CN104761639B - ScFv antibody, its encoding gene and its application in preparing treatment or prevention hepatitis B preparation - Google Patents
ScFv antibody, its encoding gene and its application in preparing treatment or prevention hepatitis B preparation Download PDFInfo
- Publication number
- CN104761639B CN104761639B CN201510181163.9A CN201510181163A CN104761639B CN 104761639 B CN104761639 B CN 104761639B CN 201510181163 A CN201510181163 A CN 201510181163A CN 104761639 B CN104761639 B CN 104761639B
- Authority
- CN
- China
- Prior art keywords
- sequence
- antibody
- variable region
- chain variable
- hepatitis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a kind of scFv antibody, its encoding gene and its preparing the application in treating or preventing hepatitis B preparation.The single-chain antibody is made of heavy chain variable region, light chain variable region and the bonding pad between them；The amino acid sequence of the heavy chain variable region be in sequence table sequence 1 from N-terminal the 1st 127；The amino acid sequence of the light chain variable region be in sequence table sequence 1 from N-terminal the 143rd 255.The single-chain antibody of the present invention has the following advantages that compared with blood product：Immune serum is not needed, solves the problems, such as to be restricted due to the shortage of immune serum source；Avoid the danger of blood product HBIG Emperical Bayesian methods；The essence of the present invention belongs to people's source protein matter, may be directly applied to immunological rejection of the human body without causing body；It is adapted to large-scale industrial production, yield can be improved, reduce cost.
Description
Technical field
The invention belongs to genetic engineering field, it is related to a kind of scFv antibody, its encoding gene and its is preparing treatment or pre-
Application in anti-hepatitis B preparation.
Background technology
Hepatitis B is the worldwide disease caused by hepatitis type B virus (HBV), and the whole world carries hepatitis B surface according to statistics
The number of antigen (HbsAg) is more than 2.8 hundred million.China is the high Prevalent district of hepatitis B, has the crowd of 40-60% to receive HBV infection, about
There are 1.2 hundred million people's Hepatitis B carrier surface antigens.Virus can be transmitted to newborn by the pregnant and lying-in women of Hepatitis B carrier.And life
More early infection hepatitis B is easier forms persistent carriers, can not only cause chronic liver disease, a portion that can also send out
Transform into hepatic sclerosis and liver cancer.
Preventing hepatitis B, there are two types of biological products：One is hepatitis B vaccines, it is possible to provide active immunity, it is front and back for contacting
Prevention.Another kind is Hepatitis B immunoglobulin (HBIG), provides temporary passive protection effect, is used for certain contacts
The prevention of crowd afterwards.It is applied alone hepatitis B vaccine to reach 50-75% to the blocking efficiency of mother-to-baby transmission, and is joined with HBIG and hepatitis B vaccine
It closes and is immunized, Interruption of Vertical Transmission rate can be made to reach 97% or more.In addition, HBIG can be also used for the prevention of hepatitis B and meaning after transfusing blood
The urgent prevention of outer accident clinically also obtains preferable effect with HBIG treatments hepatitis B.In short, HBIG is a kind of prevention hepatitis B
Important product.Its effect in terms of hepatitis b precaution and passive immunotherapy is affirmative.
The domestic and international HBIG overwhelming majority used comes from for a long time acquires height after hepatitis b vaccine immune Healthy People
Made of valence blood plasma or serum separation and Extraction immunoglobulin, belong to blood product.It is constantly found since blood passes disease in recent years,
There is certain potential dangers using HBIG for large area.Since ministry of Health of China door in 1996 is forbidden to use the blood system of HBIG
After product, the urgent prevention of the prevention for hepatitis B after blood transfusion at present and contingency lacks effective precautionary measures.
Invention content
It is an object of the present invention to provide a kind of single-chain antibodies.
Single-chain antibody provided by the present invention is the single-chain antibody for being specific to hepatitis B surface antigen pre-s1 protein, is named as
Anti-preS1scFv, by heavy chain variable region, light chain variable region and can for connecting the heavy chain variable region and the light chain
Become the bonding pad composition in area；
The amino acid sequence of the heavy chain variable region is concretely following (a) or (b)：
(a) in sequence table sequence 1 from N-terminal 1-127；
(b) (a) is passed through into the substitution of one or several amino acid residues and/or lacks and ors add and there is identical work
Property by its derivative amino acid sequence；
The amino acid sequence of the light chain variable region is concretely following (c) or (d)：
(c) in sequence table sequence 1 from N-terminal 143-255；
(d) (c) is passed through into the substitution of one or several amino acid residues and/or lacks and ors add and there is identical work
Property by its derivative amino acid sequence.
The bonding pad is preceding 15 amino acid of the heavy chain constant region CH1 of human antibody；Specifically, the human antibody
The sequence of preceding 15 amino acid of heavy chain constant region CH1 be following (e) or (f)：
(e) in sequence table sequence 1 from N-terminal 128-142；
(f) (e) is passed through into the substitution of one or several amino acid residues and/or lacks and ors add and there is identical work
Property by its derivative amino acid sequence.
Further, the single-chain antibody is concretely following (g) or (h)：
(g) protein shown in sequence in sequence table 1；
(h) (g) is passed through into the substitution of one or several amino acid residues and/or lacks and ors add and there is identical work
Property by its derivative protein.
For the ease of the purifying of anti-preS1scFv antibody, can in by sequence table sequence 1 amino acid residue sequence
The upper label as shown in the table of amino terminal or carboxyl terminal connection of the protein of composition.
Table：The sequence of label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being usually 5) | RRRRR |
| Poly-His | 2-10 (being usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
The nucleic acid molecules for encoding the single-chain antibody also belong to protection scope of the present invention.
The nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also be
RNA, such as mRNA, hnRNA or tRNA.
In one embodiment of the invention, the nucleic acid molecules are specially the gene for encoding the single-chain antibody；It is described
In gene, the DNA molecular for encoding the heavy chain variable region can be following (1) or (2) or (3)：
(1) sequence 2 of sequence table DNA molecular shown in the nucleotide of 5 ' end 1-381；
(2) DNA with identical active albumen points of the DNA sequence dna hybridization limited under strict conditions with (1) and coding
Son；
(3) DNA sequence dna limited with (1) or (2) at least with 90% or more homology and is encoded with identical active
The DNA molecular of albumen；
In the gene, the DNA molecular for encoding the light chain variable region can be following (4) or (5) or (6)：
(4) sequence 2 of sequence table DNA molecular shown in the nucleotide of 5 ' end 427-768；
(5) DNA with identical active albumen points of the DNA sequence dna hybridization limited under strict conditions with (4) and coding
Son；
(6) DNA sequence dna limited with (4) or (5) at least with 90% or more homology and is encoded with identical active
The DNA molecular of albumen.
In the gene, the DNA molecular for encoding the bonding pad can be following (7) or (8) or (9)：
(7) sequence 2 of sequence table DNA molecular shown in the nucleotide of 5 ' end 382-426；
(8) DNA with identical active albumen points of the DNA sequence dna hybridization limited under strict conditions with (7) and coding
Son；
(9) DNA sequence dna limited with (7) or (8) at least with 90% or more homology and is encoded with identical active
The DNA molecular of albumen.
