CN107156487A - It is a kind of to improve the pure plant source feed additive of meat quality - Google Patents

Abstract

Improve the pure plant source feed additive of meat quality, including following components by weight percent the invention discloses a kind of：12 parts of Radix Codonopsis, 12 parts of the bighead atractylodes rhizome, 9 parts of Poria cocos, 9 parts of radix glycyrrhizae, 9 parts of the tuber of pinellia, 9 parts of dried orange peel, 9 parts of radish seed, 9 parts of hawthorn, 9 parts of malt, 6 parts of fructus amomi, 3 parts of the banksia rose.It is shown experimentally that, the influence for the various trophic factors that the pure plant source feed additive of improvement meat quality determined by the present invention contains in different pig kinds to pork is significantly better than that other groups.Therefore, the present invention can significantly improve the nutritional quality of pork, improve the edible nutritive value of pork.

Description

It is a kind of to improve the pure plant source feed additive of meat quality

Technical field

It is specially a kind of to improve the pure plant source feed of meat quality the present invention relates to pig feed additive field Additive.

Background technology

With the rapid raising of living standards of the people, the health care consciousness of people is strengthened increasingly.Swine product quality problem by Consumer more and more pays close attention to.It is unfavorable for many anti-of health because the producer abuses some for the high lean meat percentage of pursuit Raw element, hormone, high-copper and arsenic preparation additive, so as to cause meat quality drastically to decline, form the latent of influence human health In danger.

Chinese herbal medicine class feed addictive refers to the animals and plants of the medical value according to Chinese medicine theory in nature Product compatibility is constituted, and has a class feed addictive of certain effect effect to growth of animal and production performance.It is substantial amounts of both at home and abroad Research shows the characteristics of Chinese herb feed additive has natural sex, multifunctionality, has no toxic side effect and have no drug resistance, and can not only improve The production performance of animal, and the quality of its product can be significantly improved.China also begins to pay much attention to this respect, and gradually will Sight turns to some natural Chinese herbal feed additives.

Shanxi Province's pig industry is also booming, and pork consumption figure is big, and quality requirements are also stepped up, therefore Shanxi Province Pig worker cultivates the strong excellent pig kind of many production performances to meet the market requirement.Shanxi Province is enhanced simultaneously in pig Competitive force of the same trade.Current our province also has some to have the pig kind of traditional improved seeds, but these excellent product to Shanxi Province The meat of boar is studied also in blank stage.

The content of the invention

It is an object of the present invention to provide a kind of Chinese herbal medicine good formulas, meat is carried out to Shanxi Province improved seeds pig and DLY Matter improves research, it is intended to which inquiring into Shanxi Province's improved seeds Meat improves situation.For Shanxi Province improved seeds pig development in meat Provided safeguard in terms of matter.

The present invention adopts the following technical scheme that realization：

1st, it is a kind of to improve the pure plant source feed additive of meat quality, including following components by weight percent：

12 parts of Radix Codonopsis, 12 parts of the bighead atractylodes rhizome, 9 parts of Poria cocos, 9 parts of radix glycyrrhizae, 9 parts of the tuber of pinellia, 9 parts of dried orange peel, 9 parts of radish seed, 9 parts of hawthorn, malt 9 Part, 6 parts of fructus amomi, 3 parts of the banksia rose.

It is the pharmacological action of every kind of component below：

Radix Codonopsis：1st, build up resistance.Radix Codonopsis has excitation to nervous system, can strengthen Abwehrkraft des Koepers；2nd, hypotensive.It can expand Open peripheral vessels and reduce blood pressure, adrenergic boosting can be suppressed again；3rd, gastric ulcer is prevented and treated.Have Gastrointestinal motility adjustment, The effects such as antiulcer, gastric acid secretion inhibiting, reduction pepsin activity；4th, blood glucose is raised.Its liter of hyperglycemia is Yin Qigen In caused by sugar containing volume；5th, antihypertensive effect；6th, antiulcer action.Radix Codonopsis has confrontation gastric mucosa damage and enhancing gastric mucosa thin Born of the same parents' protective effect；7th, immunity is improved.Generation to interleukin -2 (IL-2) is also remarkably reinforced effect, to netted interior The phagocytic function of dermal system also has humidification；8th, endurance and oxygen lack resistant function.

The bighead atractylodes rhizome：1st, hypoglycemic effect.The assimilation of glucose thus reduces blood glucose in acceleration bodies；2nd, strong effect.It can promote Increased weight and enhancing endurance, 3, strengthen immunity.The phagocytic function of reticuloendothelial system can be strengthened, promote gulping down for macrophage Bite function.Promote cellular immune function, and substantially increase IgG；4th, antitumor action.The neutral oil of Baizhu volatile oil is to the cancer of the esophagus Cell has obvious inhibiting effect；5th, antibacterial action.Infusion in vitro has suppression to acrothesium floccosum, star nocardia Effect.Decoction has not to meningococcus, typhoid bacillus, paratyphosum Bacterium, shigella dysenteriae, Escherichia coli, Pseudomonas aeruginosa etc. With the bacteriostasis of degree；6th, protein synthesis is promoted.The synthesis of Protein in small intestine can be obviously promoted；7th, hepatic cholagogic.It can protect Protect liver is dirty, prevents liver glycogen caused by carbon tetrachloride from reducing.Carbon tetrachloride, which can be suppressed, causes serum AST, ALT and LDH rising； 8th, antioxidation.The bighead atractylodes rhizome can reduce lipid peroxidation, removal ability of the enhancing body to free radical.

