CN106967608A - Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof - Google Patents
Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof Download PDFInfo
- Publication number
- CN106967608A CN106967608A CN201611043674.5A CN201611043674A CN106967608A CN 106967608 A CN106967608 A CN 106967608A CN 201611043674 A CN201611043674 A CN 201611043674A CN 106967608 A CN106967608 A CN 106967608A
- Authority
- CN
- China
- Prior art keywords
- gra17
- strain
- insect
- worm
- infection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
- C07K14/45—Toxoplasma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the weak poisonous insect mutant strain of the Infection of Toxoplasma Gondii of one plant of GRA17 gene delection, the weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of described GRA17 gene delections is LZ △ GRA17, is deposited in China typical culture collection center, and deposit number is CCTCC NO：V201656；And there is provided its preparation method.Beneficial effects of the present invention are：Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii for one plant of GRA17 gene delection that the present invention is provided and preparation method thereof, it is built upon on molecular biology mechanism, based on CRISPR/Cas9 gene Knockouts, the gene delection worm strain of structure, there is toxicity to weaken for worm strain, and lose biological characteristics to the lethal of mouse, be the worm strain being worth with huge applications, can as attenuated live vaccine the strain of candidate worm.
Description
Technical field
The present invention relates to the weak poisonous insect strain technical field of Infection of Toxoplasma Gondii, and in particular to the Infection of Toxoplasma Gondii of one plant of GRA17 gene delection is weak
Poisonous insect mutant strain and preparation method thereof.
Background technology
Toxoplasmosis（Toxoplasmosis）It is a kind of parasitic zoonoses as caused by Infection of Toxoplasma Gondii.The whole world there are about
1/3rd population is infected by it, Infection of Toxoplasma Gondii can infect that almost all of warm-blooded animal, infectiousness are strong, Epidemic Scope is big,
Host range is wide, there is no vaccine can use at present, thus prevents and treats the sick difficulty greatly, and the requirement to Prevention Technique is very high.In view of medicine
Toxoplasmosis is limited in one's ability and the characteristics of big toxic side effect for thing treatment, develops its vaccine and has been increasingly becoming prevention and control Infection of Toxoplasma Gondii patient's condition and exists
The significant task that must be gone.At present, the type of resisting toxoplasmosis vaccine mainly includes full worm（Go out）Live vaccine, polypide specific components epidemic disease
The live vector vaccines such as seedling, subunit vaccine, virus and albumen and nucleic acid vaccine etc., however most of vaccines be not it is highly desirable,
In order to strengthen immune effect, immune protective rate is improved, the vaccine development of attenuated live vaccine is by as an important research topic.
Dense granule（Dense Granules, DG）It is the indispensable important component of the infection host of Infection of Toxoplasma Gondii, fine and close
Albumen secreted by grain is called dense granule protein（GRAs）, dense granule protein exists in the form of solvable albumen composition
In in dense granule, have research represent it be constitute toxoplasma tachyzoite receive worm vacuole membrane it is gentle grow ascus wall it is main into
Point.Important modification opsonic action is played in Na Chongpao forming process, and it is relevant with the network structure in bubble, it is polypide energy
Enough pivotal players survived and replicated in the cell.Immunocytochemical study discloses it in toxoplasma tachyzoite, bradyzoite bag
All be distributed on capsule and enteral phase polypide pellicle, it is follow-up it is multiple grind make internal disorder or usurp confirmation its be respectively provided with Infection of Toxoplasma Gondii acute and chronic infection it is stronger
Immunogenicity, body can be induced to produce obvious, long-acting humoral and cellular immune response response, arch insect infection is resisted.With
The dense granule protein constantly found, also deepens continuously to its research.It was found that some albumen are good in GRA protein families
Virulence factor, take part in the invasion and duplication of Infection of Toxoplasma Gondii, and GRA17 is exactly an important virulence factor, therefore build GRA17 house
The Toxoplasma gondii Strains of race's gene delection will be expected to screen the attenuated live vaccine worm strain with potential using value.At present in the world
Only Infection of Toxoplasma Gondii attenuated live vaccine that can be listed is S48, but it is only limitted to the application to goat and sheep.
The content of the invention
There is provided the bow of one plant of GRA17 gene delection aiming at above-mentioned defect of the prior art for the purpose of the present invention
Weak poisonous insect mutant strain of shape worm and preparation method thereof.
To achieve these goals, the technical scheme that provides of the present invention is：The weak poison of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection
Worm mutant strain, the weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of described GRA17 gene delections is LZ △ GRA17 (Toxoplasma gondil
LZ △ GRA17), China typical culture collection center is deposited in, preservation date is on November 14th, 2016, and preservation address is：
Wuhan Wuhan University, postcode 430072, deposit number is CCTCC NO：V201656.
