CN109097382A - A method of for screening specific antibody variable region - Google Patents

Abstract

The invention discloses a kind of methods using bacterium surface exhibiting system screening single-chain antibody.This method comprises the following steps: A) construct the gene code database being made of different single-chain antibody encoding genes to be detected；Primer pair for expanding antibody VH and VL is same kind degenerate primer pair, and the connector for connecting VH and VL is with kind CH1；B the gene coded sequence for being specific to the target single-chain antibody of the target antigen) is obtained；Target antigen and single-chain antibody to be detected coexpression, and with label protein Flag labelled antigen, after obtaining the recombinant bacteria for carrying target single-chain antibody by the screening of fluidic cell separating method by the anti-label protein antibody of fluorescent marker, the method for turning host strain again by extracting plasmid saves target single-chain antibody.The present invention is improved and is innovated on the basis of traditional bacteria display technology, and new resistant bacteria display systems are constructed according to element necessary to antibody display carrier and basic principle.

Description

A method of for screening specific antibody variable region

Technical field

The invention belongs to genetic engineering antibodies to research and develop field, be related to a kind of for screening the side of specific antibody variable region Method.

Background technique

The technical characterstic is to utilize the signal peptide NlpA leader of bacterial cell interstitial membrane lipoprotein by antibody variable region base Because library is transported to bacterium interstitial chamber, and NlpA leader is gradually degraded during transdermal delivery, remaining 6 amino Phospholipid layer on the outside of sour (CDQSSS) and intercellular membrane forms rouge glycosidic bond, so that the antibody fragment merged with it is showed in carefully On the outside of bacterium inner membrance.At spheroplast after bacterial outer membrane is by lysozyme digestion, the labelled antigen in Incubating Solution can enter between bacterium Then the antibody of itself and fluorescent marker is carried out total incubation in conjunction with the antibody fragment being anchored on the outside of intercellular membrane by matter, and anti- The specific antibody gene that original combines can be separated by flow cytomery.

Antigen can also be combined by way of coexpression in bacterium interstitial with antibody variable region library, by identifying antigen Method screen specific antibody variable region.Specific method can guide the antigen merged with it to enter bacterium with pelB leader Interstitial, free antigen are combined with the antibody variable region fragment for being anchored on bacterial inner membrane in interstitial chamber, are known using antigenic tag Not Wei point, such as Flag, then with label anti-Flag antibody mark, then screened with flow cytometer.

The above method and lot of advantages, such as: (l) screens positive antibody variable region clone in real time, using flow cytometry (FCM) the synchronous follow-up of real-time monitoring can really be accomplished by carrying out screening.(2) it does not need to prepare antigen and labelled antigen, prepare Antigen and labelled antigen are time-consuming and laborious things, and antigen-antibody coexpression not only reduces workload, reduces job costs, And shorten the working time.

Summary of the invention

It is an object of the present invention to provide the encoding genes that a kind of acquisition is specific to the target single-chain antibody of target antigen Method.

It is provided by the present invention to obtain the method for being specific to the encoding gene of target single-chain antibody of target antigen, specifically may be used Include the following steps:

A it) is compiled according to the method building included the following steps by the gene that different single-chain antibody encoding genes to be detected form Code library:

(a1) it according to known antibody framework region sequences, designs and synthesizes the degeneracy for expanding antibody heavy chain variable region and draws Object is to 1, and degenerate primer for expanding antibody's light chain variable region is to 2；

The known antibody framework region sequences are the antibody of the host from the microorganism for carrying the target antigen Framework sequence；Such as target antigen is a certain albumen that can infect the hepatitis B of people, then the known antibody frame Frame region sequence is the antibody framework region sequences of people；

(a2) using the degenerate primer 1 and the degenerate primer, to 2, amplification obtains antibody weight respectively from initial sample Chain variable region set and antibody's light chain variable region set；

Contain the antibody library being made of the antibody not of the same race for resisting the target antigen in the initial sample；

The initial sample can for it is following a) or b):

A) tissue samples (such as blood) of healthy individuals, the healthy individuals be immunized containing the target antigen or After the vaccine of its code nucleic acid, evoke the healthy individuals that immune response generates corresponding antibodies；

B) tissue sample (such as blood) of diseased individuals, the diseased individuals are because carrying causing a disease for the target antigen The caused diseased individuals of microorganism (such as virus, bacterium or fungi) infection, and verified evoked immune response and generated Antibody.

The antibody heavy chain variable region set is the set being made of different heavy chains variable region；The light chain variable region set For the set being made of different light chain variable regions；

The degenerate primer may be either a primer pair to 2 to 1 and the degenerate primer, can also be multiple primer pairs. When for multiple primer pairs, each primer pair in 1 respectively expands the initial sample using the degenerate primer, The set of amplification gained segment is the antibody heavy chain variable region set；Using the degenerate primer to each primer in 2 To expanding respectively to the initial sample, the set of amplification gained segment is the antibody's light chain variable region set.

(a3) by the antibody heavy chain variable region set different heavy chains variable region and the antibody's light chain variable region collection Different light chain variable regions in conjunction are connected at random by heavy chain constant region CH1, are obtained and are compiled by different single-chain antibodies to be detected The gene code database of code gene composition；

The heavy chain constant region CH1 is the heavy chain constant region of the host from the microorganism for carrying the target antigen Preceding 15 amino acid of CH1；If the target antigen is a certain albumen that can infect the hepatitis B of people, then the heavy chain is permanent Determine preceding 15 amino acid for the heavy chain constant region CH1 that area CH1 is people；

In the present invention, the antibody heavy chain variable region is connected to the upstream of the heavy chain constant region CH1；The antibody is light Chain variable region is connected to the downstream of the heavy chain constant region CH1.

B the base for being specific to the target single-chain antibody of the target antigen) is obtained according to the method included the following steps Because of coded sequence:

(b1) by each single-chain antibody encoding gene to be detected in the gene code database respectively with target antigen-label egg White fusion is implemented in same expression vector jointly, and the single-chain antibody encoding gene to be detected is made to be blended in signalase 11 Encoding gene downstream, be blended in the target antigen-label protein fusion under the encoding gene of signal peptide 2 Trip obtains recombinant expression carrier library；Contain the target antigen-label protein in the recombinant expression carrier library on each carrier Fusion and any single-chain antibody encoding gene to be detected；

The target antigen-label protein fusion is the encoding gene and the label protein by the target antigen Encoding gene fusion made of fusion；

The signalase 11 is the signal peptide with following function: the destination protein merged with it is showed in bacterial inner membrane The destination protein merged with it (is transported to bacterium interstitial chamber, and is positioned on the outside of bacterial inner membrane) by outside；

The signal peptide 2 is the signal peptide with following function: the destination protein merged with it is transported to bacterium interstitial Itself is degradable after chamber, and it is intracavitary that the destination protein is free on the bacterium interstitial；

The signalase 11 does not have the above functions of the signal peptide 2；And the signal peptide 2 does not have the signal yet The above functions of peptide 1.