Poria cocos：1st, antibacterial action.PORIA ALBA has suppression to make to staphylococcus aureus, Escherichia coli, proteus etc. With.The ethanol extract of PORIA ALBA can kill Leptospira in vitro；2nd, reduction hydrochloric acid in gastric juice effect.PORIA ALBA is to intestine in vitro There is direct relexation, and hydrochloric acid in gastric juice can be dropped；3rd, hepatoprotective effect.There is obvious protection hepatic injury effect, make gpt activity Substantially reduction, prevents necrosis of liver cells；4th, PORIA ALBA polysaccharide body enhancing immunologic function.The cytotoxicity for increasing macrophage is made With the cytotoxicity of enhancing T lymphocytes strengthens cell immune response, and therefore activate immune prison of the body to tumour System is superintended and directed, this is closely related with its antitumor activity.

Radix glycyrrhizae：1st, detoxication.Extract of licorice root and glycyrrhizin are poisoned to some drugses, food poisoning, in vivo metabolism production Thing poisoning has certain detoxification ability.The effective ingredient of detoxication is glycyrrhizin, and detoxication mechanisms are glycyrrhizin to poison Thing has suction-operated, and glycyrrhizin hydrolysate glucuronic acid can be combined with poisonous substance, and glycyrrhizin have adrenal cortex Hormone-like effect, strengthens the result of combined factors effect in terms of the detoxification ability of liver；2nd, function of relieving cough and calming asthma.Enoxolone There is obvious central antitussive effect.3rd, glycyrrhizin, glycyrrhetate still have anti-inflammatory and antiallergy, anti-liver injury, anti-rush Cancer, antibacterial, anti AIDS virus (glycyrrhizin) effect；4th, body's immunity, anti-arrhythmia are adjusted.

The tuber of pinellia：1st, antitussive effect.There is obvious antitussive effect to cough, and can maintain more than 5 hours；2nd, to tryptose The inhibitory action of enzyme.Tuber of pinellia trypsin inhibitor can suppress water of the trypsase to acid amides, ester, hemoglobin and casein Solution, does not suppress chymotrypsin, bradykinin and releases the water of a piece enzyme, subtilopeptidase A and papain to respective substrate Solution；3rd, cell division effect is promoted.The rush cell division effect of pinellin also has animal species selectivity, and it promotes animal periphery Blood lymphocyte is converted.

Dried orange peel：1st, hepatoprotective effect.Dried orange peel has protective effect to liver damage.Not only suppress Alpha-Naphthyl isothiocyanates to cause Serum bilirubin increase, moreover it is possible to suppress the release of enzyme in liver；2nd, choleretic effect.Dried orange peel can increase solids in bile and bile The excretion of matter, there is preferable choleretic effect；3rd, antibacterial action.Dried orange peel has antibacterial action to helicobacter pylori；4th, enzyme is improved Activity.Dried orange peel water decoction can increase in vitro salivary amylase activity；5th, digestion is promoted.There is volatile oil to intestines and stomach contained by dried orange peel Gentle stimulation, can promote the secretion of digestive juice, exclude the pneumatosis in intestinal tube；6th, cholesterol is reduced.Orange peel pectin is to reality The property tested high fat of blood animal, can reduce serum cholesterol；7th, antiinflammatory immunity function.Aurantiamarin and hesperidin methyl have citrin sample Effect, can resist capillary permeability increase.

Radish seed：1st, the effect of resisting pathogenic microbes.Radish seed water extract has significantly to staphylococcus and Escherichia coli etc. Inhibitory action；2nd, detoxication.Raphanin has obvious detoxication after being mixed in vitro with bacterial exotoxin；3rd, decompression is made With.Radish seed water extract has obvious antihypertensive effect, can substantially reduce pulmonary hypertension and body arterial pressure；4th, to vascular resistence Influence.After the intravenous injection of radish seed parenteral solution, make body vascular resistence（SVR）, pulmonary vascular resistance（PVR）Substantially lower.

Hawthorn：1st, it is depressured, lipid-loweringing.The general flavone that can be significantly reduced in serum cholesterol and triglycerides, hawthorn has expansion The effect of blood vessel and lasting buck, effectively prevents and treats atherosclerosis, can be aid digestion, with nourishing the liver degreasing effect；2nd, block simultaneously Reduce the generation of free radical.Anti-oxidant, strengthen immunity, removing intestines and stomach harmful bacteria etc., can also prevent liver cancer.

Malt：1st, digestion-aid effect.This product contains α and beta amylase, and starch is the mixture of amylose and amylopectin.Form sediment Powder is decomposed into maltose and dextrin in the presence of α and beta amylase.Secretion of the malt decoction to hydrochloric acid in gastric juice and pepsin has gently Spend facilitation；2nd, hypoglycemic effect.Malt preserved material can reduce blood glucose；3rd, antifungic action.Hordenine A and B contained by this product There is antifungal activity.

Fructus amomi：1st, intestinal tube is shunk.It can strengthen small intestine intestinal contraction, have inhibitory action to intestinal tube during escalated dose, show Tension force is reduced, and amplitude is reduced；2nd, platelet aggregation can substantially be suppressed；3rd, antiulcer action.Gastric enzyme digestible protein can be suppressed.