Further, the gene is specially following (10) or (11) or (12)：
(10) DNA molecular shown in the sequence 2 of sequence table；
(11) DNA of DNA sequence dna hybridization and coding with identical active albumen limited under strict conditions with (10)
Molecule；
(12) DNA sequence dna limited with (10) or (11) at least with 90% or more homology and is encoded with identical activity
Albumen DNA molecular.
Above-mentioned stringent condition can be with 6 × SSC, and the solution of 0.5%SDS hybridizes at 65 DEG C, then with 2 × SSC,
It is primary that 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film.
Wherein, sequence 2 is made of 768 nucleotide, single-chain antibody shown in sequence 1 in polynucleotide.
Expression cassette, recombinant vector, transgenic cell line or recombinant bacterium containing the nucleic acid molecules also belong to the present invention's
Protection domain.
Wherein, the recombinant vector can be recombinant expression carrier or recombinant cloning vector.The transgenic cell line
It, cannot be by its Reproductive development at animal individual or the transgenic cell line of plant individual not have cellular omnipotency.
The antibody of other forms based on the single-chain antibody also belongs to protection scope of the present invention.
The antibody of the other forms can be the antibody of Fab forms, IgG forms antibody etc..
The present invention also protects the application of the single-chain antibody or the antibody of the other forms in preparing product；The production
The function of product is following (I), (II) or (III) or (IV)：
(I) hepatitis type B virus is detected；
(II) auxiliary identification hepatitis type B virus；
(III) prevent and/or treat hepatitis B；
(IV) prevent and/or treat by hepatitis b virus infected caused disease.
The product of antibody containing the single-chain antibody or the other forms also belongs to protection scope of the present invention；It is described
The function of product is following (I), (II) or (III) or (IV)：
(I) hepatitis type B virus is detected；
(II) auxiliary identification hepatitis type B virus；
(III) prevent and/or treat hepatitis B；
(IV) prevent and/or treat by hepatitis b virus infected caused disease.
The present invention produces anti-preS1scFv antibody using prokaryotic system, obtains recombination egg of the purity 95% or more
In vain, and the neutralization of flow cytometry and ELISA detection antibody is utilized.As a result prove that the antibody can effective inhibition of hepatitis b virus
Infection to stem cell.Anti-preS1scFv antibody provided by the present invention has the following advantages that compared with blood product：No
Immune serum is needed, solves the problems, such as to be restricted due to the shortage of immune serum source；Avoid blood product HBIG warps
The danger of blood born diseases；The essence of the present invention belongs to people's source protein matter, may be directly applied to human body without causing body
Immunological rejection；It is adapted to large-scale industrial production, yield can be improved, reduce cost.
Description of the drawings
The PCR qualification results of Fig. 1 behaviours heavy chain, light chain and VH-CH1-VL.
Fig. 2 is that flow cytometry screens bacillus coli DH 5 alpha (pBGD-Flag-preS1-scFv) display libraries result.
Fig. 3 is expression of the recombinant plasmid pET-27b-anti-preS1scFv in Escherichia coli.M：Protein standards point
Son amount 1：Induction bacterium supernatant；2：Induction bacterium precipitates.
Fig. 4 is the SDS-PAGE electrophoresis of anti-preS1scFv antibody proteins after purification.
Fig. 5 is that ELISA detects anti-preS1scFv antibody to the specificity of preS1 albumen and the result of affinity.**
It indicates compared with the control group, in P<0.01 horizontal upper difference is extremely notable.
Fig. 6 is the knot that pre-S1-FITC albumen and CCL 13 or HepG2 cells are blocked with anti-preS1scFv
It closes.A is CCL 13 (Chang liver cell) correlated results.In A, negative control 1：Untreated CCL 13
(Chang liver cell)；Negative control 2：Pre-S1-FITC is replaced with 5 μ g/ml of pre-S2-FITC.B is HepG2 cells
Correlated results.In B, negative control 1：Untreated HepG2 cells；Negative control 2：5 μ g/ml of pre-S2-FITC are replaced
pre-S1-FITC。
Fig. 7 is inhibiting rates of the anti-preS1scFv to preS1-FITC albumen.A is CCL 13 (Chang liver
cell)；B is HepG2 cells.Negative control is negative control 2 in Fig. 6.
Fig. 8 is to block HBV infection CCL 13 with anti-preS1scFv.
Specific implementation mode
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Design, synthesis and the clone of gene involved in following embodiments, the structure of expression vector, nucleic acid extraction, sequencing
And identification and the operating procedures such as the separation of expression product and purifying, can be carried out according to techniques known in the art (referring to
CURRENT PROTOCOLS IN MOLECULAR BIOLOGY).Unless otherwise specified, technological means used in embodiment is
Conventional means well-known to those skilled in the art.
PET-27b carriers：Purchased from Novagen companies, Cat.No.69337-3.Escherichia coli Rosetta：It is purchased from
Novagen companies, Cat.No.71403-4.
HepG2 cells：It commercially obtains, is recorded in document such as the " .HepG2 such as Tang Mengxuan, Zhou Wanjun, Hu Yuanjia
In the discussion practicality preventive medicine of cell culture processes and condition, the 1st phase of volume 12 in 2005 ".
Chang cells (CCL 13)：It commercially obtains, is recorded in document such as " Tao Yang's CCL 13s
Chang liver cell transplanting improves the prognosis .2013 of acute hepatic failure, the Central China University of Science and Technology, Master's thesis " in.
HepG2.2.15 cells：It commercially obtains, is recorded in document as " Korea Spro builds, Wang Xiaojuan, Liu Peng etc.
.HepG2.2.15 the revaluation of cell model function:The dynamic change of secretion HBVDNA, cccDNA and serologic marker object is ground
Study carefully China Pathogen Biology magazine, 05 phase in 2013 " in.
The acquisition of embodiment 1, anti-preS1scFv single-chain antibody encoding genes
One, initial sample
With the peripheral white blood cells of the blood donor of surface antigen antibody high-titer for initial sample, as antibody library gene
Source.This can not only increase the kurtosis of natural antibody, and can therefrom pick out the neutralizing antibody for popular strain, reach
To the effect got twice the result with half the effort.
Two, the extraction of RNA
Take fresh peripheral blood leukocytes 106Eppendorf (Ep) the Guan Zhongjia cold TRIzol of 1ml of precooling, blow and beat repeatedly, mix
It is even, 10min, 12000rpm, 4 DEG C of centrifugation 10min are placed on ice.Supernatant is transferred in new Ep pipes, adds the phenol of 200 μ l precoolings
Chloroform (phenol：Chloroform=1:5, volume ratio), shake vigorously and mix well 30sec, 12000rpm, 4 DEG C of centrifugation 10min.Supernatant is taken, is repeated
It is centrifuged after the oscillation of 200 μ l phenol chloroforms is added.Supernatant is taken, isometric cold isopropanol is added, -20 DEG C are placed 15min, 12000rpm, room
Temperature centrifugation 10min.Supernatant carefully is sucked, centrifuge tube is inverted, liquid feed is made to drain off.75 ﹪ ethyl alcohol are pre-chilled with 1ml,
12000rpm, 4 DEG C of centrifugation 5min wash RNA precipitate, abandon supernatant, be repeated 3 times, drying at room temperature.With 30 μ l sterilizing DEPC water dissolutions
RNA, -20 DEG C save backup.
Three, the synthesis of cDNA
Using the total tissue RNA of step 2 extraction as template, Oligo (dT)18For primer, reference reverse transcriptase (M-MLVRT)
Specification carries out the synthesis of first chain of cDNA.