(b2) each recombinant expression carrier in the recombinant expression carrier library is transferred to host bacteria, obtains recombinant bacteria Library；Containing any recombinant expression carrier (i.e. in the recombinant bacteria in each recombinant bacteria in the recombinant bacteria library In library, a kind of recombinant expression carrier is contained only in each recombinant bacteria, a kind of this recombinant expression carrier can be institute State any recombinant expression carrier in recombinant expression carrier library)；

(b3) the recombinant bacteria library is cultivated, induces the recombinant expression carrier to be expressed, by described to be detected single-stranded Antibody-encoding genes encode resulting single-chain antibody to be detected and are showed on the outside of the bacterial inner membrane, by the target antigen- It is intracavitary that the resulting target antigen-tag fusion protein of label protein fusion coding is free on the bacterium interstitial；

(b4) outer membrane (as used bacteriolyze enzymatic treatment) for removing each recombinant bacteria in the recombinant bacteria library, obtains spheroplast Library；It shows there is any single-chain antibody to be detected on each spheroplast in the spheroplast library, is free on described Target antigen-the tag fusion protein outside spheroplast can be resisted by the specific single-chain in the single-chain antibody to be detected Body is captured, formation antigen antibody complex (and the non-specific single-chain antibody on the spheroplast surface cannot then capture institute State target antigen)；

(b5) the spheroplast library and the antibody for resisting the label protein through fluorescent marker are incubated for jointly, only table The spheroplast that face forms the antigen antibody complex can be labeled the fluorescence, obtain from the spheroplast library The labeled spheroplast for the fluorescence in surface is obtained (to divide as carried out streaming to the spheroplast library using flow cytometer Choosing), it is denoted as fluorescence-spheroplast；The single-chain antibody to be detected of the surface display of the fluorescence-spheroplast is described Target single-chain antibody；

(b6) plasmid is extracted from the fluorescence-spheroplast, is transferred to the host bacteria again, carry out the plasmid Expand numerous culture, the plasmid, conservation are extracted from the bacterium after culture；

To the gene coded sequence for obtaining the target single-chain antibody after the plasmid order-checking.

It is that building is single-stranded anti-the present invention also provides a kind of method for obtaining and being specific to the target single-chain antibody of target antigen Body library and the method for therefrom screening single-chain antibody.

This method is in addition to including the A) step and the B) step, in the B) it further include following steps after step C):

C) according to the gene coded sequence of step B) the target single-chain antibody obtained, protein expression is carried out, obtains institute State target single-chain antibody.

In the present invention, the signalase 11 is NlpAleader signal peptide；The signal peptide 2 is pelB leader signal Peptide.

The sequence of the encoding gene of the NlpAleader signal peptide is 5258-5344 of sequence 1 in sequence table；Institute The sequence for stating the encoding gene of pelB leader signal peptide is 167-232 of sequence 1 in sequence table.

In the present invention, the host bacteria is Escherichia coli；Specially bacillus coli DH 5 alpha.

In the present invention, the label protein is Flag albumen.The amino acid sequence of the Flag albumen is specially sequence In table shown in sequence 2.

In the present invention, the marker of the fluorescence is FITC.

In the present invention, in step (b1), the expression vector is specially pBGD carrier；The sequence of the pBGD carrier has Body is as shown in sequence 1 in sequence table.

The method the step of in (b5), it is described " obtained from the spheroplast library surface it is labeled it is described In the spheroplast of fluorescence ", the method for " acquisition " can screen for single-wheel, can also be more wheel (such as 2-4 wheel) screenings；When for When multi-turns screen, from the 2nd wheel screening, each round screening, which is screened in the resulting spheroplast from previous round, extracts matter The step of grain is transferred to the host bacteria again, repeats (b3)-(b5).With the increase of number of screening round can gradually decrease through The dosage of the antibody (the Flag antibody of such as FITC label) for resisting the label protein of the fluorescent marker, is conducive to screen in this way To the stronger antibody of affinity.

It is a further object to provide it is a kind of for obtain be specific to target antigen target single-chain antibody or its The kit of encoding gene.

It is provided by the present invention to be specific to the target single-chain antibody of target antigen or the reagent of its encoding gene for obtaining Box, it may include expression vector, host bacteria, anti-label protein through fluorescent marker antibody；

The expression vector contains the gene for encoding the signalase 11 and the signal peptide 2, described to be checked for co-expressing Survey single-chain antibody and the target antigen-tag fusion protein (such as described pBGD carrier)；

The host bacteria can be Escherichia coli；Specific such as bacillus coli DH 5 alpha；

The antibody of the anti-label protein through fluorescent marker can be the antibody of the anti-Flag albumen marked through FITC.

In addition, also containing the readable carrier for recording method as described above, such as specification in the kit.

The kit also belongs in the application obtained in the target single-chain antibody or its encoding gene for being specific to target antigen In protection scope of the present invention.

In the present invention, the target antigen is to have antigen from pathogenic microorganism (such as virus, bacterium or fungi) Active substance, such as the conjugate of albumen, polypeptide, polysaccharide or small molecule compound and carrier protein.

In one embodiment of the invention, the target antigen is specially infectious bursal disease virus (IBDV) VP2 albumen.The amino acid sequence of the VP2 albumen is sequence 4 in sequence table, and the sequence of the encoding gene of the VP2 albumen is Sequence 5 in sequence table.The heavy chain constant region CH1 is preceding 15 amino acid of the heavy chain constant region CH1 of chicken.The heavy chain of the chicken The amino acid sequence of constant region CH1 is that (corresponding coding gene sequence is sequence table by 125-139 of sequence 6 in sequence table 373-417 of middle sequence 7).The signalase 11 is that (coding gene sequence is the of sequence 1 to NlpA leader signal peptide 5258-5344)；The signal peptide 2 is that (coding gene sequence is the 167-232 of sequence 1 to pelB leader signal peptide Position).Finally screen the coding of the resulting target single-chain antibody (being denoted as anti-VP2scFV) for being specific to the VP2 albumen The sequence of gene is sequence 7 in sequence table, and the amino acid sequence of the anti-VP2scFV of coding is sequence 6 in sequence table.

The degenerate primer is to 1:

5’-CCCAAGCTTGGCCCAGCCGGCCGCCGTGACGTTGGACGAG-3'；

5’-CTAGCTAGCGGAGGAGACGATGACTTCGGTCC-3’。

The degenerate primer is to 2:

5’-CGCGGATCCGCGCTGACTCAGCCGTCCTCGGTGTC-3'；

5’-CCGCTCGAGGGCCCCCGAGGCCTTAACCTAGGACGGTCAGGG-3’。

The initial sample is that IBDV virus height exempts from chicken bursa.

The specific construction method in the recombinant expression carrier library includes the following steps: to encode the single-chain antibody to be detected Gene forward direction is inserted into the restriction enzyme site Sfi I in NlpA leader signal DNA encoding peptide downstream on the pBGD carrier Place；By the target antigen-label protein fusion (encoding gene of the VP2 albumen and the coding of the Flag albumen Fusion made of gene is sequentially merged according to from 5 ' to 3 ' direction) forward direction is inserted into the pelB on pBGD carrier Between restriction enzyme site Nhe I and the BamH I in leader signal DNA encoding peptide downstream, the recombinant expression carrier library is obtained.

In another embodiment of the invention, the target antigen is specially the pre-s1 protein of hepatitis B (HBV) (preS1 albumen).The amino acid sequence of the pre-s1 protein is sequence 8 in sequence table, the encoding gene of the pre-s1 protein Sequence is sequence 9 in sequence table.The heavy chain constant region CH1 is preceding 15 amino acid of the heavy chain constant region CH1 of people.The people The amino acid sequence of heavy chain constant region CH1 be that (corresponding coding gene sequence is by 128-142 of sequence 10 in sequence table 382-426 of sequence 11 in sequence table).The signalase 11 is that (coding gene sequence is sequence to NlpA leader signal peptide 5258-5344 of column 1)；The signal peptide 2 is that (coding gene sequence is the of sequence 1 to pelB leader signal peptide 167-232).It finally screens the resulting target single-chain antibody for being specific to the pre-s1 protein and (is denoted as anti-preS1 ScFv the sequence of encoding gene) is sequence 11 in sequence table, and the amino acid sequence of the anti-preS1scFV of coding is Sequence 10 in sequence table.