The banksia rose：1st, tracheospasm is solved：Banksia rose Aqueous extracts, alcohol extract, volatile oil and total alkaloid can be to antihistamines and acetyl Choline is to tracheae and bronchial cause convulsion effect；2nd, excited enteron aisle, to anti-spasm.Banksia rose Aqueous extracts, volatile oil and total alkaloid First there is slight excitation to rat small intestine in vitro, subsequent tonicity is substantially reduced with rhythmicity.To acetylcholine, histamine and barium chloride Caused myenteron spasm has antagonism；3rd, antibacterial action：Streptococcus, the golden yellow growth with white grapes can be suppressed, to large intestine Bacillus also has effect with corynebacterium diphtheriae, and decoction has inhibitory action to 10 kinds of fungies such as oidium schoenleinii and its Mongolian mutation.

2nd, different pig varieties improve meat Quality Research

Choose Jin Fen white pigs, the white pig in Jin Yang, Shanxi Black pig, four pig kinds of DLY, it is every kind of be divided into I group of Chinese herb feed additive, in II group of Chinese herbal medicine additive agent, antibiotic group and blank control group, every group of 30 test pigs.Pass through feeding experiment, metabolic test and Tu Experiment is killed, analysis is measured to meat quality, the pork of high-quality is researched and produced.

3rd, with meat related gene expression quantifier elimination

（1）, take after feeding experiment longissimus dorsi muscle to carry out the analysis of meat related gene expression amount.

（2）, by the production performance of growing and fattening pigs, carcass quality and meat sample aliphatic acid, amino acid, cholesterol measure Probe into the determination excellent pig kind high-quality pork production technology in Shanxi Province and application.

（3）, pass through feeding experiment, metabolic test and slaughter experiment etc. inquire into meat related gene table between different pig kinds Up to amount difference.

4th, the present invention has the beneficial effect that：

A, the meat quality to Shanxi Province's different cultivars and Chinese medicine improve situation and contrasted

The present invention is studied for the white pigs of Jin Fen, the white pig in Jin Yang, Shanxi Black pig, the pork of four pig kinds of DLY, and During feeding add Chinese herbal medicine carried out different cultivars meat quality improve situation studied.

B, the mechanism for probing into by the analysis to cholesterol in meat sample meat improvement

Cholesterol is used as finger as current mankind and the important measurement index of animal health, this project to cholesterol level in meat sample Mark to disclose meat improvement.

C, exploration Chinese herbal medicine improve the study mechanism of meat quality on different pig kind gene levels

Action pathway of the nutrition regulation to meat quality Improving flavor is studied using Protocols in Molecular Biology, is also pig battalion of China Support and learn and feed science research is from initial nutritional need quantifier elimination to nutrition and meat quality, nutrition and environment, nutrition and be immunized, Transformation in terms of molecular nutrition.

It is shown experimentally that, improves the pure plant source feed additive of meat quality determined by the present invention not The influence of the various trophic factors contained in same pig kind to pork is significantly better than that other groups.Therefore, the present invention can be notable Improve the nutritional quality of pork, improve the edible nutritive value of pork.

Brief description of the drawings

Fig. 1 represents delicious amino acid content in pork sample.

Fig. 2 is represented must unsaturated fatty acid content in pork sample.

Fig. 3 represents cholesterol level in pork sample.

Fig. 4 represents total serum IgE electrophoretogram.

Fig. 5 represents reference gene GAPDH amplification curves.

Fig. 6 represents reference gene GAPDH solubility curves.

Fig. 7 represents target gene H-FABP amplification curves.

Fig. 8 represents target gene H-FABP solubility curves.

Fig. 9 represents pork sample H-FABP values.

Figure 10 represents target gene CAST amplification curves.

Figure 11 represents target gene CAST solubility curves.

Figure 12 pork sample CAST values.

Figure 13 represents target gene LPL amplification curves.

Figure 14 represents target gene LPL solubility curves.

Figure 15 represents pork sample LPL values.

Figure 16 represents target gene myog amplification curves.

Figure 17 represents target gene myog solubility curves.

Figure 18 pork sample myog values.

Figure 19 represents the sugared kinase isozyme gene of target gene（HK）Amplification curve.

Figure 20 represents the sugared kinase isozyme gene of target gene（HK）Solubility curve.

Figure 21 represents pork sample HK values.

Figure 22 represents target gene ATP synzyme（ATP5B）Amplification curve.

Figure 23 represents target gene ATP synzyme（ATP5B）Solubility curve.

Figure 24 represents pork sample ATP5B values.

Figure 25 represents target gene phosphofructokinase（PFK）Amplification curve.

Figure 26 represents target gene phosphofructokinase（PFK）Solubility curve.

Figure 27 represents pork sample P FK values.

Embodiment

The specific embodiment of the present invention is described in detail below.

It is a kind of to improve the pure plant source feed additive of meat quality, including following components by weight percent：

12 parts of Radix Codonopsis, 12 parts of the bighead atractylodes rhizome, 9 parts of Poria cocos, 9 parts of radix glycyrrhizae, 9 parts of the tuber of pinellia, 9 parts of dried orange peel, 9 parts of radish seed, 9 parts of hawthorn, malt 9 Part, 6 parts of fructus amomi, 3 parts of the banksia rose.