Reaction system and reaction condition are as follows：Oligo(dT)181.0μl；5.0 μ l of total serum IgE template；DEPC-H2O5.0μl。
5min in 70 DEG C of water-baths places 5min on ice, sequentially adds：RNasin 1.0μl；5×M-MLVRT buffer5.0μl；
dNTPs 5.0μl；DTT 5.0μl；M-MLVRT 1.0μl.42 DEG C of water-baths 2h, 70 DEG C of water-bath 15min take 1 μ l products in 1% fine jade
Clip size is observed on sepharose electrophoresis.
Four, the design of the libraries clone scFv primer
The Accuracy and high efficiency of primer is the key that clone's variable region gene, and the present inventor is according to GenBank
Human antibody framework sequence, design PCR amplification primer are used for the amplification of light chain and heavy chain variable region, and in heavy chain variable region gene
Upstream and downstream is separately added into HindI II, Nhe I's restriction enzyme site, and chain variable region gene upstream and downstream is separately added into BamH I, I enzymes of Xho
Enzyme site, primer are synthesized by TaKaRa companies.Primer sequence is specific as follows：
Light chain divides Kappa types and Lambda types
Kappa chains upstream：BamH I restriction enzyme sites (underscore part)
KU1：
5'-CGCGGATCCGACATCCAGATGACCCAGT-3'；
5'-CGCGGATCCGACATCGTGATGACCCAGT-3'；
5'-CGCGGATCCGATATTGTGATGACTCAGTCTCCA-3'；
5'-CGCGGATCCGAAATTGTGTTGACGCAGT-3'；
5'-CGCGGATCCGATGTTGTGATGACTCAGTCTCCA-3'；
5'-CGCGGATCCGAAACGACACTCACGCAGTCTCCA-3'。
Kappa chains downstream：Xho I restriction enzyme sites (underscore part)
KD1：
5'-CCGCTCGAGTTAACGTTTGATTTCCACCTTGGTCCC-3'；
5'-CCGCTCGAGTTAACGTTTGATCTCCACCTTGGTCCC-3'；
5'-CCGCTCGAGTTAACGTTTGATCTCCAGCTTGGTCCC-3'；
5'-CCGCTCGAGTTAACGTTTTATTTCCACCTTGGTCCC-3'；
5'-CCGCTCGAGTTAACGTTTGATATCCACTTTGGTCCC-3'；
5'-CCGCTCGAGTTAACGTTTAATCTCCAGTCGTGTCCC-3'。
The upstreams Lambda：BamH I restriction enzyme sites (underscore part)
LU1：
5'-CGCGGATCCCAGTCTGCCCTGACTCAGCCTG-3'；
5'-CGCGGATCCCAGTCTGTGCTGACTCAGCCAC-3'；
5'-CGCGGATCCTCCTATGAGCTGACACAGCCAC-3'；
5'-CGCGGATCCTCCTATGAGCTGACTCAGCCAC-3'；
5'-CGCGGATCCTCCTATGAGCTGACTCAGGCAC-3'；
5'-CGCGGATCCAATTTTATGCTGACTCAGCCCC-3'；
5'-CGCGGATCCTCGTCTGAGCTGACTCAGGACC-3'；
5'-CGCGGATCCTCTGAGCTGACTCAGGACCCTG-3'。
The downstreams Lambda：Xho I restriction enzyme sites (underscore part)
LD1：
5'-CCGCTCGAGTTACTAGGACGGTCAGCTTGGTCC-3；
5'-CCGCTCGAGTTAACCTAGGACGGTGACCTTGGTC-3'；
5'-CCGCTCGAGTTAACCTAGGACGGTCAGCTTGGTC-3'；
5'-CCGCTCGAGTTACTGTGACGGTCAGCTTGGTCCC-3'。
Heavy chain
Ig Gamma chains upstream：Hind III digestions site (underscore part)
IGU1：
5'-CCCAAGCTTGAGGTGCAGCTGCTCGAGTCT-3'；
5'-CCCAAGCTTGAGGTGCAGCTGTTGGAGTCT-3'；
5'-CCCAAGCTTGAGGTGCAGTTGTTGGAGTCT-3'；
5'-CCCAAGCTTGAGGTGCAGCTGGTGGAATCT-3'；
5'-CCCAAGCTTGAGGTGCAGTTGGTGGAGTCT-3'；
5'-CCCAAGCTTGAGGTGCAGCTGGTGGAGTCC-3'；
5'-CCCAAGCTTGAAGTGCAGCTGGTGGAGTCT-3'；
5'-CCCAAGCTTCAGGTGCAGATGGTGGAGTCT-3'；
5'-CCCAAGCTTCAGGTGCAGTTGGTGGAGTCT-3'；
5'-CCCAAGCTTCAGGTGCAACTGGTGGAGTCT-3'；
5'-CCCAAGCTTCAGGTGCAGCTGGTGGAATCT-3'；
5'-CCCAAGCTTCAGGTGCAGCTGGTGGAGTC-3'；
5'-CCCAAGCTTCAGGTGCAGTTGGAAGAATCT-3'；
5'-CCCAAGCTTCAGGTGCAGTTGGAGGAATCT-3'；
5'-CCCAAGCTTCAGGTGCAGCTGCAGGAGTCG-3'；
5'-CCCAAGCTTCAGCTGCAGCTGCAGGAGTCG-3'；
5'-CCCAAGCTTCAGGTGCAGCTGGTGGAGTCT-3'；
5'-CCCAAGCTTGAGGTGCAGCTGCTGGAGTCT-3'；
5'-CCCAAGCTTGAGGTTCAGCTGGTGGAGTCT-3'；
5'-CCCAAGCTTGAGGTGCAGCTGGTGCAGTCT-3'；
5'-CCCAAGCTTCAGGTCCAGCTGGTGCAG-3'；
5'-CCCAAGCTTCAGGTACAGCTGCAGCAGTCA-3'；
Ig Gamma chains downstream：Nhe I restriction enzyme sites (underscore part)
IGD1：
5'-CGGCTAGCTGAAGAGACGGTGACCATTGTC-3'；
5'-CGGCTAGCTGAGGAGACGGTGACCATGGTC-3'；
5'-CGGCTAGCTGAGGAGACGGTGACCAGGGTT-3'；
5'-CGGCTAGCTGAAGAGACGGTGACCAGGGTT-3'；
5'-CGGCTAGCTGAGGAGACGGTGACCGTGGTCC-3'；
5'-CGGCTAGCTGAGGAGACGGTGACCAGGATT-3'。
Five, the PCR amplification of antibody variable region
Using the cDNA synthesized in step 3 as template, gradient is carried out with VH upstream and downstream primers and VL upstream and downstream primers respectively
PCR amplification determines optimum annealing temperature.Wherein, it is separated for the primer of Kappa chains and Lambda chains in VL upstream and downstream primers single
It solely uses, that is, when expanding the VL of Kappa chains, sense primer is the equimolar mixture of each primer in KU1, and downstream primer is
The equimolar mixture of each primer in KD1；When expanding the VL of Lambda chains, sense primer is each primer in LU1
Equimolar mixture, downstream primer are the equimolar mixture of each primer in LD1.PCR is carried out using VH upstream and downstream primers
When amplification, sense primer is the equimolar mixture of each primer in IGU1, and downstream primer is each primer in IGD1
Equimolar mixture.
It is as follows that PCR reacts (25 μ l systems)：10×PCR buffer 2.5μl；dNTPs 2.0μl；1.0 μ l of template
(10ng)；1.0 μ l of sense primer (a concentration of 10pmol/ μ l of primer after mixing)；1.0 μ l of downstream primer (primers after mixing
A concentration of 10pmol/ μ l)；0.5 μ l of Taq enzyme；ddH2O 17μl。
PCR amplification is carried out after mixing.Loop parameter is：95 DEG C of pre-degeneration 5min, 95 DEG C are denaturalized 1min, Gradient annealing temperature
For 48.5 DEG C~61.5 DEG C (48.5 DEG C, 48.9 DEG C, 49.8 DEG C, 51.1 DEG C, 52.6 DEG C, 54.2 DEG C, 55.8 DEG C, 57.4 DEG C, 58.9
DEG C, 60.2 DEG C, 61.1 DEG C, 61.5 DEG C), anneal 1min, 72 DEG C extension 1min, 30 cycle after, 72 DEG C extension 10min.Separately set
Negative control, wherein being not added with template, remaining ingredient is identical, with sterile deionized water polishing to same volume.
After amplification, takes 1 μ l products in observing clip size and brightness on 1% agarose gel electrophoresis, select most suitable
Annealing temperature (the most suitable annealing temperature of Kappa chains is：57.4 DEG C, the most suitable annealing temperature of Lambda chains is：61.1
DEG C, the most suitable annealing temperature of VH chains is：58.9 DEG C) carry out antibody variable region amplification.It is as follows that PCR reacts (250 μ l systems)：
10×PCR buffer 25μl；dNTPs 20μl；10 μ l (10ng) of template；10 μ l of sense primer (10pmol/ μ l)；Draw in downstream
10 μ l of object (10pmol/ μ l)；5 μ l of Taq enzyme；ddH2O 170μl。
PCR product is purified using plain agar sugar gel DNA QIAquick Gel Extraction Kits, and will be to Kappa chains, Lambda chains
The amplified production mixing of PCR reactions.Wherein, VH about 385bp, VL about 345bp.
Six, the preparation of Escherichia coli Electroporation-competent cells
The bacillus coli DH 5 alpha bacterium solution that picking freezes is crossed in LB solid plate media surfaces, 37 DEG C of overnight incubations.It is secondary
Day single bacterium colony of picking median size, is inoculated in 10ml LB liquid mediums, 37 DEG C, 120rpm shaken cultivations about 10h.With
Oese picks in bacterium solution access 10ml LB liquid mediums, 37 DEG C, 120rpm shaken cultivations about 10h.It has been activated above-mentioned
Strain is in 1/1000 ratio access 200ml LB liquid mediums, 37 DEG C, 120rpm shaken cultivations work as OD600Reach 0.35
It when between~0.4, collects in bacterium solution to 50ml centrifuge tubes, 4 DEG C, 3000rpm, centrifuges 10min.Supernatant is abandoned, 40~50ml is added
Deionized water is pre-chilled, thalline is resuspended, 4 DEG C, 3000rpm centrifuge 10min, and repetitive operation is primary.Supernatant is abandoned, it is pre- that 40~50ml is added
Thalline is resuspended in cold 10% (volume fraction) glycerine, and 4 DEG C, 3000rpm centrifuge 10min, and repetitive operation is primary.Supernatant is exhausted, is added
A small amount of 10% (volume fraction) glycerine of fresh precooling dispenses after thalline is resuspended, often 100 μ l of pipe, -80 DEG C freeze it is spare.This step
In all triangular flasks for using all impregnated with concentrated acid, on the one hand ensure that absolute cleanliness is sterile, and triangular flask inner wall can be removed
The ion of absorption.
Often 5ng pUC19 standard plasmids are added in pipe competent cell, and carrying out electricity under the conditions of 3kV, 25 μ F, 200 Ω turns, and is added
400 μ l LB 37 DEG C of shaken cultivation 1h of culture medium, spread plate, 37 DEG C of 12~16h of culture, next day observation electrotransformation result are simultaneously counted
Calculate conversion ratio.As a result it shows：Transformation efficiency is 1.1 × 109。
Seven, the structure in the libraries pTch1-2-scFv
PTch1-2 carriers are the carrier (sequence 3) of the present inventor's autonomous Design, and linker sequences are people's
Preceding 15 amino acid of CH1, for being connected to VH and VL, there are Hind III, Nhe I restriction enzyme sites in the front ends CH1, and there is Xho in rear end
I, BamH I restriction enzyme sites are inserted into convenient for VH segments and VL segments.
The coded sequence of preceding 15 amino acid of the heavy chain constant region CH1 of people：
5 '-the GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCT-3 ' (382-426 of sequence 2
Position)
The sequence of preceding 15 amino acid of the heavy chain constant region CH1 of people is 128-142 of sequence 1 in sequence table.
VH glue recovery product and pTch1-2 carriers that step 5 obtains is taken to carry out Hind III, Nhe I double digestions, 37 DEG C
Water-bath 3h, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.By VH and pTch1-2 digestion pieces
Duan Liyong T4Ligase are attached.The 2 above-mentioned connection products of μ l are added to the bacillus coli DH 5 alpha competence of step 6 preparation
In cell, carries out electrotransformation and build VH antibody libraries.
Next day collects all bacterium colonies and extracts plasmid, carries out Xho I, BamH I double digestions, while with XhoI, BamH I
Double enzymes are carried out to the VL recovery products that step 5 obtains.Glue recycling is carried out after digestion, connects the large intestine that simultaneously step of converting six obtains
Bacillus DH5 α competent cells, spread plate, 37 DEG C are incubated overnight.It collects bacterium colony and extracts plasmid, as pTch1-2-scFv
Library.
The libraries pTch1-2-scFv of structure are taken to carry out digestion identification and PCR identifications.With Hind III, Nhe I and Xho
I, BamH I carry out double digestion to the libraries pTch1-2-scFv.It is template to take pTch1-2-scFv Library plasmids, uses VH respectively
Sense primer and VL downstream primers carry out PCR identifications to it.
As a result (Fig. 1) is shown：VH and VL has been attached to together, size about 770bp.
Eight, antigen is connected into the downstreams pBGD plasmid pelB leader
The PCR primer of pre-S 1 antigens of hepatitis B viruses is designed, Nhe I restriction enzyme sites are added in sense primer, and downstream primer is added
Flag sequences and BamHI restriction enzyme sites.
Pre-S 1 antigens of hepatitis B viruses：Amino acid sequence is sequence in encoding gene such as sequence table in sequence table shown in sequence 4
Shown in row 5.
preS1-F：GCTAGC(underscore part is the identification sequence of Nhe I to ATGGGAGGTTG, and sequence thereafter is sequence
1-11 of sequence 5 in list)
preS1-R：GGATCC(underscore part is TTACTTATCGTCGTCATCCTTGTAATCGGCCTGAGGATG
The identification sequence of BamHI, italicized item are the coding gene sequence of Flag labels, and sequence thereafter is sequence 5 in sequence table
346-357 reverse complementary sequences).
With HBV gene group sequence shown in GenBank Accession No.AB205124 in artificial synthesized gene pool
It is classified as template, PCR amplification is carried out using primer preS1-F and preS1-R.
It is as follows that PCR reacts (25 μ l systems)：10×PCR buffer 2.5μl；dNTPs 2.0μl；1.0 μ l of template
(10ng)；1.0 μ l of sense primer (10pmol/ μ l)；1.0 μ l of downstream primer (10pmol/ μ l)；0.5 μ l of Taq enzyme；ddH2O 17μ
l。
PCR amplification is carried out after mixing.Loop parameter is：95 DEG C of pre-degeneration 5min, 95 DEG C are denaturalized 1min, Gradient annealing temperature
It is 40 DEG C~65 DEG C, anneal 1min, 72 DEG C of extension 1min, after 30 cycles, 72 DEG C of extension 10min.Negative control separately is set, wherein
It is not added with template, remaining ingredient is identical, with sterile deionized water polishing to same volume.
After amplification, takes 1 μ l products in observing clip size and brightness on 1% agarose gel electrophoresis, select most suitable
(48.9 DEG C) of annealing temperature progress antibody variable region amplifications, PCR product utilizes plain agar sugar gel DNA QIAquick Gel Extraction Kits
It is purified.
2, the structure of pBGD-Flag-preS1 recombinant vectors
PBGD carriers are the present inventor's autonomous Design carrier (sequence 6), pelB leader signal peptides on the carrier
There are NheI, BamH I restriction enzyme sites in encoding gene (167-232 of sequence 6) downstream, is inserted into convenient for antigen fragment.
The preceding S1 glue recovery product that step 1 obtains is taken to carry out Nhe I, BamH I double digestions, 37 DEG C of water-baths with pBGD carriers
3h, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.By after recycling preS1 antigens and
PBGD carrier endonuclease bamhis are attached using T4Ligase.The 2 above-mentioned connection products of μ l are added to the large intestine of step 6 preparation
It in bacillus DH5 α competent cells, is converted, next day, picking monoclonal extracts plasmid, carries out Nhe I, BamH I double digestions
Identification.
As a result it shows：Cut the preS1-Flag fusion segments that size is about 381bp.
By the correct plasmid sample presentation sequencing of Preliminary Identification.By through sequencing show pBGD carriers restriction enzyme site Nhe I and
DNA fragmentation shown in " sequence 5+GATTACAAGGATGACGA CGATAAG " is inserted between BamH I, and (i.e. preS1-Flag merges base
The sequence of cause) recombinant plasmid be named as pBGD-preS1-Flag.
Nine, the structure in antigen-antibody coexpression library
There are SfiI enzymes in NlpA leader signals DNA encoding peptide (5258-5344 of sequence 6) downstream on pBGD carriers
ScFv segments can be scaled off from the libraries pTch1-2-scFv that step 7 is built and be connected to step 8 structure by enzyme site
PBGD-Flag-preS1 carriers NlpA leader signal DNA encoding peptides downstream, be built into antigen-antibody coexpression bacterium
Display libraries.
The pBGD-Flag-preS1 carriers in the libraries pTch1-2-scFv and step 8 structure that step 7 is built are taken to carry out
SfiI digestions, 37 DEG C of water-bath 3h, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.It will recycling
ScFv segments and pBGD-Flag-preS1 carrier endonuclease bamhis be attached using T4Ligase.By the 2 above-mentioned connection products of μ l
It is added in the bacillus coli DH 5 alpha competent cell of step 6 preparation, carries out the text that electrotransformation is built into antigen-antibody coexpression
Library.Next day picking monoclonal extracts plasmid after conversion, carries out Sfi I digestions identification.
As a result it shows：Cut the scFv library fragments that size is about 760bp.Correct recombinant vector library will be identified through digestion
It is named as pBGD-Flag-preS1-scFv.
The identification sequence for the limitation restriction endonuclease (SfiI) used in this step is rare in antibody sequence, can avoid limitation inscribe
Enzyme shreds some antibody fragments, and just uses a kind of limitation restriction endonucleases of SfiI, can be to avoid double digestion in the process due to reaction
Condition inconsistent and cause digesting efficiency to reduce, cause digestion incomplete, so that the storage capacity of antibody library reduces.
Ten, prepared by the induction of bacillus coli DH 5 alpha and spheroplast
All bacterium colonies in library that collection step nine is built are diluted to OD with LB liquid medium6000.2,37 DEG C of culture 2h of ≈,
It is allowed to OD600IPTG to final concentration of 0.25mmol/L, 37 DEG C of induction 4h is added in ≈ 0.4.
2mL cultures are collected, 12000rpm centrifuges 1min, abandons supernatant.350 μ l Sucrose of bacterial sediment
(0.75mmol/L)/Tris (0.1mol/L) solution is resuspended；The lysozyme of a concentration of 10mg/ml Fresh of 35 μ l is added
(solvent is 350 μ l Sucrose (0.75mmol/L)/Tris (0.1mol/L) solution to mother liquor, and the enzyme activity of lysozyme is
20U/g)；700 μ l 1mmol/L EDTA solution (solvent is water), while the mixing that is vortexed is added dropwise；It is incubated 15min on ice；Add
Enter 50 μ l 0.5mol/L MgCl2Solution, and it is incubated 10min on ice；4 DEG C, 10000rpm centrifuges 10min；Spheroplast is heavy
It forms sediment and washing is resuspended with 1ml PBS solutions, 6000rpm centrifuges 3min, removes supernatant；Spheroplast precipitation is resuspended with 100 μ l PBS.
11, flow cytometry screens bacillus coli DH 5 alpha display libraries
Bacteria cell wall forms spheroplast after being punched by lysozyme, the substances such as antigen, antibody are both transparent for cell at this time
Wall is in contact with cell membrane and reacts.With the Flag antibody of FITC labels, (Sigma Products, catalog number are
F4049) the Flag-preS1 antigen fragments combined with the scFv of anchoring on incubated cell film, if expressed successfully or expressed
ScFv is that positive colony is then able to detect that fluorescence, it is on the contrary then cannot.The specific method is as follows：
Be added in the bacterium solution (IPTG has been induced) that 100 μ l PBS are resuspended 10 μ l 1% (1g/100ml) BSA storages liquid,
The Flag antibody of 5 μ g FITC labels, is protected from light is incubated 1h on ice；8000rpm, centrifuges 3min, and 1ml PBS resuspensions washed once, sink
It forms sediment and is resuspended with 100 μ l PBS.Negative control is set, by recombinant plasmid in the pBGD-Flag-preS1-scFv of library containing recombinant vector
Bacterium solution (being induced without IPTG) is treated as the Flag antibody incubations marked with FITC after spheroplast.With flow cytometer in
The fluorescence intensity that sample and negative control are detected under 488nm wavelength lasers collects fluorescence intensity in sample and is higher than negative control
Part.
Sorting gained bacterium is subjected to plasmid, electroporated to new bacillus coli DH 5 alpha, structure secondary screens library, by upper
The method stated carries out the second wheel screening (the Flag antibody dosages of FITC labels are reduced to 3 μ g), will be thin in each peak ranges
Born of the same parents sort out, and convert bacillus coli DH 5 alpha after preparing plasmid, structure secondary screens library carries out third round sieve by above-mentioned method
After choosing (the Flag antibody dosages of FITC labels are reduced to 1.5 μ g), picking single bacterium colony 20 uses flow cytometer one by one after spreading cultivation
It is detected, selects the fluorescence signal clone stronger than negative control, be sequenced and analyzed.It is gradually dropped in a few step screenings later
The Flag antibody of low FITC labels, is conducive to screen the stronger antibody of affinity.
The present invention is saved by way of extracting the new bacillus coli DH 5 alpha of plasmid, electrotransformation in the bacterium sorted out
Positive antibody gene, simplifies test procedure, also avoids being mutated the generation with strand displacement caused by normal PCR rescue is possible,
Increase the feasibility and practicability of this method.And it is thin that the competence without any plasmid is added when extracting plasmid
Bacterium inevitably loses (adhesion loss) when can reduce extraction plasmid in this way, can increase the total amount of last extraction plasmid.
Fluidic cell the selection result is as shown in Figure 2.It is screened by three-wheel, obtaining one has with preS1 antigens in conjunction with energy
The monoclonal antibody of power is named as anti-preS1scFv antibody.
The encoding gene of anti-preS1scFv antibody (for single-chain antibody) is coded sequence in sequence table shown in sequence 2
Anti-preS1scFv antibody shown in sequence 1 in table.
The preparation of embodiment 2, anti-preS1scFv single-chain antibodies
One, the structure of single-chain antibody expression vector (pET-27b-anti-preS1scFv)
The clone that PCR primer is used for single-chain antibody gene is designed using primer-design software Primer Premier 5.0.
Nco I restriction enzyme sites are added when designing sense primer, downstream is added XhoI restriction enzyme sites, is synthesized by Invitrogen companies.Tool
Body primer sequence is as follows：
anti-preS1scFv-F：CCATGG(underscore part is the identification sequence of Nco I to GT-TCGGTGCAGTTGGTG
Row ,-after sequence be 1-15 of sequence 2)；
anti-preS1scFv-R：CTCGAGTTAACGTTTGATATCC (underscore part is the identification sequence of XhoI ,-
Sequence afterwards is 753-768 reverse complementary sequences of sequence 2).
Sequence 2 in sequence table (is carried with the recombinant plasmid obtained through 1 fluidic cell of embodiment (FACS) screening using primer
Shown DNA fragmentation, anti-preS1scFv antibody shown in expressible nucleotide sequence 1) it is template PCR amplifications genetic fragment.Loop parameter
For：95 DEG C of pre-degenerations 5min, 95 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 72 DEG C of extension 1min, after 20 recycle, 72 DEG C of extensions
10min.After amplification, take 1 μ l products in observing clip size on 1% agarose gel electrophoresis.The results show that PCR product
Size is about 768bp.PCR product is purified using plain agar sugar gel DNA QIAquick Gel Extraction Kits.After purification and pMD18-T
Carrier is attached, converts, picking monoclonal, upgrading grain and send sequencing.It will show to be connected on pMD18-T carriers through sequencing
“CCATGGGT- sequences 2-CTCGAG" shown in recombinant plasmid after DNA fragmentation be named as pMD18-T-anti-preS1scFv.
With restriction enzyme Nco I and XhoI digestion pMD18-T-anti-preS1scFv plasmids, recycling size is about
The target fragment of 768bp, with the pET-27b carriers (being purchased from Novagen companies, Cat.No.69337-3) by same double digestion
Skeleton large fragment is connected.The 10 above-mentioned connection products of μ l are first converted with bacillus coli DH 5 alpha competent cell, picking Dan Ke
It is grand, extract Nco I and XhoI digestions identification after plasmid.By digestion Preliminary Identification, correctly (it is about 5414bp and 768bp to obtain size
Two bands) recombinant plasmid sequencing.It will show between restriction enzyme site the Nco I and XhoI of pET-27b carriers through sequencing
The recombinant plasmid for inserting DNA fragmentation shown in " GT- sequences 2 " is named as pET-27b-anti-preS1scFv.
Two, expression and purifying of the recombinant plasmid pET-27b-anti-preS1scFv in Escherichia coli
Take the positive recombinant plasmid pET-27b-anti-preS1 scFv conversion Rosetta (DE3) that 10ng step 1 obtains
Competence bacteria is coated in the LB solid medium tablets containing 50 μ g/ml Kan, 37 DEG C of 12~16h of culture.
The several transformed bacterias of picking are inoculated in respectively in the LB liquid medium of the 50 μ g/ml Kan containing concentration, 37 DEG C of oscillation trainings
It supports overnight, collects thalline and carry out PCR identifications.
Picking identifies that correct pET-scFv converts Rosetta (DE3) single bacterium colony, is inoculated in containing 50 μ g/ml Kan's
In LB liquid medium.Next day takes above-mentioned culture to be inoculated in containing 100 μ g/ml Kan's according to the ratio of 1% (volume ratio)
In culture medium, 37 DEG C of culture 2h work as OD600When value is to about 0.4, IPTG (to final concentration of 0.25mmol/L), 37 DEG C of trainings are added
It supports, induces 4h.Another to set the control group for being not added with IPTG inductions, remaining condition is identical.
Induction group and control group culture 1ml is taken to be added in 1.5ml Ep pipes after induction respectively, room temperature 12000r/m
It centrifuges 1min and collects thalline.Supernatant is abandoned, is precipitated with precooling PBS (pH7.4) washing thalline of 100 μ l, room temperature 12000r/m centrifugations
Supernatant is abandoned after 1min.Be added into induction group thalline 100 μ l precooling PBS (pH7.4) suspend after ultrasonication, 12000r/m from
Heart 10min is drawn in supernatant to another Ep pipes, and 100 μ l precooling PBS (pH7.4) are added into precipitation and are resuspended.Control group is used simultaneously
100 μ l precooling PBS (pH7.4) are resuspended.
1/3 volume 4 × SDS Sample Buffers are added into induction group supernatant, induction group precipitation and control group thallus suspension liquid
Liquid (contains DTT), and 100 DEG C are boiled 5min.20 μ l samples are taken to carry out 15%SDS-PAGE.After electrophoresis, contaminated through coomassie brilliant blue R_250
Color, methanol-glacial acetic acid destainer decoloration observation result is to determine the expression of destination protein.
As a result (Fig. 3) is shown：Anti-preS1scFv antibody is mainly expressed in the form of inclusion body in Escherichia coli.
Supernatant is abandoned in thalline centrifugation after induction group is induced, and is resuspended with appropriate PBS and is added lysozyme to final concentration of 1mg/mL,
60min is placed on ice, and ultrasonication, 4 DEG C, 10000g centrifuges 30min, collects inclusion body, with dissolving buffer solution after washing
(8mol/L urea liquids, pH8.0) fully dissolves.It is filled with 100 milliliters of dissolving buffer solutions (8mol/L aqueous solution of urea, pH8.0)
Divide dissolving, is then splined on HiLoad 16/60Superdex75pg pillars (being purchased from GE companies), it is then slow with 500 milliliters of renaturation
Fliud flushing (2mol/L aqueous solution of urea, pH8.0) elutes and collected the eluent after column, then dialyses in PBS buffer solution
At night, it is anti-preS1scFv antibody-solutions to obtain solution.All steps are under 4 DEG C of environment.Albumen after purification carries out
SDS-PAGE electrophoretic analysis analyzes its purity using high performance liquid chromatograph (being purchased from Waters companies).It is used in combination ultraviolet
Spectrophotometer (ND-1000 type Spectrophotometer) detects its concentration.As a result it shows：Albumen after purification is through SDS-
The protein band (protein band size is consistent with expected results) (Fig. 4) that size is about 27.1KD can be obtained in PAGE electrophoresis,
Recycling protein band is simultaneously sequenced, 1-15 amino acids residue institute of 15 amino acid residues such as sequence 10 in sequence table before N-terminal
Show, i.e. SVQLVESGGGLVQPG.In addition, purity of protein reaches 78%, concentration reaches 1.7mg/ml.
Embodiment 3, anti-preS1scFv single-chain antibody performance detections
One, ELISA detects the affinity power of anti-preS1 scFv antibody
Anti-preS1 scFv antibody prepared by embodiment 2 is coated in elisa plate and 4 DEG C are stayed overnight, peridium concentration gradient
For 100 μ g/mL, 50 μ g/mL, 10 μ g/mL, 5 μ g/mL, the specificity for detecting anti-preS1scFv to preS1 albumen,
Negative control group is set simultaneously.Coating is washed 3 times, each 2min after overnight with PBST, with 5% 37 DEG C of (5g/100ml) skimmed milk power
2h is closed, after washing, the preS1 albumen (amino acid sequence is sequence 4 in sequence table) of 10 μ g/mL, 37 DEG C of incubations are added
1h, washing is the same, and primary antibody (preS1 monoclonal antibodies, the production of Fitzgerald (Massachusetts, America) company is added
Product, catalog number Cat.No.10-H07A；2000 times of dilution), it is incubated washing and is same as above.Add secondary antibody (HRP-goat
Anti-mouse antibody, eBioscienc (San Diego, America) Products, catalog number are
Cat.No.11-7018；7500 times of dilution), 37 DEG C of incubation 1h after washing, are added tmb substrate liquid, colour developing are protected from light in 37 DEG C
The 50 μ L terminate liquids (H of 2mol/L are added per hole by 5min2SO4), its OD value is detected under wavelength 450nm with microplate reader.
It is arranged and replaces anti-preS1 scFv antibody-solutions, preS1 albumen and antibody with isometric PBS buffer solution
PBS groups.The control group 1 for being added without preS1 albumen is set, the control group 2 of antibody is added without, is added without preS1 albumen and is not added with
The control group 3 for entering antibody, with the scFv of anti-hIL-1 β that are isometric and waiting albumen concentration, (amino acid sequence is sequence in sequence table
7) control group 4 of anti-preS1 scFv is replaced.3 multiple holes of each processing setting.
As a result see Fig. 5.ELISA the result shows that, anti-preS1 scFv antibody can be combined with preS1 protein-specifics.
Two, the neutralization activity identification of anti-preS1scFv antibody
Anti-preS1scFv antibody prepared by embodiment 2, it is each with 5 μ g/mL of concentration gradient, 25 μ g/mL, 50 μ g/mL
The preS1-FITC (the preS1 albumen of FITC labels) of 200 μ l and 5 μ g/mL is after 4 DEG C of pre-reaction 1h, by reaction solution and HepG2
Cell or Chang cells (also referred to as CCL 13 or Chang liver cell) (105A cell) at 4 DEG C be incubated 1h after, PBS
It washs cell twice, is detected with flow cytometer.Provided with the blank control group for not adding reaction solution, only add 5 μ g/mL
The positive controls of preS1-FITC and with 5 μ g/mL preS2-FITC (FITC label preS2 albumen, the ammonia of preS2 albumen
Base acid sequence is by sequence 8 in sequence table) replace the negative control group of 5 μ g/mL preS1-FITC.
The results are shown in Figure 6, it is seen that and preS1-FITC can be specifically bound with HepG2 cells or CCL 13,
Anti-preS1 scFv antibody can be combined with the functional epitope of preS1 albumen, prevent preS1-FITC and HepG2 cells
Or the combination that CCL 13 occurs.Fig. 7 be anti-preS1scFv antibody to the inhibiting rate of preS1-FITC albumen, use Fig. 5
The inhibiting rate that comes of result conversion, formula is：[(average fluorescent strength-anti-preS1scFv of preS1-FITC groups and
The average fluorescent strength of preS1-FITC groups)/(mean fluorecence of 1 group of average fluorescent strength-negative control of preS1-FITC groups
Intensity)] × 100.It can be seen that anti-preS1 scFv antibody to the inhibition of preS1-FITC albumen at metering dependence.
10 are collected from HepG2.2.15 cells and supernatants4The HBV virions of copy and a concentration of 50 μ g/ml,
The anti-preS1scFv antibody mixing of 100 μ g/ml is abundant, in (25 DEG C) reaction 1h of room temperature.By mixture and Chang cells
(105A cell) it after incubation 1h, discards Incubating Solution at 37 DEG C and washs cell twice with PBS, culture medium is added in 37 DEG C of incubators
In continue to cultivate cell 72 hours.Cell conditioned medium is collected respectively, in the method detection Chang cell conditioned mediums of quantitative fluorescent PCR
The content of HBV virions detects the secretion situation of HBV e antigens in cell conditioned medium, tool with HBeAg ELISA detection kits
Steps are as follows for body：
HBV DNA, DNA in cell conditioned medium are extracted with viral DNA extracts kit (Omega Bio-tek, Inc.USA)
Content fluorescence quantitative PCR detection, reaction system are：25μl FastStart Universal Probe Master(Roche,
Mannheim, Germany), 0.5 μ l fluorescence probes, 0.5 μ l sense primers, 0.5 μ l downstream primers, 18.5 μ l water mix well
The HBV DNA of 5 μ l extractions are added afterwards.Cycling condition：94 DEG C of pre-degeneration 10min expand 40 according to 94 DEG C of 15s → 60 DEG C 60s
Cycle.The hepatitis B that the content of HBV e antigens is produced with limited liability company of Shanghai Kehua Bio-engineering Co., Ltd in cell conditioned medium
Malicious e diagnostic antigens kit (enzyme-linked immunization) is detected, and specific steps are referring to specification.
Wherein, fluorescence probe：5'-FAM-CCTCTTCATCCTGCTGCTATGCCTCATC-TAMRA-3'；
Sense primer：5'-CCATGGGTCTAGTGCAGATGGTG-3'；
Downstream primer：5'-GACAAACGGGCAACATACCTT-3'.
The results are shown in Figure 8, it is seen that the content of HBV virions and the content of HBeAg in experimental group Chang cell conditioned mediums
Will be lower than control group, and there are significant difference, illustrate that anti-preS1scFv antibody can prevent HBV viruses from infecting Zhang Shi
Liver cell.Positive control is only to use HBV infection CCL 13, and negative control is to replace scFv-9 will with the scFv of anti-hIL-1 β
HBeAg is converted into inhibiting rate, and formula is：[(positive control OD450Plus the OD of anti-preS1 scFv450)/positive control
OD450]×100.From result (table 1) it can be seen that anti-preS1scFv antibody prevents HBV viruses from infecting CCL 13 into meter
Measure dependence.
The HBV viruses that 1 anti-preS1scFv antibody of table prevent infect the inhibiting rate of CCL 13
Claims (9)
1. a kind of single-chain antibody, by heavy chain variable region, light chain variable region and for connecting the heavy chain variable region and described light
The bonding pad of chain variable region forms；
The amino acid sequence of the heavy chain variable region be in sequence table sequence 1 from N-terminal 1-127；
The amino acid sequence of the light chain variable region be in sequence table sequence 1 from N-terminal 143-255；
The bonding pad is preceding 15 amino acid of the heavy chain constant region CH1 of human antibody；
The sequence of preceding 15 amino acid of the heavy chain constant region CH1 of the human antibody be in sequence table sequence 1 from N-terminal the
128-142.
2. single-chain antibody according to claim 1, it is characterised in that：The single-chain antibody is by 1 institute of sequence in sequence table
The protein shown.
3. encoding the nucleic acid molecules of single-chain antibody described in claims 1 or 2.
4. nucleic acid molecules according to claim 3, it is characterised in that：The nucleic acid molecules are coding claims 1 or 2 institute
State the gene of single-chain antibody；
In the gene, the DNA molecular that encodes the heavy chain variable region is the sequence 2 of sequence table from the core of 5 ' end 1-381
DNA molecular shown in thuja acid；
In the gene, the DNA molecular that encodes the light chain variable region is the sequence 2 of sequence table from 5 ' end 427-768
DNA molecular shown in nucleotide.
5. nucleic acid molecules according to claim 4, it is characterised in that：In the gene, DNA points of the bonding pad are encoded
Son is the DNA molecular shown in the nucleotide of 5 ' end 382-426 of sequence 2 of sequence table.
6. nucleic acid molecules according to claim 4 or 5, it is characterised in that：The gene is shown in the sequence 2 of sequence table
DNA molecular.
7. expression cassette, recombinant vector, transgenic cell line or recombination containing any nucleic acid molecules in claim 3-6
Bacterium.
8. application of the single-chain antibody as claimed in claim 1 or 2 in preparing product；
The function of the product is following (I), (II) or (III) or (IV)：
(I) hepatitis type B virus is detected；
(II) auxiliary identification hepatitis type B virus；
(III) prevent and/or treat hepatitis B；
(IV) prevent and/or treat by hepatitis b virus infected caused disease.
9. the product containing single-chain antibody as claimed in claim 1 or 2；
The function of the product is following (I), (II) or (III) or (IV)：
(I) hepatitis type B virus is detected；
(II) auxiliary identification hepatitis type B virus；
(III) prevent and/or treat hepatitis B；
(IV) prevent and/or treat by hepatitis b virus infected caused disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510181163.9A CN104761639B (en) | 2015-04-16 | 2015-04-16 | ScFv antibody, its encoding gene and its application in preparing treatment or prevention hepatitis B preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510181163.9A CN104761639B (en) | 2015-04-16 | 2015-04-16 | ScFv antibody, its encoding gene and its application in preparing treatment or prevention hepatitis B preparation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104761639A CN104761639A (en) | 2015-07-08 |
| CN104761639B true CN104761639B (en) | 2018-07-31 |
Family
ID=53643770
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510181163.9A Active CN104761639B (en) | 2015-04-16 | 2015-04-16 | ScFv antibody, its encoding gene and its application in preparing treatment or prevention hepatitis B preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104761639B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105504052B (en) * | 2015-12-21 | 2019-03-01 | 江苏康缘瑞翱生物医药科技有限公司 | The scFv antibody of infections chicken cloacal bursa virus resisting is treating or preventing the application in Bursal Disease preparation |
| CN115160433B (en) * | 2022-06-28 | 2023-04-07 | 吉林大学 | Humanized HBV B and C genotype pre-S1 protein antibody and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1335324A (en) * | 2001-07-24 | 2002-02-13 | 大连理工大学 | Humanized single chain antibody of hepatitis B virus resisting preS1 antigen |
| CN101550189B (en) * | 2008-04-25 | 2011-10-19 | 中国人民解放军军事医学科学院卫生学环境医学研究所 | Anthropogenic antivirulin glycosidoprotein neutralizing genetic engineering antibody RD9 and preparation and application thereof |
| CN103333242B (en) * | 2013-07-23 | 2014-12-03 | 哈尔滨博翱生物医药技术开发有限公司 | scFv antibody, encoding gene thereof and application thereof to preparation of preparation for treating or preventing infectious bursal disease |
| CN104017080B (en) * | 2014-06-13 | 2016-09-28 | 华南农业大学 | A kind of dog source single-chain antibody and construction method thereof and application |
-
2015
- 2015-04-16 CN CN201510181163.9A patent/CN104761639B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104761639A (en) | 2015-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Matthews | Fundamentals of plant virology | |
| CN106479986B (en) | A kind of O-shaped foot and mouth disease virus sample particle and its preparation method and application | |
| CN108642021B (en) | A-type Saikoviruses virus-like particle and preparation method and application thereof | |
| CN102121009B (en) | Nucleic acid aptamer specifically combined with hepatitis C virus core protein and application thereof | |
| CN104524564B (en) | A kind of crucian Simplex Virus combination vaccine preparation and preparation method and application | |
| CN102558313A (en) | Enterovirus 71 type specific recombinant protein antigen and application thereof | |
| CN104873967A (en) | O type foot and mouth disease virus-like particle vaccine as well as preparation method and application thereof | |
| Stander et al. | A plant-produced virus-like particle displaying envelope protein domain III elicits an immune response against West Nile virus in mice | |
| CN105349562B (en) | Express recombinant vector, recombinant bacterium and its application of PPV VP 2 protein | |
| CN104761639B (en) | ScFv antibody, its encoding gene and its application in preparing treatment or prevention hepatitis B preparation | |
| CN107304419A (en) | The yeast cDNA library and its construction method and purposes of a kind of swine fever virus resistant VHH antibody | |
| CN104710529B (en) | A kind of single-chain antibody of anti-fishes virus haemorrhagic septicaemia virus | |
| US10532092B2 (en) | Mineralized foot-and-mouth disease virus like particles, and preparation method and use thereof | |
| CN114213532B (en) | Preparation and application of high-affinity anti-chicken infectious bursal disease virus scFv antibody | |
| Chen et al. | Development and evaluation of nucleoprotein-based rapid detection test for Siniperca chuatsi rhabdovirus | |
| CN104774844A (en) | Method for sieving single-chain antibody by virtue of bacterial surface display system | |
| CN111217905A (en) | Preparation method of recombinant rabbit monoclonal antibody | |
| CN105859879B (en) | A kind of single-chain antibody of Antifish lymphocystis virus | |
| CN114106113B (en) | Recombinant baculovirus for expressing porcine parvovirus VP2 protein, preparation method and application | |
| CN109097382A (en) | A method of for screening specific antibody variable region | |
| CN108753751A (en) | A kind of human telomerase reverse transcriptase's Antigenic Peptide and preparation method thereof | |
| CN118027183B (en) | Neutralizing antibody for resisting SARS-like coronavirus and novel coronavirus mutant strain and application thereof | |
| CN107603979A (en) | A kind of startup increment gene of high efficient expression foreign protein and its application | |
| CN108690835B (en) | Type I bovine herpes virus gE deletion strain and acquisition method thereof | |
| CN106749676A (en) | The series connection neutralizing antibody epitope peptide and fusion protein of the VP7 genes of rotavirus street strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20181221 Address after: 222001 No. 58 Haichang South Road, Haizhou District, Lianyungang City, Jiangsu Province Patentee after: Jiangsu Kangyuan Ruiao Biomedical Technology Co., Ltd. Address before: 150030 Science and Technology Park of Northeast Agricultural University, 59 Wood Street, Xiangfang District, Harbin City, Heilongjiang Province Patentee before: Harbin Boao Bio-Medical Technology Development Company |
|
| TR01 | Transfer of patent right |