The degenerate primer is multipair primer to 2 to 1 and the degenerate primer, referring specifically to embodiment 2.

The initial sample is to pick up from the peripheral white blood cells of the healthy blood donor of hepatitis b surface antigen antibody high-titer.

The specific construction method in the recombinant expression carrier library includes the following steps: to encode the single-chain antibody to be detected Gene forward direction is inserted into the restriction enzyme site Sfi I in NlpA leader signal DNA encoding peptide downstream on the pBGD carrier Place；By the target antigen-label protein fusion (encoding gene of the pre-s1 protein and the coding of the Flag albumen Fusion made of gene is sequentially merged according to from 5 ' to 3 ' direction) forward direction is inserted into the pelB on pBGD carrier Between restriction enzyme site Nhe I and the BamH I in leader signal DNA encoding peptide downstream, the recombinant expression carrier library is obtained.

The present invention is improved and is innovated on the basis of traditional bacteria display technology, according to antibody display carrier institute Required element and basic principle construct resistant bacteria display carrier, and using different hosts E.coli DH5 α bacterial strain at Function illustrates the antibody with antigen binding capacity.

Detailed description of the invention

Fig. 1 is the SDS-PAGE electrophoresis of anti-VP2scFv antibody protein after purification.

Fig. 2 is that ELISA detects anti-VP2scFv antibody to the specificity of VP2 albumen and the result of affinity.Ordinate For OD450 value.* is indicated compared with the control group, extremely significant in the horizontal upper difference of P < 0.01.

Fig. 3 is that ELISA detects anti-VP2scFv antibody to the specificity of different IBDV viruses and the result of affinity.It is vertical Coordinate is OD450 value.* is indicated compared with the control group, extremely significant in the horizontal upper difference of P < 0.01.

Fig. 4 is the PCR qualification result of people's heavy chain, light chain and VH-CH1-VL.

Fig. 5 is that flow cytometry screens bacillus coli DH 5 alpha (pBGD-Flag-preS1-scFv) display libraries result.

Fig. 6 is the SDS-PAGE electrophoresis of anti-preS1scFv antibody protein after purification.

Fig. 7 is that ELISA detects anti-preS1scFv antibody to the specificity of preS1 albumen and the result of affinity.** It indicates compared with the control group, it is extremely significant in the horizontal upper difference of P < 0.01.

Fig. 8 is the knot that pre-S1-FITC albumen and CCL 13 or HepG2 cell are blocked with anti-preS1scFv It closes.A is CCL 13 (Chang liver cell) correlated results.In A, negative control 1: untreated Zhang Shi liver is thin Born of the same parents (Chang liver cell)；Negative control 2: pre-S1-FITC is replaced with 5 μ g/ml of pre-S2-FITC.B is that HepG2 is thin Born of the same parents' correlated results.In B, negative control 1: untreated HepG2 cell；5 μ g/ml of negative control 2:pre-S2-FITC is replaced pre-S1 -FITC。

Fig. 9 is inhibiting rate of the anti-preS1scFv to preS1-FITC albumen.A is CCL 13 (Chang liver cell)；B is HepG2 cell.Negative control is negative control 2 in Fig. 8.

Figure 10 is to block HBV infection CCL 13 with anti-preS1scFv.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Design, synthesis and the clone of gene involved in following embodiments, the building of expression vector, nucleic acid extraction, sequencing And identification and the operating procedures such as the separation of expression product and purifying, can be carried out according to techniques known in the art (referring to CURRENT PROTOCOLS IN MOLECULAR BIOLOGY).Unless otherwise specified, technological means used in embodiment is Conventional means well-known to those skilled in the art.

PET-27b carrier: Novagen company, Cat.No.69337-3 are purchased from.Escherichia coli Rosetta: it is purchased from Novagen company, Cat.No.71403-4.DF1 cell (chicken fibroblasts): it is purchased from Chinese Academy of Sciences Shanghai life science Icm cell resource center, Cat.No.3131C0001000400030.SPF chick: it is purchased from Harbin veterinary institute.Chicken Newcastle disease inactivated vaccine (Sota plants of La) is bought from biotech firm of Ha Shouyanwei section, number 080012008.

Infectious bursal disease live-vaccine (Gt plants): biotech firm of Ha Shouyanwei section, number 080012122.Chicken is infected The property medium virulence live vaccine of bursal disease (NF8 plants): Yangzhou VAC BIO Engineering Co., Ltd., number 101042056.Chicken is infected Property bursal disease live vaccine (1-65 plants): Shafit InterGumboro, number S20651010A.Bursal Disease Live vaccine (BJ836 plants): Shanghai Hai Li biologics Co., Ltd, number 090202026.Infectious bursal disease live-vaccine (MB plants): ABIC, number 20621150B.Infectious bursal disease live-vaccine (B87 plants): there is bank biology medicine company in Hunan Province Limit company, number 180022026.HB/11 plants of infectious bursal disease virus: bibliography: Huang obvious, Zhang little Fei, Ding Meijuan Deng, the separation and identification of infectious bursal disease virus velogen strain HB/11, " Chinese zoonosis journal " 2012 years the 5th Phase, 8-11 pages.

HepG2 cell: commercially obtaining, and is recorded in document such as the " .HepG2 such as Tang Mengxuan, Zhou Wanjun, Hu Yuanjia In the practical preventive medicine of the discussion of cell culture processes and condition, the 1st phase of volume 12 in 2005 ".

Chang cell (CCL 13): commercially obtaining, and is recorded in document such as " Tao Yang's CCL 13 Chang liver cell transplanting improves the prognosis .2013 of acute hepatic failure, the Central China University of Science and Technology, Master's thesis " in.

HepG2.2.15 cell: commercially obtaining, and is recorded in document as " Korea Spro builds, Wang Xiaojuan, Liu Peng etc. .HepG2.2.15 the revaluation of cell model function: the dynamic change of secretion HBVDNA, cccDNA and serologic marker object Study China Pathogen Biology magazine, 05 phase in 2013 " in.

Embodiment 1, anti-ibd V virus VP 2 albumen single-chain antibody screening

Gumboro disease (IBD) is a kind of urgency of the chicken as caused by infectious bursal disease virus (IBDV) and turkey Property highly contagious disease, has caused the concern in the world.IBDV belongs to birnavirus section Avibirnavirus, gene Group is made of two different RNA of length.VP2 molecular weight is about 37kDa, is serotype specificity antigen, is both IBDV's Major structural protein, and be the main host protective antigens of virus, the change of induction, antigen and virulence with virucidin Different, Apoptosis etc. is related.Antibody drug is currently the only effective therapeutic agent, hyper-immune serum and high immunity yolk antibody pair IBD shows good prevention and treatment effect, but is restricted due to cost and safety etc., to reduce Their use value.And targeting diagnosis and treatment of the genetic engineering recombinant antibodies as high-affinity, based on albumen are used Biological products are increasingly taken seriously in terms of the anti-system of viral disease.It is anti-it is therefore desirable to develop the genetic engineering of anti-ibd V Body drug fills up the blank using genetic engineering antibody treatment Bursal Disease, also to develop other animal virals Disease medicament lays the foundation.

