CN107156487B

CN107156487B - Pure natural plant source feed additive for improving pork quality

Info

Publication number: CN107156487B
Application number: CN201710429154.6A
Authority: CN
Inventors: 胡广英; 曹暄雅; 刘华栋; 曹日亮; 郭建东; 段亚娜; 赵敏; 温永亮; 韩淑芳; 刘泽民; 韩云生; 吴志娟; 闫益波; 睢进财; 冯军
Original assignee: INSTITUTE OF ANIMAL HUSBANDRY AND VETERINARY SCIENCES SHANXI ACADEMY OF AGRICULTURAL SCIENCES (SAAS)
Current assignee: INSTITUTE OF ANIMAL HUSBANDRY AND VETERINARY SCIENCES SHANXI ACADEMY OF AGRICULTURAL SCIENCES (SAAS)
Priority date: 2017-06-08
Filing date: 2017-06-08
Publication date: 2020-05-22
Anticipated expiration: 2037-06-08
Also published as: CN107156487A

Abstract

The invention discloses a pure natural plant source feed additive for improving pork quality, which comprises the following components in parts by weight: 12 parts of codonopsis pilosula, 12 parts of bighead atractylodes rhizome, 9 parts of poria cocos, 9 parts of liquorice, 9 parts of pinellia ternate, 9 parts of dried orange peel, 9 parts of radish seed, 9 parts of hawthorn, 9 parts of malt, 6 parts of fructus amomi and 3 parts of costustoot. Experiments show that the pure natural plant source feed additive for improving the pork quality, which is determined by the invention, has obviously better influence on various nutritional factors contained in pork in different pig species than other groups. Therefore, the invention can obviously improve the nutritional quality of the pork and improve the edible nutritional value of the pork.

Description

Pure natural plant source feed additive for improving pork quality

Technical Field

The invention relates to the field of pig feed additives, in particular to a pure natural plant source feed additive for improving pork quality.

Background

Along with the rapid improvement of the living standard of people, the health care consciousness of people is gradually strengthened. Swine product quality issues are receiving increasing attention from consumers. Due to abuse of a plurality of antibiotics, hormones, high-copper and arsenic preparation additives which are not beneficial to human health by producers for pursuing high lean meat percentage, the quality of pork is sharply reduced, and potential risks influencing human health are formed.

The Chinese herbal medicine feed additive is prepared by mixing animal and plant products with medicinal value in nature according to the theory of traditional Chinese medicine, and has certain effect on animal growth and production performance. A large number of studies at home and abroad show that the Chinese herbal medicine additive has the characteristics of naturalness, multifunction, no toxic or side effect and no drug resistance, can improve the production performance of animals, and can obviously improve the quality of products. China also pays high attention to the aspect and gradually turns the attention to some natural Chinese herbal medicine feed additives.

The pig raising industry in Shanxi province is also vigorous in development, the pork consumption is large, and the quality requirement is gradually improved, so that pig raising workers in Shanxi province breed a plurality of excellent pig breeds with strong production performance to meet the market demand. Meanwhile, the competitive strength of Shanxi province in the same industry of pig raising is enhanced. At present, some pig breeds with traditional excellent breeds exist in our province, but research on the meat quality of the excellent pig breeds in Shanxi province is still in a blank stage.

Disclosure of Invention

The invention aims to provide a Chinese herbal medicine excellent formula, research on meat quality improvement of Shanxi province high-quality pigs and Du Dao pigs is carried out, and the purpose of the invention is to discuss the meat quality improvement condition of the Shanxi province high-quality pigs. Provides guarantee for the development of Shanxi province high-quality products breeding pigs in the aspect of meat quality.

The invention is realized by adopting the following technical scheme:

1. a pure natural plant source feed additive for improving pork quality comprises the following components in parts by weight:

12 parts of codonopsis pilosula, 12 parts of bighead atractylodes rhizome, 9 parts of poria cocos, 9 parts of liquorice, 9 parts of pinellia ternate, 9 parts of dried orange peel, 9 parts of radish seed, 9 parts of hawthorn, 9 parts of malt, 6 parts of fructus amomi and 3 parts of costustoot.

The pharmacological action of each component is as follows:

codonopsis pilosula: 1. enhancing resistance. Radix Codonopsis has effects of exciting nervous system and enhancing body resistance; 2. reducing blood pressure. Can dilate peripheral blood vessels to reduce blood pressure, and inhibit the pressure increase effect of epinephrine; 3. can be used for preventing and treating gastric ulcer. Has effects in regulating gastrointestinal motility, resisting ulcer, inhibiting gastric acid secretion, and reducing pepsin activity; 4. raise blood sugar. The function of increasing blood sugar is caused by the large amount of sugar in the root; 5. reducing blood pressure; 6. has antiulcer effect. Radix Codonopsis has effects in resisting gastric mucosa injury and enhancing gastric mucosa cell protection; 7. improving immunity. The composition also has obvious enhancement effect on the generation of leukocyte mediator-2 (IL-2) and the phagocytic function of a reticuloendothelial system; 8. fatigue resistance and anti-anoxia effect.

