 5000g centrifugations, is added 1ml and is consolidated
Determine liquid (ethanol：Acetic acid=3:1) taken pictures after elution 30min.As a result as shown in figure 5, as shown in Figure 5, algae is all referred in phaeodactylum tricornutum
In growth cycle, gus gene expression efficiency is higher.
Embodiment 6：RT-PCR detects promoter efficiency
The present invention carries out fluorescence real-time quantitative analysis to the Reporter gene GUS for converting algae.Wild type algae and conversion algae are placed
In new culture medium and algae density domination is in 1x106Individual/ml, takes the microalgae of first day, the 4th day and the 8th day respectively, microalgae
Quantity is controlled in 3x108It is individual.3000g centrifuges 5min, in -80 ° of preservations.Obtained using the plant RNA extraction kit of Omega companies
Phaeodactylum tricornutum RNA, the reverse transcription reagent box of TAKARA companies is by RNA reverse transcriptions into cDNA.For the special of gus gene
Primers F:5 ' GCCAAAAGCCAGACAGAGTG3 ' (as shown in SEQ ID No.8)；R:5’TGACGACCAAAGCCAGTAAAG
3 ' (as shown in SEQ ID No.9), for real-time quantitative amplification.Fluorescence probe SYBR qPCR Mix used are public purchased from TAKARA
Department, experiment detection device used is the CFX96Touch of Bio-Rad companies of the U.S.TMFluorescence quantitative PCR detection system.As a result such as
Shown in Fig. 6-8.As can be seen here, the promoter can efficiently start destination gene expression within the growth of Phaeodactylum tricornutum cycle, and
And can conspicuousness raising destination gene expression.Real-time quantitative PCR result understands that PPt47667 promoters are given birth in Phaeodactylum tricornutum
The expression of the efficient promotor gene of energy in long period.
Embodiment 7
Control group：Beta-tubulin (TUB) promoter；
Experimental group：The promoter PPt47667 that the present invention is provided；
The promoter in control group and experimental group is built into recombinant vector respectively, conversion algae is made.Algae is converted to place newly
In culture medium and algae density domination is 1 × 106Individual/ml, takes the microalgae of first day, the 4th day and the 8th day, the number of microalgae respectively
Amount control is 3 × 108It is individual.3000g centrifuges 5min, in -80 DEG C of preservations.Obtained using the plant RNA extraction kit of Omega companies
Phaeodactylum tricornutum RNA, the reverse transcription reagent box of TAKARA companies is by RNA reverse transcriptions into cDNA.Used from corresponding primer
In real-time quantitative amplification.Fluorescence probe SYBR qPCR Mix used are purchased from TAKARA companies, and experiment detection device used is U.S.
The CFX96Touch of Bio-Rad companies of stateTMFluorescence quantitative PCR detection system.Real-time quantitative PCR the results are shown in Table 4.
The real-time quantitative PCR result of table 4
| Group | Control group | Experimental group |
| First day | 20.12 | 269.46** |
| 4th day | 50.86 | 764.68** |
| 8th day | 300.80 | 20037.66** |
Note：Compared with control group, * shows that P ＜ 0.05, * * show P ＜ 0.01.
As seen from the results in Table 4, at first day, the 4th day and the 8th day, the promoter of experimental group is in growth of Phaeodactylum tricornutum
Destination gene expression can efficiently be started in cycle, and can conspicuousness raising destination gene expression.Experimental group and control group
Compare, with pole significant difference (P ＜ 0.01).
Embodiment 8
Control group：Beta-tubulin (TUB) promoter
Experimental group：The promoter PPt47667 that the present invention is provided；
The promoter in control group and experimental group is built into recombinant vector respectively, conversion algae is made.
Using high efficient expression of the microalgae made from control group and experimental group by oil synthesis related gene, lifting grease contains
Amount, then the grease in microalgae cell is transformed into using either physically or chemically extracellular, then carries out refinement processing, so that
Produce biodiesel.As a result it is as shown in table 5.
The yield of biodiesel of table 5 and cost
| Group | Control group | Experimental group |
| The yield (%) of biodiesel | 10.20 | 44.10* |
| Biodiesel fractional yield | 1 | 5.20* |
Note：Compared with control group, * shows that P ＜ 0.05, * * show P ＜ 0.01.
As seen from the results in Table 5, the promoter of experimental group within the growth of Phaeodactylum tricornutum cycle by efficiently starting purpose base
Because of expression, the yield of the biodiesel significantly improved has significantly saved production cost.Experimental group is respectively provided with compared with control group
Significant difference (P ＜ 0.05).