Second object of the present invention there is provided the weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of above-mentioned one plant of GRA17 gene delection
Preparation method, comprises the following steps：
A）pSAG1::Cas9-U6::Sg GRA17 plasmid constructions：
1）It is GACTGTCCCTGAGGACCCAT using webpage Software for Design GRA17 sgRNA；
2）GRA17 sgRNA is replaced into pSAG1 using Q5 site-directed mutagenesis kits and amplimer::Cas9-U6:: sgUPRT
SgUPRT in carrier is built into pSAG1::Cas9-U6::Sg GRA17, amplimer is gRNA-Fw:
GACTGTCCCTGAGGACCCATGTTTTAGAGCTAGAAATAGC and gRNA-Rv: AACTTGACATCCCCATTTAC；
3）PCR conditions are:With pSAG1::Cas9-U6::SgUPRT is template, is carried out using primer gRNA-Fw and gRNA-Rv
pSAG1::Cas9-U6::The PCR of sgGRA17 carriers is expanded, and reaction condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation
1min, 55 DEG C of renaturation 1min；72 DEG C of extension 5min；25 circulations；
4）KLD reacts：Reaction system is μ l, the 10X KLD Enzyme of 1 μ l, 2X KLD Reaction Buffer of PCR primer 5
Mix 1 μ l, ddH2O 3μl；Reacted 5 minutes under 25 degree of room temperature；
5）Conversion：Above-mentioned KLD reaction products are transformed into bacillus coli DH 5 alpha, some single bacterium colonies of picking, extract plasmid, sequencing
Identification.Correctly mark is for sequencing::Cas9-U6:: sgGRA17；
B）Plasmid is carried greatly：
1）Picking contains pSAG1::Cas9-U6::The positive bacterium solution of sgGRA17 plasmids is selected in the LB solids of the Amp+ containing 1000U/mL
A single bacterium colony on culture medium on line, 37 DEG C of overnight incubations, picking plate is selected to be placed in 4 mL LB liquid selective mediums,
37 DEG C of shaking table, 180~220rpm cultivates 12~16h, by above-mentioned culture bacterium solution with 1：100 ratio is inoculated into equipped with 100mL LB
In the 500mL conical flasks of culture medium, 37 DEG C of shaking table, 180~220rpm overnight incubations；
2）Bacterial cultures is placed in ice or several minutes of 4 DEG C of refrigerators, 4 DEG C, 9500rpm centrifugation 5min collect bacterial cultures
Precipitation, abandons supernatant, and being inverted centrifuge tube makes supernatant try one's best outflow, and thalline is resuspended in the Solution I of 10mL precoolings, and vortex vibrates, made
Bacterium is completely dispersed in Solution I；
3）The Solution II that 20mL is newly prepared, jog and mixing 3~5 times of turning upside down are added, 15mL precoolings are added
Solution III, jog is mixed immediately, in order to avoid produce localized precipitation, on ice or -20 DEG C of refrigerators place 10min, plus
Solution II and Solution III time interval controls are within 5min, in order to avoid undue cracking；4 DEG C or room temperature,
11000rpm centrifuges 10min, filters supernatant using 5 layers of gauze, is transferred in two new 50mL centrifuge tubes；
4）Supernatant and 0.6 times of volume isopropanol are mixed, and room temperature places 10min；At room temperature, 11000rpm centrifuges 10min, abandons
Clearly, blank pipe is inverted on filter paper 3-5 minutes, removes remaining, addition 3mL ddH2O fully dissolves, and adds the 5M of 3mL precoolings
LiCl solution, is fully mixed, and two centrifuge tubes are merged into a pipe, ice or -20 DEG C of refrigerators place 10min；4 DEG C or room temperature,
11000rpm centrifuges 10min, supernatant is transferred to respectively in a new 50mL centrifuge tubes, adds the isopropanol of isometric precooling, fills
Divide and mix, room temperature places 10min；4 DEG C or room temperature, 11000rpm centrifugation 10min, abandon supernatant, and inversion drains liquid in pipe, is inverted
10~15min.Now white depositions i.e. plasmid occurs in tube wall；
5）Add 3mL ddH2O or pH8.0 TE solution dissolving precipitation, and add 30 μ L 10mg/mL RNase A, 37 DEG C of water
Bathe 1h and remove RNA, add in 2 times of volume absolute ethyl alcohols and the 3M NaAc solution of 1/10 volume, fully mixing, ice or -20 DEG C of ice
Case places 20min；4 DEG C, 11000rpm centrifugation 10min suction out supernatant, and centrifuge tube is inverted on filter paper drained, and add
100μL ddH2O or pH8.0 TE solution, fully elution plasmid precipitation, utilize the concentration of plasmid obtained by spectrophotometer measurement
And record, coating-dividing sealing is saved backup after -20 DEG C；
C）DHFR-Ts* resistances Marker amplification：
1）Utilize primer DHFR-Fv：AAGCTTCGCCAGGCTGTAAA and DHFR-Rv：GGAATTCATCCTG
CAAGTGCATAG expands DHFR-Ts* resistant genes, and reaction condition is as follows：94 DEG C of pre-degeneration 5min, 94 DEG C are denatured 1min, 55
DEG C sec of renaturation 30；72 DEG C of extension 3min30sec；30 circulations；
2）Purpose fragment is reclaimed using OMEGA plain agars sugar gel DNA QIAquick Gel Extraction Kits, using obtained by spectrophotometer measurement
The concentration and record of PCR primer, coating-dividing sealing are saved backup after -20 DEG C；
D）The transfection of Infection of Toxoplasma Gondii electric shock and acquisition positive monoclonal：
1）I types worm strain RH is inoculated in 75T HFF cells, when insect cell lysis 75%, scraped polypide with cell sleaker
Rise, cross the intracellular insect of 22G 3-5 release of syringe needle；
2）Above-mentioned insect is filtered using 3.0 μm of filters and removes cell fragment, and then the min centrifuging and takings precipitation of 400g × 10, is utilized
HBSS buffer are resuspended, the min centrifuging and takings precipitation of then 400g × 10；Then insect is resuspended with Cytomix buffer makes its concentration
Reach 4 × 107Individual/ml, Cytomix buffer are matched：120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4/
KH2PO4, 25 mM HEPES, 2 mM EDTA, 5 mM MgCl2, pH 7.6；
3）Rotaring redyeing system includes：The μ g of 250 μ l, DHFR-Ts* resistance gene fragment of RH insect Cytomix mixed liquors 1.5,
pSAG1::Cas9-U6::SgGRA17 carriers 7.5 μ g, 0.2 M, 100 × ATP3 μ l, 0.5 M, 100 × the μ of glutathione 3
L, Cytomix totally 300 μ l；Rotaring redyeing system is transferred into 4mm electric shock cups using BTX ECM-830 electroporations progress electricity to turn, electricity turns
Program is：The V of voltage 1700, shock by electricity the μ s of time 176, and twice, then the ms of midfeather 100 turns the insect that electricity turns electric shock
Move on in 25T HFF cells；
4）In 37 DEG C, 5% CO2After incubator culture 48h, 3 μM of pyrimethamine is added, approximately passes through 7-10 days and finds drug resistance worm
Son.
5）The screening of drug-resistant worm plant is carried out using limiting dilution assay, the insect of drug resistance is inoculated according to 5-10 per hole
96 orifice plates, in 37 DEG C, 5% CO2Incubator culture 7-10 days, in micro- sem observation pityriasis simplex, chooses the inoculation for only having 1 pityriasis simplex per hole
Expand culture into 24 orifice plates；
6）Repeat step 5）Limiting dilution assay, to worm strain carry out monoclonal, obtain purity be 100% genetic background it is identical
Some strains of worm strain；
7）The strain of the worm of above-mentioned purifying is inoculated into 24 orifice plates and expands culture, the insect of culture draw a part to 1.5ml from
In heart pipe, the genome of worm strain is extracted；
8）The positive worm strain of PCR identifications, following primer is used by gene-deleted strain and the genome of wild worm strain simultaneously： KO-GRA17-
F:TCTACAAGCACGCAGAAAGGA and R:CGAACCGGAAGTTACCACGAC is expanded, and reaction condition is as follows：94℃
Pre-degeneration 5min, 94 DEG C of denaturation 1min, 55 DEG C of sec of renaturation 30；72 DEG C of extension 1min；30 circulations, are expanded by electrophoresis detection
Increase production thing, detection wild strain and mutant strain；
9）Corresponding positive colony is inoculated into from 24 holes in 25T HFF and expands culture, and freezes in liquid nitrogen and protects for a long time
Deposit.
The GRA17 gene nucleotide series of missing are as shown in SEQ No.1 and Fig. 3 in sequence table.
Beneficial effects of the present invention are：The weak poisonous insect mutant strain of Infection of Toxoplasma Gondii for one plant of GRA17 gene delection that the present invention is provided
And preparation method thereof, it is built upon on molecular biology mechanism, based on CRISPR/Cas9 gene Knockouts, the gene of structure
Worm strain is lacked, there is toxicity to weaken for worm strain, and lose the biological characteristics to the lethal of mouse, be with huge applications valency
Value worm strain, can as attenuated live vaccine candidate worm strain.
Brief description of the drawings
Fig. 1 is shown as the structure flow of gene-deleted strain.
Fig. 2 is shown as the PCR qualification results of mutant strain.
Fig. 3 is shown as the GRA17 gene nucleotide series of missing.
Embodiment
Embodiment 1：
The weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection, the weak poisonous insect of Infection of Toxoplasma Gondii of described GRA17 gene delections dashes forward
Mutant is LZ △ GRA17, is deposited in China typical culture collection center, and deposit number is CCTCC NO：V201656.
The preparation method of the weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of above-mentioned one plant of GRA17 gene delection, as shown in figure 1, including with
Lower step：
First, pSAG1::Cas9-U6::Sg GRA17 plasmid constructions：
1st, it is GACTGTCCCTGAGGACCCAT using webpage Software for Design GRA17 sgRNA.
2nd, Q5 site-directed mutagenesis kits (NEB) and amplimer are utilized（gRNA-Fw: GACTGTCCCTGAGGACCCAT
G TTTTAGAGCTAGAAATAGC and gRNA-Rv: AACTTGACATCCCCATTTAC）GRA17 sgRNA is replaced
pSAG1::Cas9-U6::SgUPRT is built into pSAG1 in sgUPRT carriers::Cas9-U6:: sg GRA17.
3rd, PCR conditions are:With pSAG1::Cas9-U6::SgUPRT is template, utilizes primer gRNA-Fw and gRNA-Rv
Carry out pSAG1::Cas9-U6::The PCR amplifications of sgGRA17 carriers.Reaction condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation
1min, 55 DEG C of renaturation 1min；72 DEG C of extension 5min；25 circulations.
4th, KLD reacts.Reaction system is 1 μ l, 2X KLD Reaction Buffer of PCR primer 5 μ l, 10X KLD
Enzyme mix 1 μ l, ddH2O 3μl；Reacted 5 minutes under 25 degree of room temperature.
5th, convert.Reaction product in above-mentioned 2.2 is transformed into bacillus coli DH 5 alpha, some single bacterium colonies of picking, extracted
Plasmid, sequencing identification.Correctly mark is for sequencing::Cas9-U6:: sgGRA17.
2nd, plasmid is carried greatly：
1st, picking contains pSAG1::Cas9-U6::The positive bacterium solution of sgGRA17 plasmids is in LB（Amp+ containing 1000U/mL, similarly hereinafter）
Rule on solid selection medium, 37 DEG C of overnight incubations.A single bacterium colony on picking plate is placed in 4 mL LB liquid selective cultures
In base, 37 DEG C of shaking table, 180~220rpm cultivates 12~16h.By above-mentioned culture bacterium solution with 1：100 ratio, which is inoculated into, to be equipped with
In the 500mL conical flasks of 100mL LB culture mediums, 37 DEG C of shaking table, 180~220rpm overnight incubations.
2nd, bacterial cultures is placed in ice or several minutes of 4 DEG C of refrigerators, 4 DEG C, 9500rpm centrifugation 5min collect bacterium training
Thing precipitation is supported, supernatant is abandoned, being inverted centrifuge tube makes supernatant try one's best outflow.Thalline is resuspended in the Solution I of 10mL precoolings, and vortex shakes
Swing, bacterium is completely dispersed in Solution I.
3rd, the Solution II that 20mL is newly prepared, jog and mixing 3~5 times of turning upside down are added.Add 15mL precoolings
Solution III, immediately jog mix, in order to avoid produce localized precipitation.On ice or -20 DEG C of refrigerators place 10min.Plus
Solution II and Solution III time interval controls are within 5min, in order to avoid undue cracking.4 DEG C or room temperature,
11000rpm centrifuges 10min, filters supernatant using 5 layers of gauze, is transferred in two new 50mL centrifuge tubes.
4th, supernatant and 0.6 times of volume isopropanol（15mL）Mix, room temperature places 10min.At room temperature, 11000rpm is centrifuged
10min, abandons supernatant, and blank pipe is inverted in into several minutes several minutes on filter paper, removes remaining.Add 3mL ddH2O fully dissolves（Very
It is important）, the 5M LiCl solution of 3mL precoolings is added, is fully mixed（It can not blow and beat）.Two centrifuge tubes are merged into a pipe, ice
Or -20 DEG C of refrigerators place 10min.Supernatant is transferred to a new 50mL centrifugations by 4 DEG C or room temperature, 11000rpm centrifugation 10min respectively
Guan Zhong, is added isometric（12mL）The isopropanol of precooling, is fully mixed, and room temperature places 10min.4 DEG C or room temperature, 11000rpm from
Heart 10min, carefully abandons supernatant, and inversion drains liquid in pipe, is typically inverted 10~15min.Now white occurs in tube wall
Sediment is plasmid.
5th, 3mL ddH are added2O or TE solution（pH8.0）Dissolving precipitation, and add 30 μ L 10mg/mL RNase A, 37
DEG C water-bath 1h removes RNA.Add 2 times of volumes（8mL）Absolute ethyl alcohol and 1/10 volume（300μL）3M NaAc solution, it is fully mixed
It is even, in ice or -20 DEG C of refrigerators place 20min.4 DEG C, 11000rpm centrifugation 10min carefully suction out supernatant（Do not fall）, and will be from
Heart pipe is inverted on filter paper and drained（It is extremely important）.Add 100 μ L ddH2O or TE solution（pH8.0）, fully elute plasmid and sink
Form sediment.Using the concentration and record of plasmid obtained by spectrophotometer measurement, coating-dividing sealing is saved backup after -20 DEG C.
3rd, DHFR-Ts* resistances Marker amplification：
1st, primer DHFR-Fv is utilized：AAGCTTCGCCAGGCTGTAAA and DHFR-Rv：GGAATTCATCCTG
CAAGTGCATAG expands DHFR-Ts* resistant genes.Reaction condition is as follows：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 1min,
55 DEG C of sec of renaturation 30；72 DEG C of extension 3min30sec；30 circulations.
2nd, purpose fragment is reclaimed according to the operation instruction of the sugared gel DNA QIAquick Gel Extraction Kits of OMEGA plain agars.Utilize light splitting
The concentration and record of PCR primer obtained by photometer measurement, coating-dividing sealing are saved backup after -20 DEG C.
4th, the transfection of Infection of Toxoplasma Gondii electric shock and acquisition positive monoclonal：
1st, type worm strain RH is inoculated in 75T HFF cells, when insect cell lysis 75%, swept polypide with cell sleaker,
Cross the intracellular insect of 22G 3-5 release of syringe needle.
2nd, filter above-mentioned insect using 3.0 μm of filter and remove cell fragment, then the min centrifuging and takings precipitation of 400g × 10,
Then it is resuspended using HBSS buffer, the min centrifuging and takings precipitation of then 400g × 10.Then Cytomix buffer are used（120 mM
KCl, 0.15 mM CaCl2 , 10 mM K2HPO4/KH2PO4, 25 mM HEPES, 2 mM EDTA, 5 mM MgCl2 ,
pH 7.6）Insect, which is resuspended, makes its concentration reach 4 × 107Individual/ml.
3rd, rotaring redyeing system as shown in table 1, is transferred to 4mm electric shock cups and entered using BTX ECM-830 electroporations by rotaring redyeing system
Row electricity turns, and electric carryover sequence is as follows（The V of voltage 1700, the electric shock μ s of the time 176 shocks by electricity twice, the ms of midfeather 100）, then
The insect that electricity turns is transferred in 25T HFF cells.
Table 1
4th, at 37 DEG C, 5 % CO2After incubator culture 48h, 3 μM of pyrimethamine is added, approximately passes through 7-10 days and finds drug resistance
Insect.
5th, the screening of drug-resistant worm plant is carried out using limiting dilution assay, the insect of drug resistance is inoculated according to 5-10 per hole
96 orifice plates, in 37 DEG C, 5 % CO2Incubator culture 7-10 days, in micro- sem observation pityriasis simplex, chooses and only has connecing for 1 pityriasis simplex per hole
Plant and expand culture into 24 orifice plates.
6th, the limiting dilution assay of the 5th step is repeated, monoclonal is carried out to worm strain, the genetic background that purity is 100% is obtained
Some strains of identical worm strain.
7th, the worm strain of above-mentioned purifying is inoculated into expand in 24 orifice plates and cultivated, the insect of culture draws a part and arrives 1.5ml
Centrifuge tube in, extract the worm strain genome, according to RH strain of Toxoplasma gondii DNA extract specific method, specific steps reference
Promega companies kit Wizard SV Genomic DNA Purification System operation instructions are carried out.
8th, the positive worm strain of PCR identifications.Gene-deleted strain and the genome of wild worm strain are used into following primer simultaneously： KO-
GRA17-F:TCTACAAGCACGCAGAAAGGA and R:CGAACCGGAAGTTACCACGAC is expanded.Reaction condition is such as
Under：94 DEG C of pre-degenerations 5min, 94 DEG C of denaturation 1min, 55 DEG C of sec of renaturation 30；72 DEG C of extension 1min；30 circulations.Pass through electricity
Whether swimming detection amplified production, detection mutant strain successfully constructs, as shown in Figure 1：Wild strain can amplify band, and gene-deleted strain does not have
There is band.
9th, corresponding positive colony is inoculated into expand in 25T HFF from 24 holes and cultivated, and frozen long-term in liquid nitrogen
Preserve.
5th, virulence determination.
Because this gene-deleted strain is that parent is transformed with RH plants of I type velogen strains, the worm plant not variance in form, so not having
There is the detection for carrying out packing, focus on the research of the decrease of its virulence.
Virulence determination is carried out to missing worm strain LZ △ GRA17, wild worm strain, missing worm strain is respectively adopted；Using 10,103、
104These three different dosage carry out challenge viral dosage to BABL/c mouse, and every group of 20 mouse observe the morbidity and death of mouse
Situation.As a result show 10,103、104Gene-deleted strain can not cause the death of mouse under these three dosage.And wild strain 10,
103、104Dead mouse is caused under these three dosage, even if again under minimum dose, 20 mouse are also all dead at 7-8 days.
It is enough to illustrate that missing GRA17 can cause I types worm strain virulence significantly to weaken.Therefore the gene-deleted strain can turn into one plant for I types
The candidate worm strain of the attenuated live vaccine of Infection of Toxoplasma Gondii.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention,
Although the present invention is described in detail with reference to the foregoing embodiments, for those skilled in the art, it still may be used
To be modified to the technical scheme described in foregoing embodiments, or equivalent substitution is carried out to which part technical characteristic.
Within the spirit and principles of the invention, any modification, equivalent substitution and improvements made etc., should be included in the present invention's
Within protection domain.
Sequence table
<110>Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
<120>Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof
<210> 1
<211> 1325
<212> DNA
<213>The GRA17 gene nucleotide series of missing
<400> 1
atgaaatcgg gcagttgccc tttcacgttt tcgcccactc tttctcaccc tcttgaaata 60
gcctggcgag ctcgtccact tcagtggccg gaaatcgaac gccagcccga accagctgct 120
ccctgtggcg cgttgtatcc cgcatctcgc gttctgtcct tttcacccac gatgcgagcg 180
attcgttccg ttgtcggcct tcccgttatg ggggctgcag ttttcttggg acttctcagc 240
ggagaactgc ccaactcctc cgtgttgccc gtccccgagg tggcgagcac ccccttcctc 300
ctcagcgtcg ccgctgacgg cgatggcggc aaaaactatg cggaagtcgc caaggtggaa 360
gcgttgacaa atatgatcag cactcccatt gagctcttcg tgaaggacgt ctggcaacag 420
ctgttccata aatctggcaa gcccgtgtgg gaaaacatgt tgttcaaggt aagtgcttga 480
ccgagactcg gtaggagtga ccgagtgcgt ggcgcgacgc tgaaaaacag tttaggtgat 540
acgcatctgg gatgcagcag agaagaaacc gttgggaagc tgtcgtcggg gagcagacac 600
tgtacaggtt caaggaaacg caactcatgt agtcgtatcg tgttgcggca tacgggcgca 660
cagccaacat tgcgtgtaaa tctcaaagga cgcgtcttca gacgcagggg ttctcatgcc 720
ttttatgaac ctctgcttac attttgctta catttctgca ggcgtttgat accaatccag 780
ggacgaacca ttcgtttgtt ccggggagtg ttccgttttc gcgcgcgtgc gtggtatttt 840
cgtcgttgta tcatcctggg ttttgtttct gcgcgtcgcc ttttctgcag tttggcagta 900
tgatccgaca ccgcgccgca cacaaggcca ctctcgtgat catgtgggaa ctgaggcact 960
tcctgtatgg cactgccaaa gtgaacccct cggcgtggaa gaagttggag accaagttcg 1020
agagctattt gcgtgagtgg tggatgactg tccctgagga cccatgggct gcactgcatg 1080
caggggcgtg gaagtcgctc ctcaagctgt acaacgaaga cctggagccg cttctgagag 1140
gcagcccgaa gctgaaggac ctggagagta tcctgttcga ctcgaagctg gcgacgatcc 1200
gcagatggac cgacgaggcc cacatcgaag tgatgaaggg ccggacttct aacatggttc 1260
ctcggcttga ggccctgagt gcgaagatgg ccgtgaagca gaaggccatg cagggcaagc 1320
agtga 1325
Sequence table
<110>Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
<120>Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof
<210> 1
<211> 1325
<212> DNA
<213>The GRA17 gene nucleotide series of missing
<400> 1
atgaaatcgg gcagttgccc tttcacgttt tcgcccactc tttctcaccc tcttgaaata 60
gcctggcgag ctcgtccact tcagtggccg gaaatcgaac gccagcccga accagctgct 120
ccctgtggcg cgttgtatcc cgcatctcgc gttctgtcct tttcacccac gatgcgagcg 180
attcgttccg ttgtcggcct tcccgttatg ggggctgcag ttttcttggg acttctcagc 240
ggagaactgc ccaactcctc cgtgttgccc gtccccgagg tggcgagcac ccccttcctc 300
ctcagcgtcg ccgctgacgg cgatggcggc aaaaactatg cggaagtcgc caaggtggaa 360
gcgttgacaa atatgatcag cactcccatt gagctcttcg tgaaggacgt ctggcaacag 420
ctgttccata aatctggcaa gcccgtgtgg gaaaacatgt tgttcaaggt aagtgcttga 480
ccgagactcg gtaggagtga ccgagtgcgt ggcgcgacgc tgaaaaacag tttaggtgat 540
acgcatctgg gatgcagcag agaagaaacc gttgggaagc tgtcgtcggg gagcagacac 600
tgtacaggtt caaggaaacg caactcatgt agtcgtatcg tgttgcggca tacgggcgca 660
cagccaacat tgcgtgtaaa tctcaaagga cgcgtcttca gacgcagggg ttctcatgcc 720
ttttatgaac ctctgcttac attttgctta catttctgca ggcgtttgat accaatccag 780
ggacgaacca ttcgtttgtt ccggggagtg ttccgttttc gcgcgcgtgc gtggtatttt 840
cgtcgttgta tcatcctggg ttttgtttct gcgcgtcgcc ttttctgcag tttggcagta 900
tgatccgaca ccgcgccgca cacaaggcca ctctcgtgat catgtgggaa ctgaggcact 960
tcctgtatgg cactgccaaa gtgaacccct cggcgtggaa gaagttggag accaagttcg 1020
agagctattt gcgtgagtgg tggatgactg tccctgagga cccatgggct gcactgcatg 1080
caggggcgtg gaagtcgctc ctcaagctgt acaacgaaga cctggagccg cttctgagag 1140
gcagcccgaa gctgaaggac ctggagagta tcctgttcga ctcgaagctg gcgacgatcc 1200
gcagatggac cgacgaggcc cacatcgaag tgatgaaggg ccggacttct aacatggttc 1260
ctcggcttga ggccctgagt gcgaagatgg ccgtgaagca gaaggccatg cagggcaagc 1320
agtga 1325
Claims (2)
1. the weak poisonous insect mutant strain of the Infection of Toxoplasma Gondii of one plant of GRA17 gene delection, it is characterised in that described GRA17 gene delections
The weak poisonous insect mutant strain of Infection of Toxoplasma Gondii is LZ △ GRA17, is deposited in China typical culture collection center, deposit number is CCTCC
NO：V201656.
2. the preparation method of the weak poisonous insect mutant strain of the Infection of Toxoplasma Gondii of one plant of GRA17 gene delection according to claim 1, it is special
Levy and be, comprise the following steps：
A）pSAG1::Cas9-U6::Sg GRA17 plasmid constructions：
1）It is GACTGTCCCTGAGGACCCAT using webpage Software for Design GRA17 sgRNA；
2）GRA17 sgRNA is replaced into pSAG1 using Q5 site-directed mutagenesis kits and amplimer::Cas9-U6:: sgUPRT
SgUPRT in carrier is built into pSAG1::Cas9-U6::Sg GRA17, amplimer is gRNA-Fw:
GACTGTCCCTGAGGACCCATGTTTTAGAGCTAGAAATAGC and gRNA-Rv: AACTTGACATCCCCATTTAC；
3）PCR conditions are:With pSAG1::Cas9-U6::SgUPRT is template, is carried out using primer gRNA-Fw and gRNA-Rv
pSAG1::Cas9-U6::The PCR of sgGRA17 carriers is expanded, and reaction condition is：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation
1min, 55 DEG C of renaturation 1min；72 DEG C of extension 5min；25 circulations；
4）KLD reacts：Reaction system is μ l, the 10X KLD Enzyme of 1 μ l, 2X KLD Reaction Buffer of PCR primer 5
Mix 1 μ l, ddH2O 3μl；Reacted 5 minutes under 25 degree of room temperature；
5）Conversion：Above-mentioned KLD reaction products are transformed into bacillus coli DH 5 alpha, some single bacterium colonies of picking, extract plasmid, sequencing
Identification；Correctly mark is for sequencing::Cas9-U6:: sgGRA17；
B）Plasmid is carried greatly：
1）Picking contains pSAG1::Cas9-U6::The positive bacterium solution of sgGRA17 plasmids is selected in the LB solids of the Amp+ containing 1000U/mL
A single bacterium colony on culture medium on line, 37 DEG C of overnight incubations, picking plate is selected to be placed in 4 mL LB liquid selective mediums,
37 DEG C of shaking table, 180~220rpm cultivates 12~16h, by above-mentioned culture bacterium solution with 1：100 ratio is inoculated into equipped with 100mL LB
In the 500mL conical flasks of culture medium, 37 DEG C of shaking table, 180~220rpm overnight incubations；
2）Bacterial cultures is placed in ice or several minutes of 4 DEG C of refrigerators, 4 DEG C, 9500rpm centrifugation 5min collect bacterial cultures
Precipitation, abandons supernatant, and being inverted centrifuge tube makes supernatant try one's best outflow, and thalline is resuspended in the Solution I of 10mL precoolings, and vortex vibrates, made
Bacterium is completely dispersed in Solution I；
3）The Solution II that 20mL is newly prepared, jog and mixing 3~5 times of turning upside down are added, 15mL precoolings are added
Solution III, jog is mixed immediately, in order to avoid produce localized precipitation, on ice or -20 DEG C of refrigerators place 10min, plus
Solution II and Solution III time interval controls are within 5min, in order to avoid undue cracking；4 DEG C or room temperature,
11000rpm centrifuges 10min, filters supernatant using 5 layers of gauze, is transferred in two new 50mL centrifuge tubes；
4）Supernatant and 0.6 times of volume isopropanol are mixed, and room temperature places 10min；At room temperature, 11000rpm centrifuges 10min, abandons
Clearly, blank pipe is inverted on filter paper 3-5 minutes, removes remaining, addition 3mL ddH2O fully dissolves, and adds the 5M of 3mL precoolings
LiCl solution, is fully mixed, and two centrifuge tubes are merged into a pipe, ice or -20 DEG C of refrigerators place 10min；4 DEG C or room temperature,
11000rpm centrifuges 10min, supernatant is transferred to respectively in a new 50mL centrifuge tubes, adds the isopropanol of isometric precooling, fills
Divide and mix, room temperature places 10min；4 DEG C or room temperature, 11000rpm centrifugation 10min, abandon supernatant, and inversion drains liquid in pipe, is inverted
10~15min；Now white depositions i.e. plasmid occurs in tube wall；
5）Add 3mL ddH2O or pH8.0 TE solution dissolving precipitation, and add 30 μ L 10mg/mL RNase A, 37 DEG C of water-baths
1h removes RNA, adds in 2 times of volume absolute ethyl alcohols and the 3M NaAc solution of 1/10 volume, fully mixing, ice or -20 DEG C of refrigerators
Place 20min；4 DEG C, 11000rpm centrifugation 10min suction out supernatant, and centrifuge tube is inverted on filter paper drained, and add 100
μL ddH2O or pH8.0 TE solution, fully elution plasmid precipitation, utilize the concentration and note of plasmid obtained by spectrophotometer measurement
Record, coating-dividing sealing is saved backup after -20 DEG C；
C）DHFR-Ts* resistances Marker amplification：
1）Utilize primer DHFR-Fv：AAGCTTCGCCAGGCTGTAAA and DHFR-Rv：GGAATTCATCCTG
CAAGTGCATAG expands DHFR-Ts* resistant genes, and reaction condition is as follows：94 DEG C of pre-degeneration 5min, 94 DEG C are denatured 1min, 55
DEG C sec of renaturation 30；72 DEG C of extension 3min30sec；30 circulations；
2）Purpose fragment is reclaimed using OMEGA plain agars sugar gel DNA QIAquick Gel Extraction Kits, using obtained by spectrophotometer measurement
The concentration and record of PCR primer, coating-dividing sealing are saved backup after -20 DEG C；
D）The transfection of Infection of Toxoplasma Gondii electric shock and acquisition positive monoclonal：
1）I types worm strain RH is inoculated in 75T HFF cells, when insect cell lysis 75%, scraped polypide with cell sleaker
Rise, cross the intracellular insect of 22G 3-5 release of syringe needle；
2）Above-mentioned insect is filtered using 3.0 μm of filters and removes cell fragment, and then the min centrifuging and takings precipitation of 400g × 10, is utilized
HBSS buffer are resuspended, the min centrifuging and takings precipitation of then 400g × 10；Then insect is resuspended with Cytomix buffer makes its concentration
Reach 4 × 107Individual/ml, Cytomix buffer are matched：120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4/
KH2PO4, 25 mM HEPES, 2 mM EDTA, 5 mM MgCl2, pH 7.6；
3）Rotaring redyeing system includes：The μ g of 250 μ l, DHFR-Ts* resistance gene fragment of RH insect Cytomix mixed liquors 1.5,
pSAG1::Cas9-U6::SgGRA17 carriers 7.5 μ g, 0.2 M, 100 × ATP3 μ l, 0.5 M, 100 × the μ of glutathione 3
L, Cytomix totally 300 μ l；Rotaring redyeing system is transferred into 4mm electric shock cups using BTX ECM-830 electroporations progress electricity to turn, electricity turns
Program is：The V of voltage 1700, shock by electricity the μ s of time 176, and twice, then the ms of midfeather 100 turns the insect that electricity turns electric shock
Move on in 25T HFF cells；
4）In 37 DEG C, 5% CO2After incubator culture 48h, the pyrimethamine for adding 3 μM approximately passes through 7-10 days discovery drug resistance worms
Son；
5）The screening of drug-resistant worm plant is carried out using limiting dilution assay, the insect of drug resistance is inoculated in 96 holes according to 5-10 per hole
Plate, in 37 DEG C, 5% CO2Incubator culture 7-10 days, in micro- sem observation pityriasis simplex, choose only have 1 pityriasis simplex per hole be inoculated into 24
Expand culture in orifice plate；
6）Repeat step 5）Limiting dilution assay, to worm strain carry out monoclonal, obtain purity be 100% genetic background it is identical
Some strains of worm strain；
7）The strain of the worm of above-mentioned purifying is inoculated into 24 orifice plates and expands culture, the insect of culture draw a part to 1.5ml from
In heart pipe, the genome of worm strain is extracted；
8）The positive worm strain of PCR identifications, following primer is used by gene-deleted strain and the genome of wild worm strain simultaneously： KO-GRA17-
F:TCTACAAGCACGCAGAAAGGA and R:CGAACCGGAAGTTACCACGAC is expanded, and reaction condition is as follows：94℃
Pre-degeneration 5min, 94 DEG C of denaturation 1min, 55 DEG C of sec of renaturation 30；72 DEG C of extension 1min；30 circulations, are expanded by electrophoresis detection
Increase production thing, detection wild strain and mutant strain；
9）Corresponding positive colony is inoculated into from 24 holes in 25T HFF and expands culture, and freezes in liquid nitrogen and protects for a long time
Deposit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611043674.5A CN106967608A (en) | 2016-11-24 | 2016-11-24 | Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611043674.5A CN106967608A (en) | 2016-11-24 | 2016-11-24 | Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106967608A true CN106967608A (en) | 2017-07-21 |
Family
ID=59334605
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611043674.5A Pending CN106967608A (en) | 2016-11-24 | 2016-11-24 | Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106967608A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109999188A (en) * | 2019-03-13 | 2019-07-12 | 中国农业科学院兰州兽医研究所 | For preventing the RH of arch insect infection: Δ NPT1 attenuated live vaccine and its preparation method and application |
| CN109999189A (en) * | 2019-03-13 | 2019-07-12 | 中国农业科学院兰州兽医研究所 | For preventing the RH of arch insect infection: Δ tkl1 attenuated live vaccine and its preparation method and application |
| CN110384797A (en) * | 2019-09-02 | 2019-10-29 | 中国农业科学院兰州兽医研究所 | A kind of attenuated live vaccine and its application for preventing arch insect infection |
| CN111172037A (en) * | 2020-01-17 | 2020-05-19 | 中国农业大学 | Neosporozoon attenuated strain with PUF1 gene deletion and construction method and application thereof |
| CN111304088A (en) * | 2020-02-24 | 2020-06-19 | 中南大学 | Toxoplasma gondii wx2 gene deletion strain, construction method and application |
| CN111607521A (en) * | 2020-05-13 | 2020-09-01 | 中国农业大学 | AP2IV-1 gene-deleted toxoplasma gondii attenuated live vaccine and construction method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009058712A1 (en) * | 2007-10-29 | 2009-05-07 | Trustees Of Dartmouth College | Toxoplasma gondii mutant with enhanced homologous recombination and uses thereof |
-
2016
- 2016-11-24 CN CN201611043674.5A patent/CN106967608A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009058712A1 (en) * | 2007-10-29 | 2009-05-07 | Trustees Of Dartmouth College | Toxoplasma gondii mutant with enhanced homologous recombination and uses thereof |
Non-Patent Citations (4)
| Title |
|---|
| BANG SHEN等: "Efficient Gene Disruption in Diverse Strains of Toxoplasma gondii", 《MBIO》 * |
| DANIEL A GOLD等: "The Toxoplasma dense granule proteins GRA17 and GRA23 mediate the movement of small molecules between the host and the parasitophorous vacuole", 《CELL HOST MICROBE》 * |
| TATSUNORI MASATANI等: "TgGRA23, a novel Toxoplasma gondii dense granule protein associated with the parasitophorous vacuole membrane and intravacuolar network", 《PARASITOLOGY INTERNATIONAL》 * |
| 陈艳: "《食源性寄生虫病的危害与防制》", 30 September 2010, 贵州科技出版社 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109999188A (en) * | 2019-03-13 | 2019-07-12 | 中国农业科学院兰州兽医研究所 | For preventing the RH of arch insect infection: Δ NPT1 attenuated live vaccine and its preparation method and application |
| CN109999189A (en) * | 2019-03-13 | 2019-07-12 | 中国农业科学院兰州兽医研究所 | For preventing the RH of arch insect infection: Δ tkl1 attenuated live vaccine and its preparation method and application |
| CN110384797A (en) * | 2019-09-02 | 2019-10-29 | 中国农业科学院兰州兽医研究所 | A kind of attenuated live vaccine and its application for preventing arch insect infection |
| CN111172037A (en) * | 2020-01-17 | 2020-05-19 | 中国农业大学 | Neosporozoon attenuated strain with PUF1 gene deletion and construction method and application thereof |
| CN111304088A (en) * | 2020-02-24 | 2020-06-19 | 中南大学 | Toxoplasma gondii wx2 gene deletion strain, construction method and application |
| CN111607521A (en) * | 2020-05-13 | 2020-09-01 | 中国农业大学 | AP2IV-1 gene-deleted toxoplasma gondii attenuated live vaccine and construction method thereof |
| CN111607521B (en) * | 2020-05-13 | 2022-07-05 | 中国农业大学 | Toxoplasma attenuated live vaccine lacking AP2IV-1 gene and construction method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106967608A (en) | Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof | |
| Maguire et al. | Molecular epidemiology of outbreaks of gastroenteritis associated with small round-structured viruses in East Anglia, United Kingdom, during the 1996–1997 season | |
| Toplin et al. | Biogeographic and phylogenetic diversity of thermoacidophilic cyanidiales in Yellowstone National Park, Japan, and New Zealand | |
| Ebert et al. | Development, life cycle, ultrastructure and phylogenetic position of Pasteuria ramosa Metchnikoff 1888: rediscovery of an obligate endoparasite of Daphnia magna Straus | |
| Reinhold-Hurek et al. | Living inside plants: bacterial endophytes | |
| CN106701763A (en) | CRISPR/Cas9 targeted knockout human hepatitis B virus P gene and specific gRNA thereof | |
| CN109825457B (en) | Salt-tolerant bacillus E40207a2 and application thereof | |
| CN107916232B (en) | Recombined broad spectrum green muscardine fungus and its preparation method and application | |
| CN109536458A (en) | For treating and controlling the method and composition of plant disease | |
| CN105132350B (en) | The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application | |
| CN110512008A (en) | Detect multiple PCR reagent kit and its application of a kind of common ten food-borne pathogens | |
| CN105296534B (en) | The method and its application of black fruit fructus lycii Establishment of Agrobacterium-Mediated Transformation System | |
| CN106754380A (en) | Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of CDPK2 gene delection and preparation method thereof | |
| CN106244602A (en) | A kind of carry two G genes and the recombinant rabies virus of VP2 gene and application thereof | |
| CN114807060A (en) | Coxsackie virus A6 type strain and immunogenic composition and application thereof | |
| Qiao et al. | Neodactylariales, Neodactylariaceae (Dothideomycetes, Ascomycota): new order and family, with a new species from China | |
| CN110423762A (en) | A kind of construction method of PVMV full length infectious cDNA | |
| CN107384868A (en) | Immortalize structure and its application of primary sheep pneumonocyte system | |
| CN107653230A (en) | A kind of II type pseudoabies poison strain and its application | |
| CN104789597B (en) | A kind of vitro construction method of silkworm cytoplasmic polyhedrosis virus | |
| CN109852573A (en) | A19 brucella VjbR deletion mutation strain building and application | |
| CN104761639B (en) | ScFv antibody, its encoding gene and its application in preparing treatment or prevention hepatitis B preparation | |
| CN103952431B (en) | Agrobacterium tumefaciens mediated gene transformation method of botryosphaeria dothidea | |
| CN109247328B (en) | LDH-dsRNA nanocrystallization preparation and preparation method and application thereof | |
| CN102465145B (en) | Shuttle vector pSHK4 for escherichia coli and haemophilus parasuis, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170721 |