White atractylodes rhizome: 1. has blood sugar lowering effect. Accelerating the assimilation of glucose in vivo and thus lowering blood glucose; 2. has tonic effect. Can promote weight gain and enhance endurance, and 3, enhance immunity. Can enhance phagocytic function of reticuloendothelial system and promote phagocytic function of macrophage. Promoting cellular immune function and obviously increasing IgG; 4. has antitumor effect. The neutral oil of the bighead atractylodes rhizome volatile oil has obvious inhibition effect on esophageal cancer cells; 5. has antibacterial effect. The water extract has effect in inhibiting Epidermophyton floccosum and Nocardia stellatoides in test tube. The decoction has different degrees of bacteriostasis on meningococcus, typhoid bacillus, paratyphoid bacillus, dysentery bacillus, colon bacillus, pseudomonas aeruginosa and the like; 6. promoting protein synthesis. Can obviously promote the synthesis of small intestine protein; 7. protecting liver and promoting function of gallbladder. Can protect liver and prevent hepatic glycogen reduction caused by carbon tetrachloride. Can inhibit the increase of AST, ALT and LDH of serum caused by carbon tetrachloride; 8. has antioxidant effect. Atractylodis rhizoma can reduce lipid peroxidation and enhance the ability of organism to remove free radicals.

Tuckahoe, poria cocos: 1. has antibacterial effect. The Poria has inhibitory effect on Staphylococcus aureus, Escherichia coli, and Proteus. The ethanol extract of the white poria can kill leptospira in vitro; 2. Reducing gastric acid effect. The white poria has direct relaxation effect on isolated intestinal canal and can reduce gastric acid; 3. has liver protecting effect. Has obvious effect of protecting liver injury, obviously reduces the activity of glutamic-pyruvic transaminase, and prevents liver cells from necrosis; 4. the Poria polysaccharide has immunity enhancing effect. Increasing the cytotoxic effect of macrophages, enhancing the cytotoxicity of T lymphocytes, i.e. enhancing the cellular immune response, and thus activating the body's immune surveillance system against tumors, which is closely related to its anti-tumor activity.

Licorice root: 1. has antidotal effect. The extractum glycyrrhizae and glycyrrhizin have certain detoxifying ability to some drug poisoning, food poisoning and in vivo metabolite poisoning. The effective component of the detoxification function is glycyrrhizin, the detoxification mechanism is the result of the combined action of the glycyrrhizin on the toxicant, the glycyrrhizin hydrolysate glucuronic acid can combine with the toxicant, and the glycyrrhizin has the adrenocortical hormone-like action and can enhance the detoxification capability of the liver; 2. relieving cough and asthma. Glycyrrhetinic acid has obvious central antitussive effect. 3. Glycyrrhizin and glycyrrhetinic acid salt have antiinflammatory, antiallergic, liver injury resisting, anticancer, antibacterial, and anti-HIV effects; 4. regulating immunity, and resisting arrhythmia.

Pinellia ternata: 1. relieving cough. Has obvious cough relieving effect on cough, and can be maintained for more than 5 hours; 2. Inhibiting effect on trypsin. The pinellia ternata trypsin inhibitor can inhibit the hydrolysis of amide, ester, hemoglobin and casein by trypsin, and does not inhibit the hydrolysis of chymotrypsin, bradykinin releasing enzyme, subtilisin and papain to respective substrates; 3. and (3) cell division promoting effect. The cell division promoting effect of pinellia ternata protein also has animal species specificity, and promotes the transformation of animal peripheral blood lymphocytes.

The orange peel has the advantages that 1, the orange peel has a liver protection effect, has a liver damage protection effect, can inhibit increase of serum bilirubin caused by α -naphthyl isothiocyanate and release of enzyme in a liver, 2, has a cholagogic effect, can increase discharge of bile and solid matters in the bile, has a better cholagogic effect, 3, has an antibacterial effect on helicobacter pylori, 4, improves enzyme activity, can increase activity of in vitro salivary amylase by a decoction agent of the orange peel, 5, promotes digestion, has a mild stimulation effect on gastrointestinal tracts by volatile oil contained in the orange peel, can promote secretion of digestive juice and eliminate pneumatosis in intestinal tracts, 6, reduces cholesterol, reduces pectin for experimental hyperlipidemic animals, can reduce serum cholesterol, and 7, has an anti-inflammatory and immune effect, and has a vitamin P-like effect on hesperidin and methyl hesperidin, and can resist increase of capillary permeability.

Radish seed: 1. resisting pathogenic microorganism. The radish seed aqueous extract has obvious inhibition effect on staphylococcus, escherichia coli and the like; 2. has antidotal effect. The sulforaphene has obvious detoxification function after being mixed with bacterial exotoxin in vitro; 3. and (4) reducing blood pressure. The radish seed aqueous extract has obvious blood pressure reducing effect, and can obviously reduce pulmonary hypertension and body arterial pressure; 4. the effect on vascular resistance. After intravenous injection, the radish seed injection can obviously reduce the body vascular resistance (SVR) and the Pulmonary Vascular Resistance (PVR).

Hawthorn fruit: 1. reduce blood pressure and blood fat. Can significantly reduce serum cholesterol and triglyceride, the total flavone in hawthorn has the functions of expanding blood vessels and lowering blood pressure for a long time, effectively prevents and treats atherosclerosis, can help digestion, and has the effects of nourishing liver and removing fat; 2. blocking and reducing the generation of free radicals. Resisting oxidation, enhancing immunity, eliminating harmful bacteria in gastrointestinal tract, and preventing hepatocarcinoma.

1, digestion-aiding effect, containing α and β amylase, wherein starch is a mixture of saccharine starch and mucilage starch, the starch can be decomposed into maltose and dextrin under the action of α and β amylase, malt decoction has slight promotion effect on secretion of gastric acid and pepsin, 2, blood sugar reducing effect, malt infusion can reduce blood sugar, and 3, antifungal effect, and the barley alkali A and B contained in the product have antifungal activity.