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Ji'nan University
<120>A kind of promoter and its application
<130> MP1618581
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 847
<212> DNA
<213>Artificial sequence
<400> 1
gccctcttaa aactaggact tttgatcagg ggggaaatgg tctacaatta gaaactctat 60
ccaattggaa gaatcgctct cgcaagaatc cttcaatgaa acaaaaatgt tcactgtcat 120
tctgggagga gaggaggatg tgaccgtgtg ctacaaactc agtagaagta ggttttcaca 180
ttaagacaaa tattccattt ttgatgtcca aagtctcgga gaatgggtct tttaaatcag 240
ggcctggagc ggattgattg ataccacaga tttgatcatt gcgaaacaga aaatttctca 300
agttttcact tctctagttt ctgatgcttg ttcctcacag tcagtattag gcgaaacttt 360
atattctggc agtgaattcc tttcattgtt ggcacgcttg atctatagag attcggacta 420
gagtaagaga gtttagactt gggacggatc atctcgctat cctaaaaaat gtacctgaaa 480
aatcaaagtt tttgggacga tgttgattca ccctaatgta acatatggat aaatttgagt 540
tgacgtttat cggagacttc acgcagctca tgtcaacagt tctggacatg tttctctttc 600
taagaaagag atcgaaccgc gactaaacga cggaatttta tatcgaaagg atgacgtcaa 660
tcggcgctcc attgctttta caaagaaaaa gattttccgc gatgtgaatc tgcgagattc 720
gtgatcgatt ctgtagaaac ggtatacttc gtacgtagat cttgaaatta tctcgtggat 780
ttgtgtagga ggccgtacat acgtggctca gtcagcttga tgtgagttgt cactttgcgc 840
ctttggt 847
<210> 2
<211> 42
<212> DNA
<213>Artificial sequence
<400> 2
ctggaaagcg ggcagtgagc cctcttaaaa ctaggacttt tg 42
<210> 3
<211> 40
<212> DNA
<213>Artificial sequence
<400> 3
ttgttggtaa ttgttaccaa aggcgaaagt gacaactcac 40
<210> 4
<211> 44
<212> DNA
<213>Artificial sequence
<400> 4
aattacaatc cagtggtacc atgttacgtc ctgtagaaac ccca 44
<210> 5
<211> 39
<212> DNA
<213>Artificial sequence
<400> 5
cgtccttgta gtccaggtgt tgtttgcctc cctgctgcg 39
<210> 6
<211> 19
<212> DNA
<213>Artificial sequence
<400> 6
atgttacgtc ctgtagaaa 19
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence
<400> 7
tgtttgcctc cctgctgcgg t 21
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence
<400> 8
gccaaaagcc agacagagtg 20
<210> 9
<211> 21
<212> DNA
<213>Artificial sequence
<400> 9
tgacgaccaa agccagtaaa g 21
Claims (10)
1. a kind of promoter, it is characterised in that including basic element, peculiar element and induced element；
The peculiar original paper be selected from A-box, ABRE, ACE, GAG-motif, HSE, TATCCAT/C-motif, WUN-motif or
as1；
The basic element is selected from TATA-box or CAAT-box；
The induced element is selected from photoinduction cis-acting elements, photoinduction transcriptional elements, thermal induction element, reaction of Salmon-Saxl core member
Part or plastid PatpB gene promoter core parts.
2. promoter according to claim 1, it is characterised in that the photoinduction cis-acting elements for-
10promoter element；The photoinduction transcriptional elements are selected from T-box or GT-1box；The thermal induction element is CCAAT
box；The reaction of Salmon-Saxl core parts are SURE；The plastid PatpB gene promoters core parts are Box II.
3. promoter according to claim 1 or 2, it is characterised in that it has the nucleosides shown in (I), (II) or (III)
Any one in acid sequence：
(I) such as SEQ ID NO:Shown in 1；
(II) with such as SEQ ID NO:Sequence shown in 1 has the sequence of at least 70% homology；
(III) such as SEQ ID NO:Sequence shown in 1 is through modifying, replacing, lack or adding the nucleosides that one or several nucleotides are obtained
Acid sequence.
4. the promoter according to any one of claims 1 to 3, it is characterised in that it is described be substituted by substitution 1,2,3
It is individual, 4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20
It is individual, 21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,
36,37 or 38 nucleotides.
5. the promoter according to any one of Claims 1-4 is starting downstream gene efficient table within the micro algae growth cycle
Application in reaching.
6. application according to claim 5, it is characterised in that the microalgae is Phaeodactylum tricornutum；The downstream gene is
Phaeodactylum tricornutum refers to prediction GFP Pt47667.
7. a kind of expression vector, it is characterised in that contain the promoter as described in any one of Claims 1-4.
8. a kind of host cell, it is characterised in that contain expression vector as claimed in claim 7.