Superfine powder is made in herbal component, and particle is 300 mesh.

Illustrate the application effect of this feed addictive below by specific experiment.

In order that experimental result is more scientific and convincingness, research has set four groups, be respectively I group of Chinese medicine, II group, AntibioticGroup and blank control CK groups.

1st, material

Chinese herbal medicine：Testing the Chinese herbal medicine selected is：Radix Codonopsis, the bighead atractylodes rhizome, Poria cocos, radix glycyrrhizae, the tuber of pinellia, dried orange peel, radish seed, hawthorn, malt, Fructus amomi, the banksia rose, perillaseed, Divine Comedy, pine needle etc..

I group of Chinese herb feed additive：2 parts of Radix Codonopsis, 3 parts of the bighead atractylodes rhizome, 1.5 parts of dried orange peel, 1 part of perilla seed, 1.5 parts of Divine Comedy, pine needle 2 Part, 1 part of radix glycyrrhizae.

II group of Chinese herb feed additive：12 parts of Radix Codonopsis, 12 parts of the bighead atractylodes rhizome, 9 parts of Poria cocos, 9 parts of radix glycyrrhizae, 9 parts of the tuber of pinellia, 9 parts of dried orange peel, Lay 9 parts of Fu, 9 parts of hawthorn, 9 parts of malt, 6 parts of fructus amomi, 3 parts of the banksia rose.

Test pig：The white pigs of Jin Fen, the white pig in Jin Yang, Shanxi Black pig, four pig kinds of DLY, it is every kind of to be divided into Chinese herb feed additive I group, II group of Chinese herb feed additive, III group of antibiotic and blank control CK groups, every group of 30 test pigs.

The addition of Chinese herb feed additive is 0.5kg in per 100kg feeds.

The feeding cycle：Whole fattening period（20kg is to delivering preceding first quarter moon for sale）.

2nd, method

2.1st, carcass quality is determined

Sample collection：Longissimus dorsi muscle 1500g at thoracic vertebrae final section vertebra or so, and preserved under the conditions of 4 DEG C.

Testing index：PH, electrical conductivity, yellowish pink, cooking loss, it is waterpower, shearing force maximum.

Assay method：

pH：Record butchers the time, butchers latter 1 hour with pH meter determination sample pH.Animal dead is determined and recorded again for 24 hours Measurement result.

Electrical conductivity：It is identical with pH assay methods, latter 1 hour is butchered with conductivity measurement determination sample electrical conductivity.Animal Determine again and record measurement result within dead 24 hours.

It is yellowish pink：24 hours after butchering, determine the yellowish pink of meat sample product with Minolta color difference meter and record, each sample determines 3 It is secondary.

Cooking loss：Sample 50g or so is taken, its quality is recorded, is then placed into steaming 30 minutes or so in 100 DEG C of steaming trays, Wait after its natural cooling, moisture is dried with blotting paper.Determination sample quality is simultaneously recorded.

It is waterpower and maximum shear stress：Using the professional research grade physical properties of food analysis Texture instruments of TMS-PRO, 1000N is used Probe, shears standardization program according to Texture instrument cube meat and 35Kg waterpower measures standardization program is carried out.

Eye muscle area：Analyzed using German scan-STAR image analysis systems according to the Rib-eye image gathered.

After the completion of measure, all data inputting Microsoft Office Excel 2013.Data analysis is used SPSS22.0 softwares carry out one-way ANOVA（Single factor test variance）Analysis.

2.2nd, the measure of longissimus dorsi muscle nutritive composition in muscle

Take eye muscle waist section 50-100g to be put into valve bag after butchering rapidly, go back to laboratory and carry out moisture, coarse ash and crude protein Determine.Assay method is edited referring to Zhang Liying《Forage analysis and quality detection technology》The third edition.

2.3rd, determined amino acid

Using automatic amino acid analyzer, 17 kinds of amino acid of each group pig longissimus dorsi muscle are detected.

2.4th, the measure of aliphatic acid and cholesterol

Carried out using the method for gas chromatographic analysis.