Amomum fruit: 1. contracting the intestinal canal. Can strengthen the contraction of small intestine and intestine, inhibit intestine when increasing dosage, reduce tension and reduce amplitude; 2. can obviously inhibit platelet aggregation; 3. has antiulcer effect. Can inhibit gastric enzyme from digesting protein.

Costustoot: 1. relieving spasm of trachea: the wood perfume extract, the alcohol extract, the volatile oil and the total alkaloids can resist the spasmolytic effect of histamine and acetylcholine on trachea and bronchus; 2. exciting the intestinal tract and resisting spasm. The wood perfume extract, the volatile oil and the total alkaloids have slight excitation effect on in-vitro small intestine, and the tonicity and the rhythmicity are obviously reduced. Has effects in resisting intestinal spasm caused by acetylcholine, histamine and barium chloride; 3. the antibacterial effect is as follows: it can inhibit growth of streptococcus, golden yellow and white grape, and has effects of inhibiting Escherichia coli and diphtheria bacillus, and the decoction has effects of inhibiting 10 kinds of fungi such as Trichophyton schoenleinii and Mongolian variety thereof.

2. Research on meat quality improvement of different pig varieties

Four breeds of Jinfen white pigs, Jinyang white pigs, Shanxi black pigs and Du Long pigs are selected, each breed is divided into a Chinese herbal medicine additive I group, a Chinese herbal medicine additive II group, an antibiotic group and a blank control group, and each group comprises 30 test pigs. The pork quality is determined and analyzed through a feeding test, a metabolism test and a slaughtering test, and the high-quality pork is researched and produced.

3. Research on expression level of meat quality-related gene

(1) And after the feeding test, taking the longissimus dorsi to analyze the expression quantity of the related genes of the meat quality.

(2) The production technology and the application of the high-quality pork of the excellent pig breed of Shanxi province are researched and determined by measuring the production performance, carcass quality, meat-like fatty acid, amino acid and cholesterol of the fattening pig.

(3) And discussing the difference of the expression quantity of the meat related genes among different pig species through a feeding test, a metabolism test, a slaughtering test and the like.

4. The invention has the following beneficial effects:

a. comparing the pork quality of different varieties of Shanxi province with the improvement condition of traditional Chinese medicine

The invention researches pork of four pig species of Jinfen white pig, Jinyang white pig, Shanxi black pig and Du-Chang pig, and researches the quality improvement conditions of different pork species by adding Chinese herbal medicines in the feeding process.

b. Research on mechanism of meat quality improvement by analysis of cholesterol in meat sample

Cholesterol is used as an important measurement index of the health of human beings and animals at present, and the cholesterol content in the meat sample is used as an index to reveal the meat quality improvement effect.

c. Research on mechanism of Chinese herbal medicine for improving pork quality at gene level of different pig breeds

The molecular biology technology is utilized to research the action way of nutrition regulation and control on the improvement of pork quality and flavor, and is also the conversion from the research of the initial nutrition requirement to the research of nutrition and pork quality, nutrition and environment, nutrition and immunity, molecular nutrition and the like in the research of pig nutrition and feed science in China.

Experiments show that the pure natural plant source feed additive for improving the pork quality, which is determined by the invention, has obviously better influence on various nutritional factors contained in pork in different pig species than other groups. Therefore, the invention can obviously improve the nutritional quality of the pork and improve the edible nutritional value of the pork.

Drawings

FIG. 1 shows the content of flavor amino acids in pork samples.

FIG. 2 shows the essential unsaturated fatty acid content of pork samples.

FIG. 3 shows the cholesterol content in pork samples.

FIG. 4 shows a total RNA electrophoretogram.

FIG. 5 shows the amplification curve of the reference gene GAPDH.

FIG. 6 shows the dissolution profile of the reference gene GAPDH.

FIG. 7 shows an amplification curve of the target gene H-FABP.

FIG. 8 shows the lysis curve of the gene of interest H-FABP.

FIG. 9 shows H-FABP values of pork samples.

FIG. 10 shows the amplification curve of the target gene CAST.

FIG. 11 shows the CAST lysis curve of the target gene.

Fig. 12 CAST values for pork samples.

FIG. 13 shows an amplification curve of the target gene LPL.

FIG. 14 shows the dissolution profile of the target gene LPL.

FIG. 15 shows LPL values of pork samples.

FIG. 16 shows the amplification curve of the gene of interest myog.

FIG. 17 shows the myog lysis curve for the gene of interest.

FIG. 18 myog values for pork samples.

FIG. 19 shows a curve of amplification of the sugar kinase isozyme gene (HK) of the objective gene.

FIG. 20 shows a glycokinase isozyme gene (HK) lysis curve of a target gene.

FIG. 21 shows HK values for pork samples.

FIG. 22 shows an amplification curve of the target gene ATP synthase (ATP 5B).

FIG. 23 shows the melting curve of the objective gene ATP synthase (ATP 5B).

FIG. 24 shows ATP5B values for pork samples.

FIG. 25 shows a Phosphofructokinase (PFK) amplification curve of the target gene.

FIG. 26 shows Phosphofructokinase (PFK) lysis curves of the genes of interest.

Figure 27 shows PFK values for pork samples.

Detailed Description

The following provides a detailed description of specific embodiments of the present invention.

A pure natural plant source feed additive for improving pork quality comprises the following components in parts by weight:

The Chinese herbal medicine components are prepared into superfine powder with the particle size of 300 meshes.

The application effect of the feed additive is illustrated by specific experiments.

In order to make the experimental results more scientific and convincing, researchFour groups are provided, namely a group I and a group II of traditional Chinese medicines and antibiotics

Group and blank control CK group.

1. Material

Chinese herbal medicines: the Chinese herbal medicines selected in the test are as follows: codonopsis pilosula, bighead atractylodes rhizome, poria cocos, liquorice, pinellia ternate, dried orange peel, radish seed, hawthorn, malt, fructus amomi, elecampane, perillaseed, medicated leaven, pine needle and the like.

Chinese herbal medicine additive I group: 2 parts of codonopsis pilosula, 3 parts of bighead atractylodes rhizome, 1.5 parts of dried orange peel, 1 part of perilla fruit, 1.5 parts of medicated leaven, 2 parts of pine needle and 1 part of liquorice.

Chinese herbal medicine additive II group: 12 parts of codonopsis pilosula, 12 parts of bighead atractylodes rhizome, 9 parts of poria cocos, 9 parts of liquorice, 9 parts of pinellia ternate, 9 parts of dried orange peel, 9 parts of radish seed, 9 parts of hawthorn, 9 parts of malt, 6 parts of fructus amomi and 3 parts of costustoot.

Test pigs: each of the four types of the Jinfen white pigs, the Jinyang white pigs, the Shanxi black pigs and the Du-Chang pigs is divided into a Chinese herbal medicine additive I group, a Chinese herbal medicine additive II group, an antibiotic III group and a blank control CK group, and each group comprises 30 test pigs.

The addition amount of the Chinese herbal medicine additive is 0.5kg per 100kg of feed.

Feeding period: the whole fattening period (20 kg to half a month before marketing).

2. Method of producing a composite material

2.1 carcass quality measurement

Collecting samples: the longissimus dorsi muscle of the last vertebra of the thoracic vertebra is about 1500g and is preserved at 4 ℃.

Measurement indexes are as follows: pH, conductivity, flesh color, cooking loss, water holding capacity, and maximum shear force.

The determination method comprises the following steps:

pH: slaughter time was recorded and the sample pH was measured 1 hour after slaughter using a pH meter. The animals were again sacrificed 24 hours and the results were recorded.

Conductivity: the conductivity of the sample was measured 1 hour after slaughter using a conductivity tester, as in the pH measurement method. The animals were again sacrificed 24 hours and the results were recorded.

Meat color: at 24 hours after slaughter, the flesh color of the meat samples was measured and recorded using a penny color difference meter, and each sample was measured 3 times.

Loss of cooking: about 50g of sample is taken, the mass of the sample is recorded, then the sample is placed in a steaming drawer at 100 ℃ for steaming for about 30 minutes, and after the sample is naturally cooled, the moisture is wiped by absorbent paper. The sample mass was determined and recorded.

Water-binding capacity and maximum shear force: the texture analyzer was performed using a TMS-PRO professional research-grade food physical property analyzer using a 1000N probe according to the texture analyzer meat piece shearing standard program and the 35Kg system water power measurement standard program.

Eye muscle area: analysis was performed using the german scan-STAR image analysis system according to the eye muscle images acquired.

After the assay was completed, all data was entered into Microsoft Office Excel 2013. Data analysis one-way ANOVA (one-way ANOVA) analysis was performed using SPSS22.0 software.

2.2 measurement of nutritional ingredients of the longissimus dorsi muscle

And (3) quickly taking 50-100g of eye muscle waist section after slaughtering, putting into a self-sealing bag, and returning to a laboratory for measuring moisture, crude ash and crude protein. The determination method is described in the third edition of "feed analysis and quality detection technology" edited by Zeliying Main.

2.3 determination of amino acids

And (3) detecting 17 amino acids of the longissimus dorsi of each group of pigs by using an automatic amino acid analyzer.

2.4 determination of fatty acids and Cholesterol

The method is carried out by adopting a gas chromatographic analysis method.

2.5 quantitative determination of meat quality-related genes

(1) Primer sequences (Primer Premier 5.0 software design)

Housekeeping Gene (GAPDH) primer sequence

S-GAPDH-F： 5'CCTGGAGAAACCTGCAAAATA 3' 57.4

S-GAPDH-R： 5'AACCTGGTCCTCAGTGTAGCC 3' 58.2 100bp

Target gene primer sequence

S-H-FABP-F：5' AAGCACCTTCAAGAGCACAGA 3' 57.1

S-H-FABP-R：5' GACAAGTTTGCCTCCATCCA 3' 58.5 115bp

S-CAST-F：5' TCCAAGTCAGGAGAACAGAAAGG 3' 60.2

S-CAST-R：5' TGAAGCAGAGGAAGGCGATAC 3' 59.6 126bp

S-LPLF：5' TTTATCGACTGGATGGCGG 3' 59.1

S-LPL-R：5' TGACCCTCTGGTGAATGTGTGT 3' 59.8 237bp

S-myog-F：5' CTATGACGGGGAAAACTACCTG 3' 58.4

S-myog-R：5' AGACACGGACTTCCTCTTACACA 3' 58.2 190bp

S-HK-F：5' GCATCTGCTCGCCTACTTCT 3' 57.2

S-HK-R：5' TCTCCGTGTTCTGTCCCATC 3' 57.6 225bp

S-ATP5B-F：GAATCCCTTCTGCGGTGGGTTAT

S-ATP5B-R：GGCAGGAGCAGGGTCAGTCAAGT 149bp

S-PFK-F：5' TGTTGAACGACCTCCAGAAAG 3' 57.7

S-PFK-R：5' TATCGGTGCCGCAAAAGT 3' 57.2 117bp

(2) Method of producing a semiconductor device

① the following reagents were added to ice-bath nucleo-free PCR tubes:

total RNA X ul

Random Primer p(dN)6（100pmol） 1ul

dNTP Mix（0.5 mM final concentration)） 1.0ul

RNase-free ddH2O constant volume to 14.5ul

② are gently mixed and centrifuged for 3-5 s, the reaction mixture is subjected to warm bath at 65 ℃ for 5min, ice bath for 2min and then centrifugation for 3-5 s.

③ the tubes were ice-cooled and the following reagents were added:

4.0 ul 5*RT Buffer

0.5 ul Thermo Scientific RiboLock RNase inhibitor（20U）

1.0 ul RevertAid Premium Reverse Transcriptase（200U）

④ are gently mixed and then centrifuged for 3-5 s

⑤ reverse transcription reaction was carried out on a PCR instrument under the following conditions

Incubating at 25 deg.C for 10min, synthesizing cDNA, terminating reaction at 50 deg.C for 30min, treating at 85 deg.C for 5min, and standing on ice.

⑥ the solution is stored at-20 deg.C.

⑦ cDNA samples were diluted 8-fold and used as templates for in-machine detection.

⑧ preparing the reaction mixture

⑨ PCR cycling conditions

⑩ after completion of the above steps, the 96/384 well plates with the added samples were placed in a LightCycler480 software set Up (Roche).

3. Results of the study

3.1 carcass quality measurement

TABLE 1 Du Long pork quality statistics

Note: the shoulder marked with different letters indicated significant difference (P < 0.05) and the shoulder marked with the same letters indicated insignificant difference (P > 0.05). In the table, CK, I, II and III represent a control group, an experimental group and an antibiotic group III, respectively. a > b > c. The following table is the same.

Table 1, pH differences were not significant. The difference in conductivity between the CK (control) group was significantly higher than the experimental group, indicating that the meat from the experimental group was better preserved. The L value (brightness) of CK group and III group is higher than that of group I and II, the A value (red degree) of group I, II and III is higher than that of CK group, and the B value (yellow degree) of group I and II is higher than that of group CK and III. The cooking loss group II is obviously higher. The system water power II group is obviously lower, and the maximum value of the shearing force II group is obviously lower. Shear force maximum ii group is significantly less than the other groups. The eye muscle areas I and II were significantly higher than those of the other groups.

TABLE 2 pork quality statistics of Shanfen white pigs

Table 2, pH differences were not significant. Group iii has the highest conductivity difference. The L values of the groups I and II are obviously higher than those of the groups CK and III, the A values of the groups I and II are obviously higher than those of the groups CK and III, and the B values of the groups CK and I are obviously higher than those of the other groups. The cooking loss and the water loss of the groups I and II are obviously lower than those of the other groups. The shear maxima are significantly highest for group iii and significantly lowest for group i. The eye muscle area of the group I and the group II is obviously larger than that of the other groups.

TABLE 3 Shanxi Black pork quality statistics

In Table 3, the pH1 was significantly lower in groups I and II, and the difference in pH24 was small. The L value (brightness) of group I, II, CK is significantly lower than that of group III, while the A value (redness) and B value (yellowness) of group CK, II are significantly higher. The meat color of the control group and the experimental group is more bright, and the A value (redness) of the III element group is remarkably lower. The conductivity difference of the I, II and III groups is obviously smaller than that of the III group, which indicates that the meat of the test group and the meat of the control group are more beneficial to preservation. The cooking loss and the water binding capacity are not obviously different. Shear force maximum ii was significantly lower than that of group i, control, which was significantly lower than that of group iii. The eye muscle areas of the group I and the group II are obviously larger than those of the group CK and the group III. Under the condition that the weight of the pigs of the same breed is not different, the larger the eye muscle area is, the higher the lean meat percentage is.

TABLE 4 jin Yang white pork quality statistics

Table 4, pH differences were not significant. The L values (brightness) of CK, II and III groups are significantly higher than those of I group, while the A values (redness) of II and III groups are significantly lower and the B values (yellowness) of CK and I groups are significantly higher. The conductivity difference of the group I, the group II and the group CK is obviously small. The cooking loss CK and the group I are obviously higher. Group III is significantly higher in water retention. The maximum shear force values of group I are significantly lower than those of group CK and group III, and those of group CK and group III are significantly lower than those of group II. The eye muscle area was significantly higher in group ii than in the other groups.

3.2 measurement of nutritional ingredients of the longissimus dorsi muscle

TABLE 5 nutrient composition test results for Du Long and big pork samples

TABLE 6 pork sample nutrient test results of Shanfen white pig

TABLE 7 nutrient content of Shanxi black pork sample

TABLE 8 content of nutrient components of Jinyang white pork sample

The nutrient contents of Shanxi black pig and Du growing up are not different significantly in CK, I, II and III groups. The moisture and crude protein I and III groups of the Jinyang white pig have obvious difference, and the difference among the crude fat groups is not obvious.

3.3 determination of amino acids

TABLE 9 amino acid content of Du Long-shou samples

Table 9, methionine group ii was significantly higher than group i, glutamic acid groups i and ii were significantly higher than group CK, and the difference from group iii was not significant; the glycine II group is obviously higher than the CK group, and the difference of other groups is not obvious. The differences between the other groups were not significant.

TABLE 10 content of flavor amino acids in Du Dao pork samples

In Table 10, glutamic acid groups I and II are significantly higher than group CK, and the difference between the glutamic acid groups I and II and group III is not significant; the glycine II group is obviously higher than the CK group, and the difference of other groups is not obvious.

TABLE 11 content of amino acids in pork samples from Shanfen pigs

Table 11, the composition differences were not significant.

TABLE 12 content of flavor-developing amino acids in pork samples from Shanfen pigs

Table 12, the composition differences were not significant.

TABLE 13 amino acid content of Shanxi black pork sample

Table 13, threonine ii group was significantly higher than CK group and iii group, with no significant difference from group i, which was also significantly higher than CK group and iii group; serine I and II are obviously higher than CK, and have no obvious difference with III; the proline group I is obviously higher than the group CK and the group III, and has no obvious difference with the group II; valine II group is obviously higher than CK group and III group, the difference with I group is not obvious, and I group is also obviously higher than CK group; the methionine I group, the methionine II group and the methionine III group are all obviously higher than the methionine CK group; isoleucine group II is obviously higher than group CK and group III, and has no obvious difference with group I, group I is also obviously higher than group CK, and has no obvious difference with group III; the leucine group II is obviously higher than the group CK and the group III, and has no obvious difference with the group I, and the group I is also obviously higher than the group CK and has no obvious difference with the group III; lysine I, II and III groups are all obviously higher than CK group; arginine I, II and III groups are all obviously higher than CK group; the aspartic acid I group and the aspartic acid II group are obviously higher than the aspartic acid CK group and the aspartic acid III group; the glutamic acid group II is obviously higher than the group CK and the group III, the difference between the glutamic acid group II and the group III is not obvious, the glutamic acid group I is also obviously higher than the group CK, and the glutamic acid group III is not obvious; the glycine I group and the glycine II group are obviously higher than the glycine CK group and the glycine III group, and the glycine III group is obviously higher than the glycine CK group; alanine II group is obviously higher than CK group and III group, the difference with I group is not obvious, and I group is obviously higher than CK group; tyrosine I group, tyrosine II group and tyrosine III group are all obviously higher than CK group; phenylalanine group II is obviously higher than group CK, group I and group III, group I is obviously higher than group CK, and the difference with group III is not obvious.

TABLE 14 amino acid content of Shanxi black pork sample

Table 14, aspartic acid group i, group ii were significantly higher than group CK and group iii; the glutamic acid group II is obviously higher than the group CK and the group III, the difference between the glutamic acid group II and the group III is not obvious, the glutamic acid group I is also obviously higher than the group CK, and the glutamic acid group III is not obvious; the glycine I group and the glycine II group are obviously higher than the glycine CK group and the glycine III group, and the glycine III group is obviously higher than the glycine CK group; alanine II group is obviously higher than CK group and III group, the difference with I group is not obvious, and I group is obviously higher than CK group; tyrosine I group, tyrosine II group and tyrosine III group are all obviously higher than CK group; phenylalanine group II is obviously higher than group CK, group I and group III, group I is obviously higher than group CK, and the difference with group III is not obvious.

TABLE 15 amino acid content of Jinyang white pork sample

Table 15, threonine ii group was significantly higher than group i, and was not significantly different from CK and iii groups; valine II group is obviously higher than CK group and III group, and has no obvious difference with I group; the isoleucine group II is obviously higher than the CK group and the III group, and has no obvious difference with the group I; the aspartic acid II group is obviously higher than the CK group and the I group, and has no obvious difference with the III group; the glutamic acid group II is obviously higher than the group CK, and has no obvious difference with the group I and the group III; phenylalanine group ii was significantly higher than group CK, group i and group iii.

TABLE 16 content of amino acids in pork sample

Table 16, aspartic acid group ii was significantly higher than group CK and group i, with no significant difference from group iii; the glutamic acid group II is obviously higher than the group CK, and has no obvious difference with the group I and the group III; phenylalanine group ii was significantly higher than group CK, group i and group iii.

3.4 determination of fatty acids

TABLE 17 fatty acid content of Du Long pork samples

In Table 17, the group of gamma-linolenic acid I is significantly higher than the group of CK, and the difference between the other groups is not significant.

TABLE 18 essential unsaturated fatty acid content of Du grown pork samples

In Table 18, the group of gamma-linolenic acid I is significantly higher than the group of CK, and the difference between the other groups is not significant.

TABLE 19 jin fen pork sample fatty acid content

Table 19, the group of docosahexaenoic acid CK was significantly higher than the group iii, and the differences among the other groups were insignificant.

TABLE 20 essential unsaturated fatty acid content of Shanfen pork sample

Table 20, the respective components are not significant.

TABLE 21 fatty acid content of Shanxi black pork samples

In table 21, in the fatty acid content of the shanxi black pork sample, heptadecanoic acid in group ii was significantly higher than that in group CK, and the difference between the other groups was not significant.

TABLE 22 content of essential unsaturated fatty acids in Shanxi black pork samples

Table 22, the differences between groups were not significant.

TABLE 23 content of fatty acids in pork samples from jin Yang white pigs

In Table 23, the fatty acid content of the pork sample from Jinyang white pig is significantly higher in group II than in group I, and the difference between the other groups is not significant.

TABLE 24 content of essential unsaturated fatty acids in jin Yang white pork sample

Table 24, the differences between groups were not significant.

3.5 determination of Cholesterol content

TABLE 25 Cholesterol content of Du grown pork samples

In Table 25, cholesterol levels in the Jinyang white pig groups I and II were significantly lower than those in the CK group and the III group.

3.6 meat quality-related Gene quantitative determination

TABLE 26 pork sample H-FABP values

In Table 26, the H-FABP values of Shanxi black pigs were not significantly different from those of group I, but significantly higher than those of group CK and group III. The Jinyang white pig group II is obviously higher than the CK group, and is obviously higher than the group III and the group I.

TABLE 27 CAST values for pork samples

Table 27, the CAST value of the pork sample is significantly higher in the shanxi black pig group ii than in the group iii, and the differences among the other groups are not significant; the Jinyang white pig group II is obviously higher than the group I and the group CK, and is extremely obviously higher than the group III, and the group I and the group CK have no obvious difference but are obviously higher than the group III.

TABLE 28 LPL values of pork samples

Table 28, the LPL values of the pork samples were significantly higher in group ii of shanxi black pigs than in group iii of shanxi black pigs, and the differences among the other groups were not significant; the differences of the jin Yang-Bai pig I group, the CK group and the II group are not obvious, but are obviously higher than those of the III group.

TABLE 29 myog values for pork samples

Table 29, the myog values of the pork samples were significantly higher in shanxi black pig group ii than in group iii, and the differences among the other groups were not significant.

TABLE 30 HK values for pork samples

Table 30, the HK value of the pork sample jin yang white pig group ii was significantly higher than that of the group i, and other differences were not significant; the Shanxi black pig group II is obviously higher than the group I, the group II is obviously higher than the group CK and the group III, the group I is obviously higher than the group CK, the group III is obviously higher than the group CK, and the group CK is obviously higher than the group III; the Jinfen white pig group II is obviously higher than the group CK, and is extremely obviously higher than the group III, and the group I is obviously higher than the group CK, the group III, and the group CK is obviously higher than the group III.

TABLE 31 pork sample ATP5B values

Table 31, the differences between the pork sample ATP5B values of shanxi black pigs in group ii, group i and group CK were not significant, and group ii and group i were significantly higher than group iii; the Shanxi white pig group II is obviously higher than the CK group and the III group, the difference between the group II and the group I is not obvious, and the difference between the group I, the group II and the group III is not obvious.

TABLE 32 pork samples PFK values

Table 32, PFK values of pork samples were not significantly different in group ii, group i, and group CK of shanxi black pigs, and group ii was significantly higher than group iii; the Jinfen white pig group II is obviously higher than the CK group, and is extremely obviously higher than the group III, the difference between the group I and the group II is not obvious, and the difference between the group CK and the group III is not obvious.

The experimental results are as follows:

the conductivity difference of the experimental group of the grown Du pigs is obviously lower than that of the CK (control) group, which indicates that the meat of the experimental group is better preserved; the L values (brightness) of the groups I and II are obviously lower than those of the groups CK and III; the B value (yellowness) is obviously higher than that of CK and III groups; the group II has obviously higher cooking loss, obviously lower water binding capacity and obviously lower maximum value of shearing force. The eye muscle areas I and II were significantly higher than those of the other groups. Glutamic acid I and II groups are obviously higher than CK groups, and have no obvious difference with III groups; the glycine II group is obviously higher than the CK group, and the gamma-linolenic acid I group is obviously higher than the CK group.

The difference in conductivity was highest for the shanfen white pig species group iii. The L values of the groups I and II are obviously higher than those of the groups CK and III, the A values of the groups I and II are obviously higher than those of the groups CK and III, and the B values of the groups CK and I are obviously higher than those of the other groups. The cooking loss and the water loss of the groups I and II are obviously lower than those of the other groups. The shear maxima are significantly highest for group iii and significantly lowest for group i. The eye muscle area of the group I and the group II is obviously larger than that of the other groups. The HK value of the pork sample II group is obviously higher than that of the CK group, the HK value of the pork sample II group is extremely obviously higher than that of the pork sample III group, and the HK value of the pork sample I group is obviously higher than that of the pork sample CK group, the HK value of the pork sample III group and that of the pork sample III group, and the HK value. Pork sample ATP5B value Shanfen white pig II group is obviously higher than CK group and III group, II group and I group have no obvious difference, and I group, II group and III group have no obvious difference. The PFK value of the pork sample is obviously higher in II groups of Shanfen white pigs than in CK groups, and is extremely obviously higher in III groups, the difference between the I groups and the II groups is not obvious, and the difference between the CK groups and the III groups is not obvious.

The Shanxi black pig breeds have obviously lower pH 1I and II groups and have little difference of pH 24. The L value (brightness) of group I, II, CK is significantly lower than that of group III, while the A value (redness) and B value (yellowness) of group CK, II are significantly higher. The meat color of the control group and the experimental group is more bright, and the A value (redness) of the III element group is remarkably lower. The conductivity difference of the I, II and III groups is obviously smaller than that of the III group, which indicates that the meat of the test group and the meat of the control group are more beneficial to preservation. The cooking loss and the water binding capacity are not obviously different. Shear force maximum ii is significantly lower than i and CK, which are significantly lower than iii. The eye muscle areas of the group I and the group II are obviously larger than those of the group CK and the group III. Under the condition that the weight of the pigs of the same breed is not different, the larger the eye muscle area is, the higher the lean meat percentage is. The aspartic acid I group and the aspartic acid II group are obviously higher than the aspartic acid CK group and the aspartic acid III group; the glutamic acid group II is obviously higher than the group CK and the group III, the difference between the glutamic acid group II and the group III is not obvious, the glutamic acid group I is also obviously higher than the group CK, and the glutamic acid group III is not obvious; the glycine I group and the glycine II group are obviously higher than the glycine CK group and the glycine III group, and the glycine III group is obviously higher than the glycine CK group; alanine II group is obviously higher than CK group and III group, the difference with I group is not obvious, and I group is obviously higher than CK group; tyrosine I group, tyrosine II group and tyrosine III group are all obviously higher than CK group; phenylalanine group II is obviously higher than group CK, group I and group III, group I is obviously higher than group CK, and the difference with group III is not obvious. H-FABP value II group and I group have no obvious difference, but are obviously higher than CK group and III group. The CAST value of the pork sample is obviously higher in the group II than the group III, and the difference of other groups is not obvious; the LPL value of pork samples in Shanxi black pigs is remarkably higher in group II than group III, and the difference of other groups is not remarkable; the myog value of the pork sample is obviously higher in Shanxi black pig group II than in group III; the HK value of the pork sample is remarkably higher in Shanxi black pig group II than group I, and is remarkably higher than group CK and group III, the group I is remarkably higher than the group CK, and is remarkably higher than the group III, and the group CK is remarkably higher than the group III; pork sample ATP5B values of Shanxi black pigs are not obviously different in group II, group I and group CK, and group II and group I are obviously higher than group III; the PFK values of pork samples of Shanxi black pigs are not obviously different among the II group, the I group and the CK group, and the II group is obviously higher than the III group.

The L value (brightness) of CK group, II group and III group of Jinyang white pig breeds is obviously higher than that of I group, the A value (red degree) of II group and III group is extremely lower, and the B value (yellow degree) of CK group and I group is obviously higher. The conductivity difference of the group I, the group II and the group CK is obviously small. The cooking loss CK and the group I are obviously higher. Group III is significantly higher in water retention. The maximum value of the shearing force is obviously lower in group I than in group CK and group III, and is obviously lower in group CK and group III than in group II; the area of the eye muscle of the group II is obviously higher than that of the other groups; the moisture and crude protein of Jinyang white pigs are obviously different from those of group III, and the aspartic acid group II is obviously higher than those of group CK and group I and is not obviously different from group III; the glutamic acid group II is obviously higher than the group CK, and has no obvious difference with the group I and the group III; phenylalanine group ii was significantly higher than group CK, group i and group iii. The cholesterol of Jinyang white pigs in the I group and the II group is obviously lower than that of the CK group and the III group. The pork sample H-FABP value Jinyang white pig II group is obviously higher than the CK group, and is obviously higher than the III group and the I group. The CAST value of the pork sample Jinyang white pig II group is obviously higher than that of the group I and the group CK, the CAST value of the pork sample is extremely obviously higher than that of the group III, and the difference between the group I and the group CK is not obvious but is obviously higher than that of the group III. The difference of the LPL value of the pork sample of Jinyang white pigs in the I group, CK group and II group is not obvious, but is obviously higher than that of the pork sample of the III group. The difference of myog values of the pork samples is not obvious; the HK value of the pork sample is obviously higher in the II group of Jinyang white pigs than in the I group of pork samples, and other differences are not obvious; the pork sample has no significant difference in ATP5B value; the difference in PFK values of the pork samples was not significant.

The results show that the influence of the Chinese herbal medicine group II on various nutritional factors contained in pork in different pig species is obviously better than that of the Chinese herbal medicine group I, the antibiotic group III and the control group CK. Therefore, the application of the traditional Chinese medicine group II can obviously improve the nutritional quality of the pork and improve the edible nutritional value of the pork.

The application of the Chinese medicaments II group obtains social and economic benefits and popularization and application prospects

(1) The price of the pork improved by the traditional Chinese medicine is doubled compared with that of common pork in the market, the created economic benefit is considerable, eight pig farms are popularized in total at 6200 in the period from 2015 to 2016, the total value in three years is 12852920 yuan, the total profit is 5578985 yuan, and the profit is newly increased by 3156235 yuan in three years.

(2) From the meat of the test pigs, the pork color, the tenderness and the flavor are obviously improved, the unsaturated fatty acid required by human bodies in the muscles is obviously increased, and the cholesterol content is obviously reduced, so that the produced green and safe pork without antibiotic residues has very good social benefits.

(3) And different effects are achieved on the quality improvement of the pork of different varieties in our province.

(4) And China is a big pig-raising country, pork production is the first place in the world, pork is mainly eaten by people from old times, and the pork accounts for more than 65% of the whole pork consumption. Therefore, the quality of pork will have a significant impact on human health. Now, the increase of patients with cerebral and cardiovascular diseases, the increase of the number of people with obesity and the like require pig raising workers to produce not only more pork but also better high-quality pork. Therefore, the ecological pork has wide popularization and application prospect undoubtedly.

Claims

1. A pure natural plant source feed additive for improving pork quality comprises the following raw materials by weight: 12 parts of codonopsis pilosula, 12 parts of bighead atractylodes rhizome, 9 parts of poria cocos, 9 parts of liquorice, 9 parts of pinellia ternate, 9 parts of pericarpium citri reticulatae, 9 parts of radish seed, 9 parts of hawthorn, 9 parts of malt, 9 parts of fructus amomi and 3 parts of costustoot.