The present embodiment extraction obtains antibody gene out of natural infected animal body, and the RNA of the bursa of farbricius is extracted using TRIZOL Reverse transcription is cDNA afterwards.According to the antibody sequence on GenBank, the degenerate primer of clonal antibody variable region is designed, with cDNA For template, the method clonal antibody variable region of PCR is used.Using efficient electrotransformation method, VH and VL segment is inserted into respectively To the upstream and downstream of pTch1 carrier Linker, constructs scFv antibody library and be connected into pBGD bacterial display vector again The downstream of NlpA leader, before this first by the downstream of antigen fragment insertion pelB leader, building antigen-antibody is total to table The bacterium surface displaying library reached.Antibody library is screened using flow cytometer, the monoclonal gene screened is connected Enter pET-27b carrier, and carries out inducing expression.

One, initial sample

Exempting from chicken bursa with IBDV virus height is initial sample (verified evoked immune response and generate antibody), as The source of antibody library gene.This can not only increase the kurtosis of natural antibody, and can therefrom pick out for popular strain Neutralizing antibody, have the function that get twice the result with half the effort.

Two, the extraction of total serum IgE

Fresh chicken bursa (the initial sample of step 1) 0.1g is taken as in the mortar of pre-cooling, to be continuously added liquid nitrogen, it is fast Fast grind into powder.Tissue powder is moved in Eppendorf (Ep) pipe of pre-cooling, adds the cold TRIzol of 1ml, blows and beats repeatedly, is mixed It is even, 10min, 12000rpm, 4 DEG C of centrifugation 10min are placed on ice.Supernatant is transferred in new Ep pipe, 200 μ l is added to be pre-chilled Phenol chloroform (phenol: chloroform=1:5, volume ratio) shakes vigorously and mix well 30sec, 12000rpm, 4 DEG C of centrifugation 10min.Supernatant is taken, weight It is centrifuged after being added with the oscillation of 200 μ l phenol chloroforms.Supernatant is taken, adds isometric cold isopropanol, -20 DEG C of placements 15min, 12000rpm, Room temperature is centrifuged 10min.Supernatant carefully is sucked, centrifuge tube is inverted, liquid feed is made to drain off.75% ethyl alcohol is pre-chilled with 1ml, 12000rpm, 4 DEG C of centrifugation 5min wash RNA precipitate, abandon supernatant, be repeated 3 times, drying at room temperature.With 30 μ l sterilizing DEPC water dissolution RNA, -20 DEG C save backup.

Three, the synthesis of cDNA

The total tissue RNA extracted using step 2 is template, Oligo (dT)₁₈For primer, reference reverse transcriptase (M-MLVRT) The synthesis of specification progress first chain of cDNA.

Reaction system and reaction condition are as follows: Oligo (dT)₁₈1.0μl；5.0 μ l of total serum IgE template；DEPC-H₂O 5.0μ l.5min in 70 DEG C of water-baths places 5min on ice, sequentially adds: 1.0 μ l of RNasin；5×M-MLVRT buffer 5.0μl； dNTPs 5.0μl；DTT 5.0μl；M-MLVRT 1.0μl.42 DEG C of water-baths 2h, 70 DEG C of water-bath 15min take 1 μ l product in 1% fine jade Clip size is observed on sepharose electrophoresis.

Four, the design of the library scFv primer is cloned

The Accuracy and high efficiency of primer is the key that clone's variable region gene, and the present inventor is according to GenBank Chicken antibody framework sequence, design PCR amplification primer are used for the amplification of light chain and heavy chain variable region, and in heavy chain variable region gene Upstream and downstream is separately added into Hind III, Nhe I's restriction enzyme site, and light-chain variable region gene upstream and downstream is separately added into BamH I, I enzyme of Xho Enzyme site, primer are synthesized by TaKaRa company.

For expanding the primer pair of heavy chain variable region:

HF (heavy chain upstream):

5’-CCCAAGCTT-GGCCCAGCCGGCC(underscore part is followed successively by digestion to GCCGTGACGTTGGACGAG-3 ' The identification sequence of site Hind III and Sfi I)；

HR (heavy chain downstream): 5 '-CTAGCTAGC(underscore part is digestion to GGAGGAGACGATGACTTCGGTCC-3 ' The identification sequence of site Nhe I).

For expanding the primer pair of light chain variable region:

LF (light chain upstream): 5 '-CGCGGATCC(underscore part is enzyme to GCGCTGACTCAGCCGTCCTCGGTGTC-3 ' The identification sequence of enzyme site BamH I)；

LR (light chain downstream):

5’-CCGCTCGAG-GGCCCCCGAGGCC(underscore part is followed successively by enzyme to TTAACCTAGGACGGTCAGGG-3 ' The identification sequence of enzyme site Xho I and Sfi I).

Five, the PCR amplification of antibody variable region

Using the cDNA synthesized in step 3 as template, respectively with the VH upstream and downstream primer and VL or more of step 4 design synthesis It swims primer and carries out grads PCR amplification, determine optimum annealing temperature.

It is as follows that PCR reacts (25 μ l system): 10 × PCR buffer, 2.5 μ l；dNTPs 2.0μl；1.0 μ l of template (10ng)；1.0 μ l of upstream primer (10pmol/ μ l)；1.0 μ l of downstream primer (10pmol/ μ l)；0.5 μ l of Taq enzyme；ddH₂O 17μ l。

PCR amplification is carried out after mixing.Loop parameter are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 1min, Gradient annealing temperature For 45 DEG C~60 DEG C (45.0 DEG C, 46.0 DEG C, 47.5 DEG C, 49.0 DEG C, 50.5 DEG C, 52.0 DEG C, 53.5 DEG C, 55.0 DEG C, 56.5 DEG C, 57.4 DEG C, 58.9 DEG C, 60.0 DEG C), anneal 1min, 72 DEG C of extension 1min, after 30 circulations, 72 DEG C of extension 10min.Separately set feminine gender Control, wherein template is not added, remaining ingredient is identical, with sterile deionized water polishing to same volume.

After amplification, takes 1 μ l product in observing clip size and brightness on 1% agarose gel electrophoresis, select most suitable Annealing temperature (heavy chain and light chain be all 55.0 DEG C) carry out the amplification of antibody variable region (reaction volume is 250 μ l).PCR reaction (250 μ l system) is as follows: 10 × PCR buffer, 25 μ l；dNTPs 20μl；10 μ l (10ng) of template；10 μ l of upstream primer (10 pmol/μl)；10 μ l of downstream primer (10pmol/ μ l)；5 μ l of Taq enzyme；ddH₂O 170μl。

PCR product is purified using plain agar sugar gel DNA QIAquick Gel Extraction Kit.Wherein, VH about 372bp, VL are about 315bp。

Six, the preparation and conversion of Escherichia coli Electroporation-competent cells

The bacillus coli DH 5 alpha bacterium solution that picking freezes is crossed in LB solid plate media surface, 37 DEG C of overnight incubations.It is secondary Day single bacterium colony of picking median size, is inoculated in 10ml LB liquid medium, 37 DEG C, 120rpm shaken cultivation about 10h.With Oese picks in bacterium solution access 10ml LB liquid medium, 37 DEG C, 120rpm shaken cultivation about 10h.It has been activated above-mentioned Strain is in 1/1000 ratio access 200ml LB liquid medium, 37 DEG C, 120rpm shaken cultivation work as OD₆₀₀Reach 0.35 When between~0.4, bacterium solution is collected into 50ml centrifuge tube, and 4 DEG C, 3000rpm are centrifuged 10min.Supernatant is abandoned, 40~50ml is added Deionized water is pre-chilled, thallus is resuspended, 4 DEG C, 3000rpm are centrifuged 10min, and repetitive operation is primary.Supernatant is abandoned, it is pre- that 40~50ml is added Thallus is resuspended in cold 10% (volume fraction) glycerol, and 4 DEG C, 3000rpm are centrifuged 10min, and repetitive operation is primary.Supernatant is exhausted, is added A small amount of 10% (volume fraction) glycerol of fresh pre-cooling dispenses after thallus is resuspended, every 100 μ l of pipe, -80 DEG C freeze it is spare.This step All triangular flasks used in rapid were all impregnated with concentrated acid, on the one hand guaranteed that absolute cleanliness is sterile, and can remove in triangular flask The ion of wall absorption.

5ng pUC19 standard plasmid is added in every pipe competent cell, carries out electricity under the conditions of 3kV, 25 μ F, 200 Ω and turns, is added 400 μ l LB 37 DEG C of shaken cultivation 1h of culture medium, spread plate, 37 DEG C of 12~16h of culture, next day observation electrotransformation result are simultaneously counted Calculate conversion ratio.As the result is shown: transformation efficiency is 1.4 × 10⁹。

Seven, the building in the library pTch1-1-scFv

PTch1-1 carrier is the carrier (sequence 12) of the present inventor's autonomous Design, and linker sequence is chicken Preceding 15 amino acid of CH1, for being connected to VH and VL, there are Hind III, Nhe I restriction enzyme site in the front end CH1, and rear end has BamH I, Xho I restriction enzyme site are inserted into convenient for VH segment and VL segment.

The coded sequence of preceding 15 amino acid of the heavy chain constant region CH1 of chicken:

5 '-the gcgagccccacatcgcccccccgattgtaccctctatccgcctgt-3 ' (373-417 of sequence 7 Position)

The sequence of preceding 15 amino acid of the heavy chain constant region CH1 of chicken is 125-139 of sequence 6 in sequence table.

The VH glue recovery product for taking step 5 to obtain and the progress of pTch1-1 carrier Hind III, Nhe I double digestion, 37 DEG C 3 h of water-bath, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.By VH and pTch1 digestion piece Duan Liyong T4Ligase is attached.The 2 above-mentioned connection products of μ l are added to the bacillus coli DH 5 alpha competence of step 6 preparation In cell, carries out electrotransformation and construct VH antibody library.

Next day collects all bacterium colonies and extracts plasmid, carries out Xho I, BamH I double digestion, while with Xho I, BamH I Double digestion is carried out to the VL recovery product that step 5 obtains.Glue recycling is carried out after digestion, connects the big of the simultaneously preparation of step of converting six Enterobacteria DH5 α competent cell, spread plate, 37 DEG C are incubated overnight.It collects bacterium colony and extracts plasmid, as pTch1-1- The library scFv.

The library pTch1-1-scFv of building is taken to carry out digestion identification and PCR identification.With Hind III, Nhe I and Xho I, BamH I carries out double digestion to the library pTch1-1-scFv.Taking pTch1-1-scFv Library plasmid is template, uses VH respectively Upstream primer and VL downstream primer carry out PCR identification to VH-Linker-VL.

As the result is shown: VH and VL have connected, and purpose band size is 760bp or so.

Eight, antigen is connected into the downstream pBGD plasmid pelB leader

1, the acquisition of Flag-VP2 fusion

Nhe I enzyme is added in the PCR primer of design clone's infectious bursal disease virus (IBDV) VP2 antigen, upstream primer Enzyme site, Flag sequence is added in downstream primer, and (nucleotides sequence is classified as in sequence table shown in sequence 3,2 institute of sequence in polynucleotide The Flag albumen shown) and BamH I restriction enzyme site.

Infectious bursal disease virus (IBDV) VP2 antigen: amino acid sequence is coding in sequence table shown in sequence 4 Gene is as shown in sequence 5 in sequence table.

VP2-F:5'-GCTAGCATGACAAACCTGCAAGATC-3'(underscore part is the identification sequence of Nhe I, Sequence afterwards is 1-19 of sequence 5 in sequence table)；

VP2-R:

5'-GGATCCTTACTTATCGTCGTCATCCTTGTAATC-TGCTCCTGCAATCTTCAGGGGAGA GTTG-3' (underscore part is the identification sequence of BamH I, and italicized item is Flag sequence ,-after sequence be the of sequence 5 in sequence table 1296-1323).

Using IBD street strain bursa of farbricius pathological material of disease as template, PCR amplification is carried out using primer VP2-F and VP2-R.

It is as follows that PCR reacts (25 μ l system): 10 × PCR buffer, 2.5 μ l；dNTPs 2.0μl；1.0 μ l of template (10ng)；1.0 μ l of upstream primer (10pmol/ μ l)；1.0 μ l of downstream primer (10pmol/ μ l)；0.5 μ l of Taq enzyme；ddH₂O 17μ l。

PCR amplification is carried out after mixing.Loop parameter are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 1min, Gradient annealing temperature It is 40 DEG C~65 DEG C, anneal 1min, 72 DEG C of extension 1min, after 30 circulations, 72 DEG C of extension 10min.Negative control separately is set, wherein Template is not added, remaining ingredient is identical, with sterile deionized water polishing to same volume.

After amplification, takes 1 μ l product in observing clip size and brightness on 1% agarose gel electrophoresis, select most suitable (62 DEG C) of annealing temperature progress VP2 antigen gene amplification, PCR product utilize plain agar sugar gel DNA QIAquick Gel Extraction Kit It is purified.

2, the building of pBGD-Flag-VP2 recombinant vector

PBGD carrier is the present inventor's autonomous Design carrier (sequence 1), pelB leader signal peptide on the carrier There are NheI, BamH I restriction enzyme site in encoding gene (167-232 of sequence 1) downstream, is inserted into convenient for antigen fragment.

VP2 antigen gene glue recovery product and pBGD carrier progress NheI, BamHI double digestion for taking step 1 to obtain, 37 DEG C Water-bath 3h, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.By VP2 antigenic site after the recovery Cause and pBGD carrier endonuclease bamhi are attached using T4Ligase.The 2 above-mentioned connection products of μ l are added to step 6 preparation It in bacillus coli DH 5 alpha competent cell, is converted, next day, picking monoclonal extracts plasmid, carries out NheI, the bis- enzymes of BamH I Cut identification.

As the result is shown: the purpose band size after digestion is about 1347bp, consistent with expected results.

By the correct plasmid sample presentation sequencing of Preliminary Identification.By through be sequenced show pBGD carrier restriction enzyme site Nhe I and Gained sequence (i.e. the sequence of VP2-Flag fusion) after insertion is sequentially joined end to end by sequence 5 and sequence 3 between BamH I Recombinant plasmid be named as pBGD-VP2-Flag.

Nine, the building in antigen-antibody coexpression library

There is Sfi I in NlpA leader signal DNA encoding peptide (5258-5344 of sequence 1) downstream on pBGD carrier ScFv segment can be scaled off from the library pTch1-1-scFv that step 7 constructs and be connected to step 8 structure by restriction enzyme site It is thin to be built into antigen-antibody coexpression for the NlpA leader signal DNA encoding peptide downstream for the pBGD-Flag-VP2 carrier built Bacterium display libraries.

The pBGD-Flag-VP2 carrier of the library pTch1-1-scFv for taking step 7 to construct and step 8 building carries out SfiI Digestion, 37 DEG C of water-bath 3h, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.By recycling ScFv segment and pBGD-Flag-VP2 carrier endonuclease bamhi are attached using T4Ligase.The above-mentioned connection product of 2 μ l is added In the bacillus coli DH 5 alpha competent cell prepared to step 6, the library that electrotransformation is built into antigen-antibody coexpression is carried out. Next day picking monoclonal extracts plasmid after conversion, carries out Sfi I digestion identification.

As the result is shown: the purpose band (consistent with expected results) that a size is about 735bp is obtained after digestion.It will be through enzyme It cuts the correct recombinant vector library of identification and is named as pBGD-Flag-VP2-scFv.

The identification sequence for the limitation restriction endonuclease (SfiI) used in this step is rare in antibody sequence, can avoid limitation inscribe Enzyme shreds some antibody fragments, and just uses a kind of limitation restriction endonuclease of SfiI, can be to avoid double digestion in the process due to reaction Condition inconsistent and cause digesting efficiency to reduce, cause digestion incomplete, so that the storage capacity of antibody library reduces.

Ten, the induction of bacillus coli DH 5 alpha and spheroplast preparation

All bacterium colonies in library that collection step nine constructs are diluted to OD with LB liquid medium₆₀₀0.2,37 DEG C of culture 2h of ≈, It is allowed to OD₆₀₀IPTG to final concentration of 2.5mmol/L, 37 DEG C of induction 4h is added in ≈ 0.4.

1.5ml culture is added in 1.5ml Eppendorf pipe, 6 000rpm are centrifuged 3min, remove supernatant.Thallus is heavy It forms sediment and is resuspended with 350 μ l sucrose (0.75mmol/L)/Tris (0.1mol/L) solution；35 μ l concentration are added to match for 10mg/ml is fresh (solvent is 350 μ l sucrose (0.75mmol/L)/Tris (0.1mol/L) solution to the lysozyme mother liquor of system, and the enzyme activity of lysozyme is 20U/g)；700 μ l 1mmol/L EDTA solution (solvent is water), while the mixing that is vortexed is added dropwise；It is incubated for 15min on ice；Add Enter 50 μ l 0.5mol/L MgCl₂Solution, and it is incubated for 10min on ice；4 DEG C, 10000rpm is centrifuged 10min；Collecting precipitating is For spheroplast.Washing is resuspended in spheroplast precipitating 1ml PBS solution, and 6 000rpm are centrifuged 3min, remove supernatant；Spheroplast Precipitating is resuspended with 100 μ l PBS.

11, flow cytometry screens bacillus coli DH 5 alpha display libraries

Bacteria cell wall forms spheroplast after being punched by lysozyme, the substances such as antigen, antibody are both transparent for cell at this time Wall is in contact with cell membrane and reacts.With the Flag antibody of FITC label, (Sigma Products, catalog number are F4049) the Flag-VP2 antigen fragment on incubated cell film in conjunction with the scFv of anchoring, if expressed successfully or expressed ScFv is that positive colony is then able to detect that fluorescence, it is on the contrary then cannot.The specific method is as follows:

10 μ l 1% (1g/100ml) are added in the PBS resuspended bacterium solution (IPTG has been induced) that 100 μ l step 10 obtain BSA stores the Flag antibody of liquid, 5 μ g FITC label, is protected from light is incubated for 1h on ice；8 000rpm are centrifuged 3min, 1ml PBS weight Outstanding to washed once, precipitating is resuspended with 100 μ l PBS.Negative control is set, recombinant vector library pBGD-Flag-VP2-scFv will be contained The bacterium solution (inducing without IPTG) of middle recombinant plasmid is treated as the Flag antibody incubation marked after spheroplast with FITC.With stream Formula cell instrument test sample and fluorescence intensity of negative control under 488nm wavelength laser are collected fluorescence intensity in sample and are higher than The part of negative control.

Sorting gained bacterium is subjected to plasmid extraction, electroporated to new bacillus coli DH 5 alpha, constructs secondary screens library, The second wheel screening (the Flag antibody dosage of FITC label is reduced to 3 μ g) is carried out by above-mentioned method, it will be in each peak ranges Cell sorting come out, prepare and convert bacillus coli DH 5 alpha after plasmid, construct secondary screens library, carry out third by above-mentioned method It is picking single colonie 20, thin with streaming one by one after spreading cultivation after wheel screening (the Flag antibody dosage of FITC label is reduced to 1.5 μ g) Born of the same parents' instrument detects, and selects the fluorescence signal clone stronger than negative control, is sequenced and is analyzed.Later in the screening of several steps by The Flag antibody for gradually reducing FITC label, is conducive to screen the stronger antibody of affinity.

The present invention is saved by way of extracting the new bacillus coli DH 5 alpha of plasmid, electrotransformation in the bacterium sorted out Positive antibody gene, simplifies test procedure, also avoids the generation of mutation and strand displacement that normal PCR rescue may cause, Increase the feasibility and practicability of this method.And it is thin that the competence without any plasmid is added when extracting plasmid Bacterium can reduce inevitably lose (adhesion loss) when extracting plasmid in this way, can increase the last total amount for extracting plasmid.

It is screened by three-wheel, obtains a monoclonal antibody with VP2 antigen with binding ability, be named as Anti-VP2 scFv antibody.

The encoding gene of anti-VP2scFv antibody (for single-chain antibody) is polynucleotide in sequence table shown in sequence 7 Anti-VP2scFv antibody shown in middle sequence 6.

12, the building of single-chain antibody expression vector (pET-27b-anti-VP2scFv)

The clone that PCR primer is used for single-chain antibody gene is designed using primer-design software Primer Premier 5.0. Nco I restriction enzyme site is added when designing upstream primer, downstream is added Hind III digestion site, is closed by Invitrogen company At.Specific primer sequence is as follows:

Anti-VP2scFv-F:CATGCCATGG(underscore part is the knowledge of Nco I to GT-GCCGTGACGTTGGACGAG Other sequence ,-after sequence be 1-18 of sequence 7)；

Anti-VP2scFv-R:CCCAAGCTT(underscore part is Hind III's to TTA-ACCTAGGACGGTCAGGG Identify sequence ,-after sequence be sequence 7 716-732 reverse complementary sequences).

Sequence table (is carried with the recombinant plasmid obtained through step 11 fluidic cell (FACS) screening using above-mentioned primer pair DNA fragmentation shown in middle sequence 7, anti-VP2scFv antibody shown in expressible nucleotide sequence 6) it is template PCR amplifications genetic fragment.Circulation Parameter are as follows: 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 72 DEG C of extension 1min, after 20 recycle, 72 DEG C Extend 10min.After amplification, take 1 μ l product in observing clip size on 1% agarose gel electrophoresis.The results show that PCR Primer size is about 732bp.PCR product is purified using plain agar sugar gel DNA QIAquick Gel Extraction Kit.After purification and PMD18-T carrier is attached, converts, picking monoclonal, upgrading grain and send sequencing.It will show through sequencing in pMD18-T carrier On be connected to " CATGCCATGGGT- sequence 7-TAAAAGCTTRecombinant plasmid after DNA fragmentation shown in GGG " is named as pMD18- T-anti-VP2scFv。

With restriction enzyme Nco I and Hind III digestion pMD18-T-anti-VP2scFv plasmid, size is recycled about For the target fragment of 732bp, with by same double digestion pET-27b carrier (be purchased from Novagen company, Cat.No.69337-3) skeleton large fragment is connected.By the 10 above-mentioned connection products of μ l first use bacillus coli DH 5 alpha competent cell into Row conversion, picking monoclonal, Nco I and Hind III digestion is identified after extracting plasmid.Digestion Preliminary Identification correctly (is obtained big It is small about 5414bp and 732bp two bands) recombinant plasmid sequencing.It will be through the digestion shown in pET-27b carrier be sequenced Recombinant plasmid after inserting DNA fragmentation shown in " GT- sequence 7-TAA " between Nco I and the Hind III of site is named as pET- 27b-anti-VP2scFv。

13, expression and purifying of the recombinant plasmid pET-27b-anti-VP2scFv in Escherichia coli

Positive recombinant plasmid pET-27b-anti-VP2scFv conversion Rosetta (DE3) for taking 10ng step 11 to obtain Competence bacteria is coated in the LB solid medium tablets containing 50 μ g/ml Kan, 37 DEG C of 12~16h of culture.

The several transformed bacterias of picking are inoculated in respectively in the LB liquid medium of the 50 μ g/ml Kan containing concentration, 37 DEG C of oscillation trainings It supports overnight, collects thallus and carry out PCR identification.

Picking identifies that correct pET-27b-anti-VP2scFv plasmid converts Rosetta (DE3) single colonie, is inoculated in and contains In the LB liquid medium for having 50 μ g/ml Kan.Next day takes above-mentioned culture to be inoculated according to the ratio of 1% (volume ratio) to contain In the culture medium for having 100 μ g/ml Kan, 37 DEG C of culture 2h work as OD₆₀₀When value is to about 0.4, IPTG is added (to final concentration of 0.25 mmol/L), 37 DEG C of cultures induce 4h.The control group that IPTG induction is not added separately is set, remaining condition is identical.

Induction group and control group culture 1ml is taken to be added in 1.5ml Ep pipe after induction respectively, room temperature 12000r/m It is centrifuged 1min and collects thallus.Abandon supernatant, precipitated with pre-cooling PBS (pH7.4) washing thalline of 100 μ l, 12 000r/m of room temperature from Supernatant is abandoned after heart 1min.Be added into induction group thallus 100 μ l pre-cooling PBS (pH7.4) suspend after ultrasonication, 12 000 R/m is centrifuged 10min, draws supernatant into another Ep pipe, and 100 μ l pre-cooling PBS (pH7.4) is added into precipitating and is resuspended.It is right simultaneously It is resuspended according to group with 100 μ l pre-cooling PBS (pH7.4).

1/3 volume 4 × SDS Sample Buffer is added into induction group supernatant, induction group precipitation and control group thallus suspension liquid Liquid (contains DTT), and 100 DEG C are boiled 5min.20 μ l samples are taken to carry out 15%SDS-PAGE.After electrophoresis, through coomassie brilliant blue R_250 Dyeing, methanol-glacial acetic acid destainer decoloration observe result to determine the expression of destination protein.

Supernatant is abandoned into thallus centrifugation after the induction of induction group, is resuspended with appropriate PBS and adds lysozyme to final concentration of 1mg/mL, 60min is placed on ice, and ultrasonication, 4 DEG C, 10000g is centrifuged 30min, inclusion body is collected, with dissolution buffer after washing (8mol/L urea liquid, pH8.0) sufficiently dissolves.It is filled with 100 milliliters of dissolution buffers (8mol/L aqueous solution of urea, pH8.0) Divide dissolution, is then splined on HiLoad 16/60Superdex75pg pillar (purchased from GE company), it is then slow with 500 milliliters of renaturation Fliud flushing (2mol/L aqueous solution of urea, pH8.0) elutes and collected the eluent after column, then dialyses in PBS buffer solution At night, obtaining solution is anti-VP2scFv antibody-solutions.All steps are under 4 DEG C of environment.Albumen after purification carries out SDS-PAGE electrophoretic analysis analyzes its purity using high performance liquid chromatograph (being purchased from Waters company).And with ultraviolet Spectrophotometer (ND-1000 type Spectrophotometer) detects its concentration.

As the result is shown: the protein band (albumen that size is about 28KD can be obtained through SDS-PAGE electrophoresis for albumen after purification Stripe size is consistent with expected results) (Fig. 1), recycling protein band is simultaneously sequenced, before N-terminal in 15 amino acid residues such as sequence table Shown in the 1-15 amino acids residue of sequence 6, i.e. AVTLDEPGGGLQTPG.In addition, purity of protein reaches 87%, concentration reaches To 1.4mg/ml.

14, ELISA detects the affinity and specificity of anti-VP2scFv antibody

(1) ELISA detects anti-VP2scFv antibody to the specificity and affinity of VP2 albumen

It 1, is respectively the anti-VP2scFv antibody of 300 μ g/ml, 60 μ g/ml, 12 μ g/ml, 2.4 μ g/ml with protein concentration Solution (i.e. the anti-VP2scFv antibody-solutions of step 13 preparation adjust protein concentration with coating buffer) coated elisa plate, 4 DEG C overnight, then washed 3 times with PBST buffer, each 2min.

2, (amino acid sequence of VP2 albumen is sequence to the VP2 protein solution that 100 μ l protein concentrations of every hole addition are 40 μ g/ml Sequence 4 in list adjust protein concentration with PBS buffer solution), then 37 DEG C of incubation 1h wash 3 times with PBST buffer, every time 2min。

3, it is added serum antibody (B87 plants of immune chickens obtain, and working concentration is 1:200 times and dilutes), 37 DEG C of incubation 1h, so It is washed 3 times with PBST buffer afterwards, each 2min.

4, the rabbit-anti chicken antibody that HRP is marked is added, and (Cat.No.11-7018 is purchased from eBioscience company, working concentration Diluted for 1:7500 times), then 37 DEG C of incubation 1h are washed 3 times, each 2min with PBST buffer.

5, tmb substrate developing solution is added, 37 DEG C are protected from light colour developing 5min.

6, the H of 50 μ l 2mol/L is added in every hole₂SO₄Aqueous solution detects OD value with microplate reader under wavelength 450nm.

It is arranged and replaces the anti-VP2scFv antibody-solutions in step 1, the VP2 in step 2 with isometric PBS buffer solution The PBS group of antibody in protein solution and step 3.The anti-VP2scFv antibody for being 300 μ g/ml with protein concentration in step 1 When solution coated elisa plate: being added without the control group 1 of VP2 protein solution in setting steps 2, pair of antibody is added without in step 3 It is added without the control group 3 that antibody is added without in VP2 protein solution and step 3 according to group 2, in step 2, with isometric and wait albumen dense The BSA solution of degree replaces the control group 4 of VP2 protein solution.

3 multiple holes are arranged in each processing.

As a result see Fig. 2.ELISA the result shows that, anti-VP2scFv antibody can be in conjunction with VP2 protein-specific.

(2) ELISA detects anti-VP2scFv antibody to the specificity and affinity of different IBDV viruses

1, with anti-VP2scFv antibody-solutions (the i.e. anti-of step 13 preparation that protein concentration is 300 μ g/ml VP2scFv antibody-solutions adjust protein concentration with coating buffer) coated elisa plate, 4 DEG C overnight, are then washed with PBST buffer 3 times, each 2min.

2, (viral dosage is 10 to 100 μ l IBDV virus liquids of every hole addition^5.0TCID₅₀), then 37 DEG C of incubation 1h use PBST Buffer washs 3 times, each 2min.

3, it is added serum antibody (B87 plants of immune chickens obtain, and working concentration is 1:200 times and dilutes), 37 DEG C of incubation 1h, so It is washed 3 times with PBST buffer afterwards, each 2min.

4, the rabbit-anti chicken antibody that HRP is marked is added, and (Cat.No.11-7018 is purchased from eBioscience company, working concentration Diluted for 1:7500 times), then 37 DEG C of incubation 1h are washed 3 times, each 2min with PBST buffer.

5, tmb substrate developing solution is added, 37 DEG C are protected from light colour developing 5min.

6, the H of 50 μ l 2mol/L is added in every hole₂SO₄Aqueous solution detects OD value with microplate reader under wavelength 450nm.

The strain that following IBDV is respectively adopted carries out above-mentioned experiment: Gt plants, NF8 plants, 1-65 plants, BJ836 plants, MB plants, B87 plants.