2.5th, meat related gene is quantitatively detected

（1）, primer sequence（The Software for Design of Primer Premier 5.0）

House-keeping gene（GAPDH）Primer sequence

S-GAPDH-F：5' CCTGGAGAAACCTGCAAAATA 3' 57.4

S-GAPDH-R：5' AACCTGGTCCTCAGTGTAGCC 3' 58.2 100bp

Target gene primer sequence

S-H-FABP-F：5' AAGCACCTTCAAGAGCACAGA 3' 57.1

S-H-FABP-R：5' GACAAGTTTGCCTCCATCCA 3' 58.5 115bp

S-CAST-F：5' TCCAAGTCAGGAGAACAGAAAGG 3' 60.2

S-CAST-R：5' TGAAGCAGAGGAAGGCGATAC 3' 59.6 126bp

S-LPLF：5' TTTATCGACTGGATGGCGG 3' 59.1

S-LPL-R：5' TGACCCTCTGGTGAATGTGTGT 3' 59.8 237bp

S-myog-F：5' CTATGACGGGGAAAACTACCTG 3' 58.4

S-myog-R：5' AGACACGGACTTCCTCTTACACA 3' 58.2 190bp

S-HK-F：5' GCATCTGCTCGCCTACTTCT 3' 57.2

S-HK-R：5' TCTCCGTGTTCTGTCCCATC 3' 57.6 225bp

S-ATP5B-F：GAATCCCTTCTGCGGTGGGTTAT

S-ATP5B-R：GGCAGGAGCAGGGTCAGTCAAGT 149bp

S-PFK-F：5' TGTTGAACGACCTCCAGAAAG 3' 57.7

S-PFK-R：5' TATCGGTGCCGCAAAAGT 3' 57.2 117bp

（2）, method

1. following reagent is added in the nuclease-free PCR pipes of ice bath：

total RNA X ul

Random Primer p(dN)6（100pmol） 1ul

dNTP Mix（0.5 mM final concentration)） 1.0ul

Rnase-free ddH2O are settled to 14.5ul

2. 3 ~ 5s is centrifuged after gently mixing, reactant mixture is after 65 DEG C of warm bath 5min, and ice bath 2min is then centrifuged for 3 ~ 5s.

3. by test tube ice bath, following reagent is added：

4.0 ul 5*RT Buffer

0.5 ul Thermo Scientific RiboLock RNase inhibitor（20U）

1.0 ul RevertAid Premium Reverse Transcriptase（200U）

4. 3 ~ 5s is centrifuged after gently mixing

5. reverse transcription reaction is carried out according to following condition in PCR instrument

25 DEG C of incubation 10min, cDNA synthesis, 50 DEG C of 30min terminating reactions, 85 DEG C of 5min after processing, are placed in and placed on ice.

6. by above-mentioned -20 DEG C of preservations of solution.

7. cDNA samples are diluted 8 times and is used as machine testing in template.

8. reaction mixture is prepared

9. PCR cycle condition

10. complete after above-mentioned steps, LightCycler480 Software Setup are placed on 96/384 orifice plate of sample has been added Reacted in (Roche Roches).

3rd, result of study

3.1st, carcass quality is determined

The DLY meat quality result of table 1 is counted

Note：Shoulder mark difference letter person represents significant difference（P<0.05）, shoulder mark same letter person represents that difference is not notable（P> 0.05）.CK, I, II, III represent control group, one group of experiment, two groups of experiment and the plain group of III life respectively in form.a>b>c.Following table Together.

Table 1, pH value difference is not notable.CK（Control）The electrical conductivity difference of group is significantly higher than experimental group, illustrates experimental group Meat is more preferably preserved.CK groups and III group of L values（Brightness）Be significantly higher than I, II group, I, II, III group of A values（Redness）It is significantly higher than CK Group, I, II group of B values（Yellowing）Be significantly higher than CK, III group.II group of cooking loss is significantly higher.It is that II group of waterpower is significantly relatively low, II group of shearing force maximum is significantly relatively low.II group of shearing force maximum is significantly less than other groups.Eye muscle area I, II group it is significantly high In other groups.

The white meat quality result statistics of the Jin Fen of table 2

Table 2, pH value difference is not notable.III group of electrical conductivity difference highest.Ith, II group of L values are significantly higher than CK groups and III group, I, II group of A values are significantly higher than CK groups and III group, and CK, I group of B values are significantly higher than other groups.Ith, II group of cooking loss and be water Power is substantially less than other groups.III group of the notable highest of shearing force maximum, and I group of shearing force maximum is significantly minimum.Ⅰ、Ⅱ Group eye muscle area is noticeably greater than other groups.

The Shanxi Black meat quality result of table 3 is counted

Table 3, pH1 I, II group it is significantly relatively low, pH24 differences are little.Ith, II, the L values of CK groups（Brightness）Substantially less than III group, and CK, II group of A values（Redness）With B values（Yellowing）It is significantly higher.Illustrate that two groups of control group and experiment are yellowish pink more bright-coloured, and III life element Group A values（Redness）It is significantly relatively low.Ith, II, III group of conductance difference illustrates test group and control group significantly less than the plain group of III life Meat advantageously in preservation.Cooking loss is with being that waterpower difference is not notable.II group of shearing force maximum is substantially less than I, control Group, and I, control group is substantially less than III group.Ith, II group of eye muscle area is noticeably greater than CK groups and III group.With the pig of kind, in body weight In the case of being more or less the same, eye muscle area is bigger, and lean meat percentage is higher.

The white meat quality result statistics in the Jin Yang of table 4

Table 4, pH value difference is not notable.CK groups, II and III group of L values（Brightness）It is significantly higher than I group, and II and III group of A values（It is red Degree）Extremely notable relatively low, CK and I group of B values（Yellowing）It is significantly higher.Ith, II, the conductance difference of CK groups is significantly small III group.Boiling Lose CK, I group it is significantly higher.In terms of being waterpower, III group significantly higher.I group of shearing force maximum be substantially less than CK, III group, and CK, III group be substantially less than II group.II group of eye muscle area is significantly higher than other groups.

3. the 2nd, measure of longissimus dorsi muscle nutritive composition in muscle

The DLY pork sample nutritional ingredient result of the test of table 5

The white pig pork sample nutritional ingredient result of the tests of the Jin Fen of table 6

The content of the Shanxi Black pig pork sample nutritional ingredient of table 7

The content of the white pig pork sample nutritional ingredient in the Jin Yang of table 8

Jin Fen is white, Shanxi Black pig, DLY nutritional ingredient it is different not notable in group contrast mean deviation of CK, I, II, III.The white pig in Jin Yang Moisture, crude protein I and III group of significant difference, each group difference of crude fat is notable.