9. host cell according to claim 8 improves the application in the yield of purpose product in microalgae.
10. a kind of method for producing biodiesel, it is characterised in that utilize the grease of host cell as claimed in claim 8
The high efficient expression of synthetic gene, lifts fat content, obtains biodiesel.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611087639.3A CN107012143B (en) | 2016-11-30 | 2016-11-30 | Promoter and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611087639.3A CN107012143B (en) | 2016-11-30 | 2016-11-30 | Promoter and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012143A true CN107012143A (en) | 2017-08-04 |
| CN107012143B CN107012143B (en) | 2020-08-28 |
Family
ID=59439113
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611087639.3A Active CN107012143B (en) | 2016-11-30 | 2016-11-30 | Promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012143B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105316358A (en) * | 2015-10-14 | 2016-02-10 | 华东理工大学 | Method for increasing content of fatty acid and oil and fat in microalgae by using type III NAD kinase |
| CN105838715A (en) * | 2016-04-26 | 2016-08-10 | 暨南大学 | Microalgae constitutive expression promoter and application thereof |
| CN106047873A (en) * | 2016-04-26 | 2016-10-26 | 暨南大学 | A phaeodactylum tricornutum bohlin highly expressed promoter and applications thereof |
-
2016
- 2016-11-30 CN CN201611087639.3A patent/CN107012143B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105316358A (en) * | 2015-10-14 | 2016-02-10 | 华东理工大学 | Method for increasing content of fatty acid and oil and fat in microalgae by using type III NAD kinase |
| CN105838715A (en) * | 2016-04-26 | 2016-08-10 | 暨南大学 | Microalgae constitutive expression promoter and application thereof |
| CN106047873A (en) * | 2016-04-26 | 2016-10-26 | 暨南大学 | A phaeodactylum tricornutum bohlin highly expressed promoter and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| NIU YF等: "Transformation of diatom Phaeodactylum tricornutum by electroporation and establishment of inducible selection marker", 《BIOTECHNIQUES》 * |
| 李濯雪等: "植物诱导型启动子及相关顺式作用元件研究进展", 《生物技术通报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107012143B (en) | 2020-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106047873B (en) | A kind of Phaeodactylum tricornutum High-expression promoter and its application | |
| CN105838715B (en) | A kind of microalgae composition type expression promoter and its application | |
| CN104818253B (en) | Target transformation of site-directed integration Chinese hamster ovary celI system and application thereof | |
| Cui et al. | Cloning and characterization of a novel diacylglycerol acyltransferase from the diatom Phaeodactylum tricornutum | |
| CN107164409A (en) | CDV sensitive cell line SLAM MDCK and its construction method and application | |
| CN106916815A (en) | A kind of promoter and its application | |
| Abel et al. | Transient gene expression in protoplasts of Arabidopsis thaliana | |
| CN107058314A (en) | A kind of promoter and its application | |
| CN103173481A (en) | Plasmid vector containing 3'UTR (untranslated regions) sequence of ABCB1 gene and reporter gene as well as construction method and use of plasmid vector | |
| CN106754926A (en) | MiRNA and its application for regulating apple spot defoliation resistance | |
| CN109487005A (en) | For expanding the primer of the intranasal tumour virus whole genome sequence of goat region | |
| CN107012143A (en) | A kind of promoter and its application | |
| CN105969768A (en) | KLF7 gene promoter as well as activity and application thereof | |
| CN106834309B (en) | DNA sequence and application thereof | |
| CN113881678B (en) | C/EBPZ gene promoter and application thereof | |
| CN103173480B (en) | Method for screening multidrug resistance related microRNA (ribonucleic acid) by using dual-luciferase report genes | |
| CN102191249A (en) | Silkworm Bmlp3 gene promoter and use thereof | |
| CN111100868B (en) | Female promotion gene FERR and female inhibition gene FERR-R of populus deltoides and application thereof | |
| CN107556373A (en) | Incise gene order and its application of the main fat drips albumen of edge green alga | |
| US5998167A (en) | Expression control polynucleotides derived from spliceosomal protein gene promoters | |
| CN106520766A (en) | Seaweed endogenesis constructive promoter and application thereof | |
| CN105602953A (en) | Agaricus-bisporus inducible promoter, expression vector and application of agaricus-bisporus inducible promoter | |
| CN110499316A (en) | It is a kind of knock out CD44 gene cow mammary gland epithelial cells system and its construction method | |
| CN105112532A (en) | Hybridization probe for detecting von hippel-lindau (VHL) gene large deletion and detection method and kit | |
| CN109679956A (en) | Promoter sequence, recombinant vector and application based on BnaCnng52950D gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |