CN107043410A - A kind of paddy endosperm silty related gene OsmtSSB and its encoding proteins matter and application - Google Patents

Abstract

The invention belongs to genetic engineering field, it is related to a kind of plant amylum synthesis associated protein OsmtSSB and its encoding gene and application.The protein that the present invention is provided, is the protein of following (a) or (b)：(a) the SEQ ID NO in sequence table：The protein of amino acid sequence composition shown in 3；(b) by SEQ ID NO：3 amino acid sequence is by the substitution and/or missing and/or addition of one or several amino acid residues and related to plant amylum synthesis by SEQ ID NO：Protein derived from 3.The synthesis of starch in the albumen influence albumen of the present invention.The encoding gene of the albumen is imported in the abnormal plant of Starch synthesis, the normal genetically modified plants of Starch synthesis can be cultivated.The albumen and its encoding gene can apply to genetic modification of plants.

Description

A kind of paddy endosperm silty related gene OsmtSSB and its encoding proteins matter and application

Technical field

The invention belongs to genetic engineering field, and in particular to a kind of paddy endosperm silty related gene OsmtSSB and its volume Code protein and application.

Background technology

With the improvement of living standards, people it is also proposed higher and higher requirement to rice quality, and improving quality It is the necessary means for improving China's rice international competitiveness.But at present in China's Rice Production, rice quality is not high, therefore It is to work as the highly important work of previous item to improve quality.

Rice paddy seed accumulates substantial amounts of starch in maturation, is sprouted for seed and seedling development is provided mainly Energy, while these a considerable number of starch also turn into the important food source of the mankind.The number of starch accumulation in rice paddy seed The size and weight of seed are often determined, thus it is directly related with the yield of paddy rice, while amylose and side chain in seed The building-up process that the ratio of starch directly affects starch in the Cooking Quality of rice, therefore research rice has important application Value, carries out its development and the further investigation of hereditary control mechanism, has important meaning to improveing rice quality and improving yield.

Although many enzymes and regulatory factor for participating in Starch synthesis process are accredited out, the mankind still can not profit Vitro system synthetic starch is used, the synthesis of starch is a complexity and fine process, new participation starch in this explanation plant The key factor of synthesis still needs further identification.

Rice fecula mutant includes waxy (waxy, wx), saccharic (sugary, su), silty (floury, flo), shrinkage The type such as (shrunken, sh), dark-coloured (dull, du), core white (white-core, wc).In paddy rice, screening endosperm is extremely prominent Variant (farinaceous albumen) is the important method for finding new Starch synthesis key factor.With molecular biology and molecular genetics The fast development of method and technology, multidigit researcher has carried out assignment of genes gene mapping research to paddy rice silty Endosperm Traits.So far, There are some paddy rice silty genes by finely positioning and clone, but the regulatory mechanism of rice fecula synthesis is not clear, this Us are accomplished by position and clone more Starch synthesis genes further to disclose the mechanism of rice fecula synthesis.

The content of the invention

First purpose of the present invention also provides a kind of albumen of paddy endosperm Starch-synthesizing genes OsmtSSB codings Sequence, its amino acid sequence contains 206 amino acid as shown in SEQ ID NO.3.

It is a further object of the present invention to provide a kind of paddy endosperm Starch-synthesizing genes OsmtSSB nucleotides sequence Row.

The gene OsmtSSB be preferably it is following 1) or 2) or 3) described in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

3) under strict conditions with 1) or 2) the DNA sequence dna hybridization limited and the DNA molecular of encoding said proteins；

1) or 2) or 3) 4) there is more than 90% homology with the DNA sequence dna that limits, and coded plant Starch synthesis is related The DNA molecular of albumen.

Recombinant expression carrier containing gene described in any of the above falls within protection scope of the present invention.

The recombinant expression carrier of the gene can be contained with existing plant expression vector construction.

The plant expression vector includes double base agrobacterium vector and the carrier available for plant micropellet bombardment etc..It is described to plant Thing expression vector can also include 3 ' end untranslated regions of foreign gene, i.e., comprising polyadenylation signals and any other participation MRNA processing or the DNA fragmentation of gene expression.The bootable polyadenylic acid of polyadenylation signals is added to the 3 ' of mRNA precursor End, such as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as kermes synzyme Nos genes), plant gene (such as soybean storage egg White gene) non-translational regions of 3 ' end transcriptions is respectively provided with similar functions.

, can be plus any one before its transcription initiation nucleotides during using the gene constructed recombinant plant expression vector Enhanced promoter or constitutive promoter, such as cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin promoter of corn (Ubiquitin), they can be used alone or are used in combination with other plant promoters；In addition, using the gene of the present invention When building plant expression vector, enhancer, including translational enhancer or transcriptional enhancer are it is also possible to use, these enhancer regions can To be ATG initiation codon or neighboring region initiation codon etc., but must be identical with the reading frame of coded sequence, it is whole to ensure The correct translation of individual sequence.The source of the translation control signal and initiation codon is extensive, can be natural, also may be used Be synthesis.Translation initiation region can come from transcription initiation region or structural gene.

For the ease of transgenic plant cells or plant are identified and screened, plant expression vector used can be carried out Processing, the enzyme of color change or reporter gene (the GUS bases of luminophor can be produced as added the coding that can be expressed in plant Cause, luciferase LUC genes etc.), resistant antibiotic marker (gentamicin label, kanamycins label etc.) Or anti-chemical reagent marker gene (such as anti-herbicide gene).From the security consideration of genetically modified plants, it can be not added with any Selected marker, directly screens transformed plant with adverse circumstance.

The restructuring over-express vector can be with restriction enzyme KpnI and BamHI double digestion carrier PCAMBIA1390 recombination site inserts the recombinant plasmid that the gene (OsmtSSB) obtains.It will contain OsmtSSB's PCAMBIA1390 is named as pCAMBIA1390-OsmtSSB.

Expression cassette and recombinant bacterium containing gene described in any of the above (OsmtSSB) belong to protection scope of the present invention.

The primer pair for expanding the gene (OsmtSSB) total length or any fragment falls within protection scope of the present invention, institute Primer pair preferred Primer1/Primer2, the Primer3/Primer4 stated；Wherein Primer1 nucleotide sequence such as SEQ ID Shown in NO.4, Primer2 nucleotide sequence is as shown in SEQ ID NO.5, Primer3 nucleotide sequence such as SEQ ID Shown in NO.6, Primer4 nucleotide sequence is as shown in SEQ ID NO.7.

The positioning primer (being shown in Table 1) being related to during finely positioning this gene, InDel primers be this experiment needs and The primer of designed, designed, the primer of these designed, designeds falls within protection scope of the present invention.

Beneficial effect

Present invention firstly discovers that, position and clone the gene for obtaining a new albumen silty GAP-associated protein GAP OsmtSSB.The albumen silty GAP-associated protein GAP of the present invention influences the Starch synthesis process of plant.Suppress the protein coding gene Expression can cause the obstacle of Starch synthesis in vegetable seeds, so as to cultivate endosperm variation genetically modified plants and plant form sediment The genetically modified plants of powder content reduction.In the plant that the encoding gene of the albumen is imported to content of starch reduction, it can cultivate The normal plant of content of starch.The albumen and its encoding gene can apply to genetic modification of plants.

Brief description of the drawings

The content of starch that Fig. 1 is wild type N22 and mutant N68 is determined.

Fig. 2 is wild type N22 and mutant N68 seed external form.

Fig. 3 is wild type N22 and mutant N68 seed scanning electron microscopic observations.

Fig. 4 is finely positioning of the mutator on the 5th chromosome.

Fig. 5 is the T for turning pCAMBIA1390-OsmtSSB₀For the T of plant₁Seed phenotype.

Fig. 6 is the T for turning pCAMBIA1390-OsmtSSB₀For the T of plant₁Seed scanning electron microscopic observation.

Embodiment

Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, is conventional method unless otherwise specified.Test material used in following embodiments, is certainly unless otherwise specified What routine biochemistry reagent shop was commercially available.

The discovery of embodiment 1, rice fecula synthesis related locus and its encoding gene

First, paddy endosperm silty mutant N68 content of starch distributional analysis and genetic analysis

In the N22 mutant produced using MNU mutagenesises, an endosperm silty mutant is filtered out, is named as N68.Compared with N22, N68's is mainly characterized by：Content of starch declines (Fig. 1) in seed, while having the opaque table of seed Type (Fig. 2).Fig. 2 shows that N22 has translucent endosperm, and N68 endosperm is opaque.This explanation gene mutation have impact on starch Synthesis, cause the structure and property of amylum body to be changed, endosperm is shown huge difference on apparent.

Scanning electron microscopic observation (see Fig. 3) is carried out to the cross section of wild type and mutant N68 seeds, from 200 times of amplification Photo on, the starch lamellar structure comparison rule of the cross section of wild type seeds is neat, and mutant is more open.Thus may be used To infer, the change of these starch granule structures and arrangement may cause the phenotype of middle endosperm presentation silty.

2nd, the map based cloning of mutant gene locus

1st, the positioning of mutator

First, mutant and normal japonica rice variety Nipponbare cross combination, F have been prepared₁Obtained after a selfing generation F₂Seed.By F₂Seed shells, transparent and opaque for standard progress statistical analysis with phenotype, investigates segregation ratio, as a result shows Show, in F₂(amount to 1235 F in segregating population₂Individual), with wild type phenotype individual (933) and mutation type surface individual (302), meet 3:1 segregation ratio (χ²=0.1687<χ² _0.05,1=3.84).As can be seen here, the mutation is by a pair of recessive bases Because of control.

Then carried out with 10 plants of extremists it is chain, by target gene determine on Chromosome 5 of Rice, utilize laboratory Common primers, increase extremists quantity reduces location area section in 570kb, completing just to position to 130 plants.

Select the F consistent with mutation type surface₂Seed sends out seedling, obtains the blade of 1013 plants of recessive extremists, utilizes public affairs With primer and self-designed primer, most target gene is determined between mark 199-2 and H199-1 at last, sector sizes 86kb (Fig. 4).

The method of above-mentioned SSR marker analysis is as described below：

(1) STb gene of above-mentioned selection individual plant is extracted as template, and specific method is as follows：

1. 0.2g or so paddy rice young leaflet tablet is taken, is placed in 2.0mL Eppendorf pipes, a steel ball is placed in pipe, The Eppendorf pipes for installing sample are freezed 5min in liquid nitrogen, is placed on 2000 type GENO/GRINDER instruments and crushes sample 1min。

2. 660 μ L extract solutions (Tris-HCl containing 100mM (pH 8.0), 20mM EDTA (pH 8.0), 1.4M are added NaCl, 0.2g/mL CTAB solution), acutely it is vortexed on whirlpool device and mixes, ice bath 30min.

3. 40 μ L 20%SDS, 65 DEG C of warm bath 10min, mixing of gently being turned upside down every two minutes are added.

4. 100 μ L 5M NaCl are added, it is gentle to mix.

5. 100 μ L 10 × CTAB, 65 DEG C of warm bath 10min are added, are interrupted mixing of gently turning upside down.

6. 900 μ L chloroforms are added, are fully mixed, 12000rpm centrifugations 3min.

7. transfer supernatant adds 600 μ L isopropanols into 1.5mL Eppendorf pipes, mixes, 12000rpm centrifugations 5min。

8. supernatant is abandoned, precipitation is rinsed once with 70% (V/V) ethanol, room temperature airing.

9. adding 100 1 × TE of μ L, (121g Tris are dissolved in 1 liter of water, and pH value is adjusted to 8.0) dissolving DNA with hydrochloric acid.

10. 2 μ L electrophoresis detection DNA mass are taken, and with DU800 spectrophotometric determinations concentration (Beckman Instrument Inc.U.S.A)。

(2) DNA of said extracted is diluted to about 20ng/ μ L, performing PCR amplification is entered as template；

PCR reaction systems (10 μ L)：DNA (20ng/ μ L) 1 μ L, sense primer (2pmol/ μ L) 1 μ L, anti-sense primer (2pmol/ μ L) 1 μ L, 10 × Buffer (MgCl₂Free) 1 μ L, dNTP (10mM) 0.2 μ L, MgCl₂(25mM) 0.6 μ L, rTaq (5U/ μ L) 0.1 μ L, ddH₂The μ L of O 5.1, totally 10 μ L.

PCR response procedures：94.0 DEG C of denaturation 5min；94.0 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether Circulation 35 times；72 DEG C of extension 7min；10 DEG C of preservations.PCR reactions are carried out in MJ Research PTC-225 thermal cyclers.

(3) the PCR primer detection of SSR marker

Amplified production is analyzed with 8% native polyacrylamide gel electrophoresis.DNA Ladder using 50bp is contrast ratios Compared with the molecular size range of amplified production, silver staining colour developing.

Above-mentioned primer development process is as follows：

(1) SSR marker is developed

The SSR marker of public collection of illustrative plates and Rice Genome Sequence are integrated, the BAC/PAC near mutational site is downloaded Cloned sequence.With SSRHunter (Li Qiang etc., heredity, 2005,27 (5):808-810) or SSRIT online softwares (http:// Archive.gramene.org/db/markers/ssrtool/) potential SSR sequences (number of repetition >=6) in search clone； These SSR and its neighbouring 400~500bp sequence are carried out with corresponding long-grained nonglutinous rice sequence online in NCBI by blast program Compare, if both SSR numbers of repetition it is variant, tentatively infer the SSR primers PCR primer exist between Xian, round-grained rice it is polymorphic Property；The Software for Design SSR primers of Primer Premier 5.0 are recycled, and are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd. The paired primer equal proportions of the SSR of designed, designed are mixed, its polymorphism between N22 and Nipponbare is detected, showed many State person is used as the molecular labeling of finely positioning.Molecular labeling for finely positioning is shown in Table 1.

Table 1 is used for the molecular labeling of finely positioning

2nd, the acquisition of silty gene

By to the sequencing in 86kb intervals, it was found that mtSSB genes have the mutation of a single base,

According to the primers announced on the net, sequence is as described below：

primer1：5'AACGCCGCCAGCCGCCTC 3'(SEQ ID NO.4)；

primer2：5'TTTGAGAGGCCAGCATCAT 3'(SEQ ID NO.5).

Using primer1 and primer2 as primer, using endosperm cDNA in N22 development as template, enter performing PCR amplification acquisition Target gene.Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument：94℃3min；94 DEG C of 30sec, 60 DEG C 45sec, 72 DEG C of 10min, 35 circulations；72℃5min.PMD18-T (TaKaRa) will be connected to after PCR primer recovery purifying, Bacillus coli DH 5 alpha competent cell (Beijing Tiangen company CB101) is converted, selects after positive colony, is sequenced.

Sequencing results show that the fragment that PCR reactions are obtained has the nucleotide sequence shown in SEQ ID NO.2, compiles The protein of 206 amino acid residue compositions of code (see the SEQ ID NO.3 of sequence table).By the albumen shown in SEQ ID NO.3 OsmtSSB is named as, the encoding gene of the albumen shown in SEQ ID NO.3 is named into OsmtSSB.

Embodiment 2, the acquisition and identification of genetically modified plants

First, recombinant expression carrier is built

Genomic DNA using N22 (coming from paddy rice institute of Agricultural University Of Nanjing germplasm resource bank) enters performing PCR amplification as template OsmtSSB genes are obtained, PCR primer sequence is as follows：

primer3：

5'TGGGCCCGGCGCGCCAAGCTTACCATGTTGCCAAATGCC 3'(SEQ ID NO.6)；

primer4：

5'GAATTCCCGGGGATCCCTAGAACAATCCTTCTCCT 3'(SEQ ID NO.7)。

Above-mentioned primer is located at the upstream 2kb and downstream 1.5kb of gene shown in SEQ ID NO.2 respectively, and amplified production is included The startup subdivision of the gene, by PCR primer recovery purifying.PCR is produced using Infusion recombination kits (TaKaRa) Thing is cloned into carrier pCAMBIA1390.Infusion recombining reactions system (10 μ L)：PCR primer 1.0 μ L, pCAMBIA1305 The μ L of 6.0 μ L, 5 × Infusion buffer, 2.0 μ L, Infusion enzyme mix 1.By mixed system 37 after of short duration centrifugation DEG C water-bath 15 minutes, then 50 DEG C of water-baths 15 minutes, takes 2.5 μ L reaction systems heat shock methods to convert bacillus coli DH 5 alpha competence Cell (Beijing Tiangen companies；CB101).Cell will be totally converted it is uniformly coated on the LB solids of the kanamycins containing 50mg/L On culture medium.After 37 DEG C of culture 16h, picked clones positive colony is sequenced.Sequencing result shows, has obtained containing SEQ The recombinant expression carrier of gene shown in ID NO.1, pCAMBIA1390- is named as by the pCAMBIA1390 containing OsmtSSB OsmtSSB, OsmtSSB genetic fragment using Infusion recombination kits (TaKaRa) be inserted into the carrier HindIII and Between BamHI restriction enzyme sites..

2nd, the acquisition of recombinational agrobacterium

PCAMBIA1390-OsmtSSB is converted into Agrobacterium EHA105 bacterial strains (being purchased from handsome company of the U.S.) with electric shocking method, Recombinant bacterial strain is obtained, plasmid is extracted and enters performing PCR and digestion identification.PCR and digestion are identified that correct recombinant bacterial strain is named as EH- pCAMBIA1305-OsmtSSB。

Agrobacterium EHA105 bacterial strains are converted as control vector with pCAMBIA1390, method ibid, obtains turning empty carrier pair According to bacterial strain.

3rd, the acquisition of genetically modified plants

By EH-pCAMBIA1390-OsmtSSB and turn the ripe glutelin content of empty vector control bacterial strain rice transformation respectively Mutant N68 is reduced, specific method is：

(1) 28 DEG C is cultivated EH-pCAMBIA1390-OsmtSSB (or turning empty vector control bacterial strain) 16 hours, collects thalline, And it is OD600 ≈ 0.5 to be diluted in N6 fluid nutrient mediums (Sigma companies, C1416) to concentration, obtains bacterium solution；

(2) the bacterium solution mixed infection to the N68 Mature Embryos of Rice embryo callus of one month and step (1) will be cultivated 30min, filter paper, which is blotted, to be transferred to after bacterium solution in co-cultivation culture medium (N6 solid co-cultivation mediums, Sigma companies), 24 DEG C of trainings altogether Support 3 days；

(3) callus of step (2) is seeded on the N6 solid screening and culturing mediums containing 100mg/L hygromycin and sieved for the first time Select (16 days)；

(4) the healthy callus of picking is transferred to programmed screening on the N6 solid screening and culturing mediums containing 100mg/L hygromycin, often 15 days subcultures are once；

(5) the healthy callus of picking is transferred on the N6 solid screening and culturing mediums containing 50mg/L hygromycin screens for the third time, often 15 days subcultures are once；

(6) picking kanamycin-resistant callus tissue is transferred on differential medium and broken up, and obtains the T of seedling differentiation₀For positive plant.

4th, the identification of transfer-gen plant

1st, PCR Molecular Identifications

In this research transfer-gen plant is identified using Hygromycin marker.

The PCR reaction systems of labeled analysis：DNA (20ng/ μ L) 2 μ L, Primer3 (10pmoL/ μ L) 2 μ L, Primer4 (10pmol/ μ L) 2 μ L, 10 × Buffer (MgCl₂Free) 2 μ L, dNTP (10mM) 0.4 μ L, MgCl₂(25mM) 1.2 μ L, rTaq (5U/ μ L) 0.4 μ L, ddH₂The μ L of O 10, the μ L of cumulative volume 20.

Amplified reaction is carried out in PTC-200 (MJ Research Inc.) PCR instrument：94℃3min；94 DEG C of 30sec, 55 DEG C (primer different, adjusted) 45sec, 72 DEG C of 2.5min, 35 circulations；72℃5min.

PCR primer purifying is reclaimed, and is carried out by kit (Beijing Tiangen companies) step.With 8% Native PAGE glue Separation, silver staining.Determine transgenic positive plant.

2nd, phenotypic evaluation

Respectively by T₀In generation, turns pCAMBIA1390-OsmtSSB positive plants, T₀In generation, turns empty vector control plant, mutant N68 It is planted in N22 in the transgenosis field of Agricultural University Of Nanjing native bridge rice breeding base.After seed maturity, each material seed is collected, It was observed that transparent seed (Fig. 5) is occurred in that in the seed of pCAMBIA1390-OsmtSSB plant, further ESEM point Analysis display, the starch granule morphology for being transferred to pCAMBIA1390-OsmtSSB N68 seeds recovers to normal level (Fig. 6).Therefore Prove that the mutant phenotype in N68 is caused by OsmtSSB mutation.PCAMBIA1390-OsmtSSB can make N68 strains Starch synthesis recovers to normal level.

<110>Agricultural University Of Nanjing

<120>A kind of paddy endosperm silty gene OsmtSSB and its encoding proteins matter and application

<160> 7

<210> 1

<211> 4758

<212> DNA

<213>Oryza paddy rice（Oryza sativa var.N22）

<220>

<223>Endosperm silty gene OsmtSSB gene order

<400> 1

ataactcaac cttttgatct cgctacgaag ctcctccgct ccacccaggc acgagcgccg 60

ccgcggccga ctccaccgga caccacccaa cgccgccagc cgcctcctcc catcctccct 120

cgatccgtac ggatagcctc cccgctcgct cggtctgcgc ccgtcgtcgt cgtcccgccg 180

tcttatccct cccgcgactc ggcgacgcgc gaaggcctcc ggcgcggggc tgaaggtacg 240

tccttttccc gagctcgttc tactgttcca actctgccat ggctgcagtt ttccattttg 300

ggctgggtct gccactgttc tatggggtat gcaactgttg tcgacgtcgc gtgaagcccc 360

tgaatggcca gtgtgcgatg cttgcaaggt gtttgttaaa atgtctcggt agaatatctt 420

ggaccgtttg catattttat ccatgcaaag tttagtccag taggctgtta atttttctgt 480

gattgcctat ttagatttta ggtggtgtta attcagcctc ctgaagaggg tggttattgg 540

atactacgat cctagaatgc cgctgcagct tagctaggcg gatcagccgc ttaggcaggt 600

agagcagctt ccttgtcttg gccggatgtc gtccctgagg ttccaacgga atggagctgc 660

tgtagctgaa taagaccata agttgttttt gtgcaggaaa gaataagcag aactgtcatg 720

gaactcctct gcactgttga gacaaacctg ggatgcctca tcataaagaa taagtgtctc 780

ccacgtgata ggccatcctg atgcacctta tttcctcatg tagttttttc cttgtagaag 840

gtcacactga acaaatgctt ttgagaatag aactgctacc aggaaaatgt tgaatgaagt 900

tgacgactgt gatgtttatg ttgttttgaa atccattaaa ggaataggaa aaaaatatat 960

gttctgatga ttatttttat gattttatta tttaacgttt ttcctcaatg tgcgtagatt 1020

taccatgaat tctctcagca atggattact gaagggcttg aggagggtct tagaacagca 1080

gagaaaacca attggtgggt tgtttttcat ggttgtttca agatttctac tcagttttta 1140

ctgagtaagt tttgattaaa tatttgtctg tgtagatttc tacagaaaat ctcaagcttg 1200

gagttctact gtttcctttt ctgatattga tgagaagagt gaaatgggag gtgatgatga 1260

ttatacagat tcaagacgag agttagaacc ccaaagcgta gaccccaaga agggctgggg 1320

attccgtggt gttcacaggg tatttaagta taatatgaaa aggatacttc atgttttggt 1380

tttcaagctt aacttggtat taattgattg tttcaacttt ctaggctata atatgcggaa 1440

aagtcggaca ggttcctgtg cagaaaattt taaggaatgg tcgtacagtg actgttttta 1500

cagttggaac tggtggcatg tttgaccaga gggtagtagg ggatgcagat ctgccaaagc 1560

cagctcagtg gcatcggata gccattcata atgaccagct aggtgctttt gctgtccaga 1620

agctggtgaa gaagtacgtg gtttcagtga gaagatcacc ctttttcttt tctccataca 1680

agtatacaac tatataccat ttcctagttc tatggcttga aattcttttt tactgtggtt 1740

ggtgctgtct ttgttcttgc cttatttcag ttctgcagtt tatgttgagg gtgatattga 1800

aaccagagta tacaatgaca gcattaatga tcaagtgaaa aatataccag agatttgtct 1860

tcgacgcgat ggtatgttga tctgccattc cactagaaac tttgtggtag taatatttta 1920

tagcaagaat aaataacgtt tgaagtttga acaattttct cggggtaact ccataactct 1980

gttaccaaac tggacacaga agcctgctgc tttgtttaat tatactgcat ttgagtaatg 2040

ttgatagcta ttcttttgta cttatttatt ttgattgtct ttgttgttgt aaaagcttat 2100

ccttggaaaa atatttatat gtacaggtaa gattcggctg attaaatctg gcgagagtgc 2160

tgctagcatt tcattagatg agctaagtaa gttcactgaa aaccttaata ttctgattta 2220

tgagaatctt gcattacttg tatttgttgt gattatgcaa ctatgattgg tctccacaat 2280

tatctgcatg cagatgtcca gtgttttaga ttttagtatt taccatttaa tcatgacaac 2340

ctttgtatgc aggagaagga ttgttctagt ttgaaagatc tcagcacaag caggccagga 2400

gtacaggcat gtttcaactc ttttgttgat tgttttaaca gtattaggat tttgacttct 2460

aagaagtgtc catgcaccct gttagctgtg ggtcatgtgt tttttattaa tttgaacttg 2520

aaatgtgcat attgtgaatt atctgtagaa caccttcagc tttcaatcaa gcatttccct 2580

gccaatactt atctgtcatt gattggtgcc tcgtgctatc tttcagtaga aagtgatatt 2640

ttgatgcctt taccaggctc atttcttcat aagtttctca tagcgtggta ttttacttgt 2700

atcgcgtctt catcttaatg aaatatgttg ttacaacttc agcttgttac ataagggtga 2760

ttacaaatta taagaaatgt catagattca cggatcttgc gaatcaaata ttacaaacct 2820

ggaatggtag agtacctaat tctatttata tttcttcact ctatttgtac atgttgctga 2880

tagattctcc ctggggtatt tgtacatgaa tagttgcaca gtgacaatct taggccaatt 2940

tgttcaatga ttttaagaat gtaagacact gaaccataac tagtctctag ttggtggaat 3000

aaaagtgatc acttgtcatt attaattttc atcatagatc atcaaaatca attaggtgag 3060

aaacaaacct ctgagtaaat attctcgagt ggcgaagaag aacacaggat aacctgcatg 3120

ttcacacaaa agcatagtat ctcttgtcaa cgaagtttgt agatcttcat gctgaaatgt 3180

tgtgatcttg aaacttattc atatgaccaa attgtattta cacttgacat gttgccaggg 3240

aatataaaag gtaatactag taaattaact gttgagtagg ttgagagaaa tcttacatca 3300

gtcacaccct tatctaaaag cataattctg atgttcttcg ctttggaacc ttgtcaattg 3360

tcaccaagta agaatgggtg tgcttttgat ggtatttcag gctttacctt atcctttgac 3420

ctctttctga gcatctcctt catgccatcc gccaccttga ctgcagggct tgatagtgcc 3480

atcctgcaga atgccatatg agctttgata gcatcttcga tgccatcctg ttctcttctg 3540

tctttactga gctcatcccc taccgcctct gagcataagc cacaaagcca tttccctccg 3600

aagtttgcct tgacattctc tatgtattcc tgggtgcaat cctcttccag gccacagcac 3660

gcacacctca ctgattcaat gtccatcttc aatgctgatg cctgatggaa agaggactaa 3720

aagaacaata gtagatgcat gggagtagag aaggagaaag aaggtgggag aaggcaaata 3780

gaaggaaaca gtatggagtt caggactagg ttgctgcttg tgtggataat ttttgtagac 3840

ctctccttcc ttttggattg gcttgtttag cttggtatgt tattgaaatt ttgagatttg 3900

cccagaccca tagtatcttc aacagtgtac tacctcgtga aagaataaga aagataatat 3960

gatttttttg atgcctacca gtttcctagg taaaaatata ggaaaccgta gttcacatga 4040

ctgcaactgt gttgaaggta aaggcaggag caggttccca tagcctgaat tagctagtac 4100

agttttgttt ttcctgtgtg aagacgcacg atggatgaca aataaacatg ctataagatc 4160

caaatgaaaa tgcaaaagaa aagttattcc catatctaaa aattgtatac ttgatcacat 4220

gcggtcaatt agccatctac atatgcacat tacaaagaac acaacacaag cttatctacc 4280

tttagtgaag gagtgggggc atatcaccat cacattagct tatcctttta cgacagtata 4320

aatttcaatg attttgtttt atataagtct ttacatgatg atgtctttaa aggttgttac 4380

atgcctaata tgtgtgatat atactagaaa tgtcagacac ctggtttcta acgcaacaac 4440

cttgtttagg ttgattactg aaatgtcgca ctcctaatat tagtcgcatc gccttcgttt 4500

gtacgtatat acttttctgg gcaggtcgta acctgtttat ctgtgcatta ttaggttcaa 4560

aagataaagt ggatacgtgc aggctcaacg atgatgctgg cctctcaaag aaaagaaaaa 4620

cgacgatgct gcttcaccga agcgaaattt gttgtagcag gcatgtgaac cttgtcctgg 4680

ccgcccttcc agtcgtattt tcattatcaa catcctttaa tgtactcttg attaacatct 4740

tagcagtcaa atttacag 4758

<210> 2

<211> 621

<212> DNA

<213>Oryza paddy rice（Oryza sativa var.N22）

<220>

<223>Endosperm silty gene OsmtSSB CDS sequences

<400> 2

atgaattctc tcagcaatgg attactgaag ggcttgagga gggtcttaga acagcagaga 60

aaaccaattg atttctacag aaaatctcaa gcttggagtt ctactgtttc cttttctgat 120

attgatgaga agagtgaaat gggaggtgat gatgattata cagattcaag acgagagtta 180

gaaccccaaa gcgtagaccc caagaagggc tggggattcc gtggtgttca cagggctata 240

atatgcggaa aagtcggaca ggttcctgtg cagaaaattt taaggaatgg tcgtacagtg 300

actgttttta cagttggaac tggtggcatg tttgaccaga gggtagtagg ggatgcagat 360

ctgccaaagc cagctcagtg gcatcggata gccattcata atgaccagct aggtgctttt 420

gctgtccaga agctggtgaa gaattctgca gtttatgttg agggtgatat tgaaaccaga 480

gtatacaatg acagcattaa tgatcaagtg aaaaatatac cagagatttg tcttcgacgc 540

gatggtaaga ttcggctgat taaatctggc gagagtgctg ctagcatttc attagatgag 600

ctaagagaag gattgttcta g 621

<210> 3

<211> 513

<212> PRT

<213>Oryza paddy rice（Oryza sativa var.N22）

<220>

<223>Endosperm silty gene OsmtSSB amino acid sequences

<400> 3

Met Asn Ser Leu Ser Asn Gly Leu Leu Lys Gly Leu Arg Arg Val Leu

1 5 10 15

Glu Gln Gln Arg Lys Pro Ile Asp Phe Tyr Arg Lys Ser Gln Ala Trp

20 25 30

Ser Ser Thr Val Ser Phe Ser Asp Ile Asp Glu Lys Ser Glu Met Gly

35 40 45

Gly Asp Asp Asp Tyr Thr Asp Ser Arg Arg Glu Leu Glu Pro Gln Ser

50 55 60

Val Asp Pro Lys Lys Gly Trp Gly Phe Arg Gly Val His Arg Ala Ile

65 70 75 80

Ile Cys Gly Lys Val Gly Gln Val Pro Val Gln Lys Ile Leu Arg Asn

85 90 95

Gly Arg Thr Val Thr Val Phe Thr Val Gly Thr Gly Gly Met Phe Asp

100 105 110

Gln Arg Val Val Gly Asp Ala Asp Leu Pro Lys Pro Ala Gln Trp His

115 120 125

Arg Ile Ala Ile His Asn Asp Gln Leu Gly Ala Phe Ala Val Gln Lys

130 135 140

Leu Val Lys Asn Ser Ala Val Tyr Val Glu Gly Asp Ile Glu Thr Arg

145 150 155 160

Val Tyr Asn Asp Ser Ile Asn Asp Gln Val Lys Asn Ile Pro Glu Ile

165 170 175

Cys Leu Arg Arg Asp Gly Lys Ile Arg Leu Ile Lys Ser Gly Glu Ser

180 185 190

Ala Ala Ser Ile Ser Leu Asp Glu Leu Arg Glu Gly Leu Phe

195 200 205

<210> 4

<211> 18

<212> DNA

<213>Artificial sequence

<220>

<223> Primer1

<400> 4

aacgccgcca gccgcctc 18

<210> 5

<211> 18

<212> DNA

<213>Artificial sequence

<220>

<223> Primer2

<400> 5

tttgagaggc cagcatcat 18

<210> 6

<211> 39

<212> DNA

<213>Artificial sequence

<220>

<223> Primer3

<400> 6

tgggcccggc gcgccaagct taccatgttg ccaaatgcc 39

<210> 7

<211> 35

<212> DNA

<213>Artificial sequence

<220>

<223> Primer4

<400> 7

gaattcccgg ggatccctag aacaatcctt ctcct 35

Claims (10)

1. a kind of protein, it is characterised in that selected from any as shown in (a) or (b)：

(a) protein being made up of the amino acid sequence shown in SEQ ID NO.3；

(b) by SEQ ID NO.3 amino acid sequence by one or several amino acid residues substitution and/or missing and/or Addition and the protein as derived from sequence 1 related to Starch synthesis.

2. encode the gene of albumen described in claim 1.

3. gene according to claim 2, it is characterised in that：The gene be it is following 1) or 2) or 3) or 4) shown in DNA molecular：

1) DNA molecular shown in SEQ ID NO.1；

2) DNA molecular shown in SEQ ID NO.2；

1) or 2) 3) DNA points under strict conditions with albumen described in the DNA sequence dna hybridization limited and coding SEQ ID NO.3 Son；

1) or 2) or 3) 4) there is more than 90% homology, and the DNA of coding Starch synthesis GAP-associated protein GAP with the DNA sequence dna that limits Molecule.

4. recombinant expression carrier, expression cassette or recombinant bacterium containing gene described in Claims 2 or 3.

5. recombinant expression carrier according to claim 4, it is characterised in that：The recombinant expression carrier be The weight that gene described in inserting Claims 2 or 3 between the multiple cloning sites HindIII and BamHI of pCAMBIA1390 carriers is obtained Group plasmid.

6. expand the total length or the primer pair of its any fragment of gene described in Claims 2 or 3, it is characterised in that be selected from Any pair in Primer1/Primer2, Primer3/Primer4；Wherein Primer1 nucleotide sequence such as SEQ ID Shown in NO.4, Primer2 nucleotide sequence is as shown in SEQ ID NO.5, Primer3 nucleotide sequence such as SEQ ID Shown in NO.6, Primer4 nucleotide sequence is as shown in SEQ ID NO.7.

7. albumen described in claim 1, gene described in Claims 2 or 3, recombinant expression carrier, expression cassette described in claim 4 Or the application of at least one of recombinant bacterium in plant breeding.

8. application according to claim 7, it is characterised in that albumen described in claim 1, base described in Claims 2 or 3 Cause, at least one of recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium described in claim 4 are cultivating shallow lake Powder synthesizes the application in normal genetically modified plants.

9. a kind of method for cultivating the normal genetically modified plants of Starch synthesis, is by channel genes starch described in Claims 2 or 3 In resulting anomaly plant, the normal genetically modified plants of Starch synthesis are obtained；The abnormal plant performance of the Starch synthesis is endosperm Opaque, starch granule morphology is irregular, arranges loose, declines with total starch content；The normal plant of Starch synthesis, The transparent not shrinkage of seed, reaches the genetically modified plants of the level of wild type.

10. method according to claim 9, it is characterised in that：Gene described in Claims 2 or 3 by claim 4 or Recombinant expression carrier described in 5 is imported in the abnormal plant of Starch synthesis.