3. the 3rd, determined amino acid

The content of the DLY pork sample amino acid of table 9

Table 9, II group of methionine is significantly higher than I group, glutamic acid I, II group be significantly higher than CK groups, it is not notable with III group of difference；It is sweet II group of propylhomoserin is significantly higher than CK groups, and other each group differences are not notable.The equal difference of other each groups is not notable.

The content of the DLY pork sample delicious amino acid of table 10

Table 10, glutamic acid I, II group be significantly higher than CK groups, it is not notable with III group of difference；II group of glycine is significantly higher than CK groups, its His each group difference is not notable.

The content of the white pork sample amino acid of the Jin Fen of table 11

Table 11, each component difference is not notable.

The content of the white pork sample delicious amino acids of the Jin Fen of table 12

Table 12, each component difference is not notable.

The content of the Shanxi Black pig pork sample amino acid of table 13

Table 13, II group of threonine is significantly higher than CK groups and III group, not notable with I group of difference, and I group is also significantly greater than CK groups and III Group；I group of serine, II group be significantly higher than CK groups, it is not notable with III group of difference；I group of proline is significantly higher than CK groups and III group, with II group of difference is not notable；II group of valine is significantly higher than CK groups and III group, not notable with I group of difference, and I group is also significantly greater than CK Group；I group of methionine, II group, III group be all remarkably higher than CK groups；II group of isoleucine is significantly higher than CK groups and III group, with I group of difference Different not notable, I group is also significantly greater than CK groups, not notable with III group of difference；II group of leucine is significantly higher than CK groups and III group, with I Group difference is not notable, and I group is also significantly greater than CK groups, not notable with III group of difference；I group of lysine, II group, III group be all remarkably higher than CK groups；I group of arginine, II group, III group be all remarkably higher than CK groups；I group of asparatate, II group be significantly higher than CK groups and III group； II group of glutamic acid is significantly higher than CK groups and III group, not notable with I group of difference, and I group is also significantly greater than CK groups, does not show with III group of difference Write；I group of glycine, II group be significantly higher than CK groups and III group, III group is significantly higher than CK groups；II group of alanine be significantly higher than CK groups and III group, not notable with I group of difference, I group is significantly higher than CK groups；I group of tyrosine, II group, III group be all remarkably higher than CK groups；Phenylpropyl alcohol ammonia Acid II group be significantly higher than CK groups, I group and III group, I group is significantly higher than CK groups, not notable with III group of difference.

The content of the Shanxi Black pig pork sample delicious amino acid of table 14

Table 14, I group of asparatate, II group be significantly higher than CK groups and III group；II group of glutamic acid is significantly higher than CK groups and III group, with I group of difference is not notable, and I group is also significantly greater than CK groups, not notable with III group of difference；I group of glycine, II group be significantly higher than CK groups and III group, III group is significantly higher than CK groups；II group of alanine is significantly higher than CK groups and III group, not notable with I group of difference, and I group significantly high In CK groups；I group of tyrosine, II group, III group be all remarkably higher than CK groups；II group of phenylalanine is significantly higher than CK groups, I group and III group, I Group is significantly higher than CK groups, not notable with III group of difference.

The content of the white pig pork sample amino acid in the Jin Yang of table 15

Table 15, II group of threonine is significantly higher than I group, not notable with CK groups and III group of difference；II group of valine is significantly higher than CK groups With III group, it is not notable with I group of difference；II group of isoleucine is significantly higher than CK groups and III group, not notable with I group of difference；Lucid asparagus II group of propylhomoserin is significantly higher than CK groups and I group, not notable with III group of difference；II group of glutamic acid is significantly higher than CK groups, with I group and III group Difference is not notable；II group of phenylalanine be significantly higher than CK groups, I group and III group.

The content of the white pig pork sample delicious amino acid in the Jin Yang of table 16

Table 16, II group of asparatate is significantly higher than CK groups and I group, not notable with III group of difference；II group of glutamic acid is significantly higher than CK groups are not notable with I group and III group of difference；II group of phenylalanine be significantly higher than CK groups, I group and III group.

3. the 4th, fatty acid determination

The DLY pork sample content of fatty acid of table 17

Table 17, I group of gamma-Linolenic acid is significantly higher than CK groups, and other each group differences are not notable.

The DLY pork sample of table 18 must unsaturated fatty acid content

Table 18, I group of gamma-Linolenic acid is significantly higher than CK groups, and other each group differences are not notable.

The white pork sample content of fatty acid of the Jin Fen of table 19

Table 19, docosahexaenoic acid CK groups are significantly higher than III group, and other each group differences are not notable.

The white pork samples of the Jin Fen of table 20 must unsaturated fatty acid content

Table 20, each component is not notable.

The content of the Shanxi Black pig pork sample aliphatic acid of table 21

II group is significantly higher than CK groups during Heptadecanoic acide is contrasted in table 21, Shanxi Black pig pork sample content of fatty acid, between other groups Difference is not notable.

The content of the necessary unrighted acid of the Shanxi Black pig pork sample of table 22

Table 22, each group difference is not notable.

The content of the white pig pork sample aliphatic acid in the Jin Yang of table 23

II group of the content of Heptadecanoic acide is significantly higher than I group in table 23, the white pig pork sample content of fatty acid in Jin Yang, between other each groups Difference is not notable.

The content of the necessary unrighted acid of the white pig pork sample in the Jin Yang of table 24

Table 24, each group difference is not notable.

3. the 5th, measure of cholesterol level

The DLY pork sample cholesterol level of table 25

Table 25, I group, II group of the white pig gall sterol in Jin Yang be substantially less than CK groups, III group.

3.6th, meat related gene is quantitatively detected

The pork sample H-FABP values of table 26

Table 26, II group of Shanxi Black pig H-FABP values are not notable with I group of difference, but be significantly higher than CK groups, III group.II group of the white pig in Jin Yang Pole is significantly higher than CK groups, is significantly higher than III group, I group.

The pork sample CAST values of table 27

Table 27, II group of pork sample CAST value Shanxi Blacks pig is significantly higher than III group, and other each group differences are not notable；The white pig II in Jin Yang Group is significantly higher than I group, CK groups, and pole is significantly higher than III group, I group, CK group differences it is not notable, but be significantly higher than III group.

The pork sample LPL values of table 28

Table 28, II group of pork sample LPL value Shanxi Blacks pig is significantly higher than III group, and other each group differences are not notable；The white pig I in Jin Yang Group, CK groups, II group of difference is not notable, but is significantly higher than III group.

The pork sample myog values of table 29

Table 29, II group of pork sample myog value Shanxi Blacks pig is significantly higher than III group, and other each group differences are not notable.

The pork sample HK values of table 30

Table 30, white II group of the pig in pork sample HK values Jin Yang is significantly higher than I group, and other differences are not notable；II group of Shanxi Black pig is notable Higher than I group, pole be significantly higher than CK groups, III group, I group is significantly higher than CK groups, and pole is significantly higher than III group, and CK groups are significantly higher than III group； II group of the white pigs of Jin Fen are significantly higher than CK groups, and pole is significantly higher than III group, I group be significantly higher than CK groups, III group, CK groups be significantly higher than III Group.

The pork sample ATP5B values of table 31

Table 31, II group of pork sample ATP5B value Shanxi Blacks pig, I group, CK group differences it is not notable, II group, I group is significantly higher than III group； II group of the white pigs of Jin Fen be significantly higher than CK groups, III group, II group, I group of difference it is not notable, I group, II group, III group of difference it is not notable.

The pork sample P FK values of table 32

Table 32, II group of pork sample P FK value Shanxi Blacks pig, I group, CK group differences it is not notable, II group is significantly higher than III group；Jin Fen is white II group of pig is significantly higher than CK groups, and pole is significantly higher than III group, I group, II group of difference it is not notable, CK groups, III group of difference is not notable.

Experimental result is as follows：

The electrical conductivity difference of DLY pig kind experimental group is substantially less than CK（Control）Group, illustrates that the meat of experimental group is more preferably preserved；Ⅰ、 II group of L values（Brightness）Substantially less than CK groups and III group；B values（Yellowing）Be significantly higher than CK, III group；II group of cooking loss is significantly inclined Height, is that waterpower is significantly relatively low, shearing force maximum is significantly relatively low.Eye muscle area I, II group be significantly higher than other groups.Glutamic acid I, II group is significantly higher than CK groups, not notable with III group of difference；II group of glycine is significantly higher than CK groups, and I group of gamma-Linolenic acid is significantly higher than CK groups.

The electrical conductivity difference highest of III group of the white pig kinds of Jin Fen.Ith, II group of L values are significantly higher than CK groups and III group, and I, II group A values be significantly higher than CK groups and III group, CK, I group of B values are significantly higher than other groups.Ith, II group of cooking loss and be waterpower show Write and be less than other groups.III group of the notable highest of shearing force maximum, and I group of shearing force maximum is significantly minimum.Ith, II group of eye Flesh area is noticeably greater than other groups.II group of pork sample HK values are significantly higher than CK groups, and pole is significantly higher than III group, and I group is significantly higher than CK groups, III group, CK groups be significantly higher than III group.White II group of the pigs of pork sample ATP5B values Jin Fen be significantly higher than CK groups, III group, II group, I group of difference is not notable, I group, II group, III group of difference it is not notable.White II group of the pigs of pork sample P FK values Jin Fen are significantly higher than CK groups, Pole is significantly higher than III group, I group, II group of difference it is not notable, CK groups, III group of difference is not notable.

Shanxi Black pig kind pH1 I, II group it is significantly relatively low, pH24 differences are little.Ith, II, the L values of CK groups（Brightness）It is significantly low In III group, and CK, II group of A values（Redness）With B values（Yellowing）It is significantly higher.Illustrate that two groups of control group and experiment are yellowish pink fresher It is gorgeous, and III life element group A values（Redness）It is significantly relatively low.Ith, II, III group of conductance difference illustrate to test significantly less than III life plain group The meat of group and control group is advantageously in preservation.Cooking loss is with being that waterpower difference is not notable.II group of shearing force maximum is notable Less than I group, CK groups, and I group, CK groups be substantially less than III group.Ith, II group of eye muscle area is noticeably greater than CK groups and III group.With kind Pig, in the case where body weight is more or less the same, eye muscle area is bigger, and lean meat percentage is higher.I group of asparatate, II group be significantly higher than CK groups and III group；II group of glutamic acid is significantly higher than CK groups and III group, not notable with I group of difference, and I group is also significantly greater than CK groups, with III group of difference is not notable；I group of glycine, II group be significantly higher than CK groups and III group, III group is significantly higher than CK groups；II group of alanine shows Write and be higher than CK groups and III group, not notable with I group of difference, I group is significantly higher than CK groups；I group of tyrosine, II group, III group it is significantly high In CK groups；II group of phenylalanine be significantly higher than CK groups, I group and III group, I group is significantly higher than CK groups, not notable with III group of difference.H- II group of FABP values are not notable with I group of difference, but be significantly higher than CK groups, III group.Pork sample CAST values, II group is significantly higher than III Group, other each group differences are not notable；II group of pork sample LPL value Shanxi Blacks pig is significantly higher than III group, and other each group differences do not show Write；II group of pork sample myog value Shanxi Blacks pig is significantly higher than III group；II group of pork sample HK value Shanxi Blacks pig is significantly higher than I Group, pole be significantly higher than CK groups, III group, I group is significantly higher than CK groups, and pole is significantly higher than III group, and CK groups are significantly higher than III group；Pork sample II group of product ATP5B value Shanxi Blacks pig, I group, CK group differences it is not notable, II group, I group is significantly higher than III group；Pork sample P FK values mountain Western II group of black pig, I group, CK group differences it is not notable, II group is significantly higher than III group.

The white pig kind CK groups in Jin Yang, II and III group of L values（Brightness）It is significantly higher than I group, and II and III group of A values（Redness） Extremely notable relatively low, CK and I group of B values（Yellowing）It is significantly higher.Ith, II, the conductance difference of CK groups is significantly small III group.Boiling is damaged Lose CK, I group it is significantly higher.In terms of being waterpower, III group significantly higher.I group of shearing force maximum be substantially less than CK, III group, and CK, III group is substantially less than II group；II group of eye muscle area is significantly higher than other groups；Moisture, crude protein I and the III group of difference of the white pig in Jin Yang Significantly, II group of asparatate is significantly higher than CK groups and I group, not notable with III group of difference；II group of glutamic acid is significantly higher than CK groups, It is not notable with I group and III group of difference；II group of phenylalanine be significantly higher than CK groups, I group and III group.I group of the white pig gall sterol in Jin Yang, II Group be substantially less than CK groups, III group.The white II group of pole of pig in pork sample H-FABP values Jin Yang is significantly higher than CK groups, be significantly higher than III group, I Group.White II group of the pig in pork sample CAST values Jin Yang is significantly higher than I group, CK groups, and pole is significantly higher than III group, I group, CK group differences do not show Write, but be significantly higher than III group.White I group of the pig in pork sample LPL values Jin Yang, CK groups, II group of difference is not notable, but is significantly higher than III Group.Pork sample myog value differences are not different notable；White II group of pig is significantly higher than I group in pork sample HK values Jin Yang, and other differences do not show Write；Pork sample ATP5B value differences are not different notable；, pork sample P FK value differences are different notable.

The influence of the various trophic factors contained by II group of the visible Chinese herbal medicine of result above in different pig kinds to pork It is significantly better than that I group of Chinese herbal medicine, antibiotic group（III group）And control group（CK）.Therefore pig can be significantly improved using II group of Chinese medicine The nutritional quality of meat, improves the edible nutritive value of pork.

Using II group of acquirement economic results in society of Chinese medicine and popularizing application prospect

（1）, improve using Chinese medicine after pork pork price more common than market can double, the economic benefit of creation quite may be used See, project amounts to from 2015 to the end of the year 2016 promotes eight 6200, pig farms, three 12852920 yuan of gross annual output values, total profits tax 5578985 yuan, 3 years 3156235 yuan of new profits.

（2）, from the point of view of the meat of test pig, the not only yellowish pink of pork, tenderness and local flavor have obtained obvious improvement, and The needed by human body unrighted acid that intramuscular contains substantially increases, and cholesterol level is remarkably decreased, therefore the nothing so produced The pork of the green safety of antibiotic residue has extraordinary social benefit.

（3）, our province different cultivars meat quality improve on all obtain different-effect.

（4）, China be pig big country, pork production occupy first place in the world, since ancient times people meat based on pork, pork Account for more than the 65% of whole carnivorous consumption figure.Therefore, the quality of meat quality undoubtedly has great shadow to the healthy of people Ring.The increase of present cardiovascular and cerebrovascular diseases people, the increase of obesity number etc. require that our pig worker can not only give birth to The more porks of output, and to produce more preferable high-quality pork.Therefore, ecological pork undoubtedly has wide popularization should Use prospect.

Claims (1)

1. a kind of improve the pure plant source feed additive of meat quality, it is characterised in that：Including following components by weight percent：

12 parts of Radix Codonopsis, 12 parts of the bighead atractylodes rhizome, 9 parts of Poria cocos, 9 parts of radix glycyrrhizae, 9 parts of the tuber of pinellia, 9 parts of dried orange peel, 9 parts of radish seed, 9 parts of hawthorn, malt 9 Part, 6 parts of fructus amomi, 3 parts of the banksia rose.