The anti-VP2scFv antibody-solutions replaced in step 1 with isometric PBS buffer solution are set, in step 2 The PBS group of antibody in IBDV virus liquid and step 3.The control group 1 of IBDV virus liquid, step 3 are added without in setting steps 2 In be added without the control group 2 of antibody, be added without the control group 3 for being added without antibody in IBDV virus liquid and step 3 in step 2, use The Newcastle Disease venom of the titres such as isometric replaces the control group 4 of IBDV virus liquid.

3 multiple holes are arranged in each processing.

As a result see Fig. 3.ELISA the result shows that, anti-VP2scFv antibody can in conjunction with different IBDV strain specifics, There is different affinity to different IBDV strains.

15, the neutralization activity measurement of anti-VP2scFv antibody

(1) measurement of IBDV titre

By the DF1 cell inoculation in logarithmic growth phase in 96 porocyte culture plates, DMEM culture medium 10 will be used¹To 10¹¹ The IBDV virus liquid (B87 plants) of gradient dilution is inoculated into cell monolayer (every 100 μ l of hole), and each dilution is inoculated with 8 cells Hole；The control group for being added without IBDV virus liquid is set.Tissue culture plate is put into cell incubator, 37 DEG C, 5%CO₂Culture, It is observed continuously 7 days, records cell growth state daily.Virus titer is calculated, the results are shown in Table 1 within the 7th day.

The result of the measurement of 1 IBDV titre of table

Dilution	There is the number of the cell hole of CPE	Do not occur the number of the cell hole of CPE	CPE percentage
				101	8	0	100%
102	8	0	100%
				103	8	0	100%
104	8	0	100%
				105	8	0	100%
106	4	4	50%
				107	3	5	37.5%
108	0	8	0%
				109	0	8	0%
1010	0	8	0%
				1011	0	8	0%
1012	0	8	0%

TCID is calculated according to Reed-Muench Liang Shi method₅₀=10^-6.8/0.1ml。

(2) neutralization activity of anti-VP2scFv antibody

By the DF1 cell inoculation in logarithmic growth phase in 96 porocyte culture plates, DMEM culture medium gradient dilution will be used Anti-VP2scFv antibody-solutions (i.e. the anti-VP2scFv antibody-solutions of step 13 preparation) and 100TCID afterwards₅₀'s IBDV virus liquid (B87 plants) mixes in equal volume and 37 DEG C of incubation 1h, is then seeded into cell monolayer, and each gradient is inoculated with 8 Cell hole；The normal control for being added without antibody-solutions and being added without virus liquid is set, and setting is only added without antibody-solutions and is only added The virus control of virus liquid.Tissue culture plate is put into thin incubator, 37 DEG C, 5%CO₂Culture is observed continuously 7 days, remembers daily Record cell growth state.It the results are shown in Table 2 within 7th day.

The result of the measurement of the neutralization activity of 2 anti-VP2scFv antibody of table

The result shows that anti-VP2scFv antibody has neutralization activity, blocks or the minimum protein concentration of inhibition CPE is 2.344μg/ml。

16, protective effect of the anti-VP2scFv antibody to IBDV infected chicken

(1) safety detection

10 13 age in days SPF chick are taken, the anti-VP2scFv antibody that chest muscle injection protein concentration is 2mg/ml respectively is molten Liquid (i.e. the scFv antibody-solutions of step 13 preparation adjust protein concentration with PBS buffer solution), every 1ml is observed 14 days.Nothing Injection site and systemic adverse reactions.

(2) measurement of IBDV semilethal rate

The chicken embryo for taking 9 ages in days is divided into 9 groups, every group 10, the 1st group to the 8th group, injects 200 μ L PBS buffer solution respectively Dilution gradient after dilution is 10¹-10⁸Infectious bursal disease virus HB/11 strain virus liquid, the 9th group be physiological saline pair According to group (every embryo injects 200 μ l physiological saline).Observation 3-6 days records chicken embryo survival condition.

As the result is shown: the chicken embryo median infective dose EID after 6 days₅₀It is 10^7.5/0.1ml

(3) Antibody Efficacy is tested

13 age in days SPF chickens are divided into five groups, every group 10.

First group: every chest muscle injects 0.2ml PBS buffer solution；

Second group: inoculation B87 strain vaccine, every chest muscle inject 0.2ml；

Third group: every chest muscle injects anti-VP2scFv antibody-solutions (1mg albumen/kg weight), every injection 0.2ml；

4th group: every chest muscle injects anti-VP2scFv antibody-solutions (0.5mg albumen/kg weight), every injection 0.2ml；

5th group: every chest muscle injects anti-VP2scFv antibody-solutions (0.1mg albumen/kg weight), every injection 0.2ml。

Detection neutralize antibody titers simultaneously inoculative infection bursa of Fabricius virus HB/11 strain virus liquid (every after 21 days immune Chest muscle injects 0.2ml, and dosage of inoculation is 4 × 10⁴EID₅₀) carry out attacking poison.

The measuring method (microtitrimetry) of neutralize antibody titers: (1) serum is taken, 56 DEG C of water-baths inactivate 30min, naturally cold But, serum work is serially diluted and (is diluted to 1:16384 from 1:2) for 2 times with Hank ' s liquid, isometric virus is added in every kind of dilution Suspension (100TCID₅₀/ 0.1ml) mixing, 37 DEG C of culture 1h fully shake；(2) chicken fibroblasts are inoculated in cell culture The mixed liquor that 100 microlitres of steps (1) obtain is added in plate, 100 microlitres of every hole, every hole；Be arranged normal control, negative serum control, Positive control and virus control；37 DEG C, 5%CO₂Culture, is observed continuously 3-5 days, if antibody has neutralization activity, DF1 cell Be not in lesion, calculate the 7th day antibody titer (can inhibit DF1 cell that the greatest dilution of lesion occurs).As a result see Table 3.

After attacking malicious 72h, the number of elements of dead chicken in every group is counted.It the results are shown in Table 3.

3 antibody titer result of table and every group of dead chicken number

Concentration	Neutralize antibody titers	Dead chicken number
			First group	1:23	6/10
Second group	1:212	0/10
			Third group	1:210	1/10
4th group	1:29	1/10
			5th group	1:28	2/10

The screening of the single-chain antibody of S1 before embodiment 2, anti-hepatitis B surface antigen

Virus B hepatitis be by caused by hepatitis B (HBV), based on liver inflammatory lesion, and more devices can be caused A kind of disease of official's damage.Virus B hepatitis (abbreviation hepatitis B) is a kind of infectious diseases for seriously endangering human health, There are about 3.5 hundred million people to infect hepatitis B (HBV) in the whole world, wherein nearly 10% patient's Ke Yin persistent infection causes chronicity, liver hard Change or hepatocellular carcinoma, the prevention and treatment of hepatitis B have become a global public health problem.Hepatitis type B virus (HBV) belongs to thermophilic Hepadnaviridae, genome are about 3.2kb, are partially double stranded cyclic DNA.Pathogenic HBV particle is that a kind of diameter is about The spherical DNA envelope virion of 42nm, the main component of envelope shell are hepatitis B surface antigen (HBsAg) and from place Main lipid, pre-s1 protein plays an important role in the assembly, infection and liver cancer of virion occur in HBsAg.It is anti- The antibody of preS1 can block the preS1 of HBV and liver cell to combine, and have the function of neutralizing virus, the recovery with HBV infection It is related, but the antibody for obtaining the anti-preS1 of people is very difficult, thus limit its clinical application.With genetically engineered bacteria exhibition The appearance for showing Antibody library makes it possible to obtain the anti-preS1 antibody of genetic engineering people.Genetic engineering recombinant antibodies are as high Compatibility, the targeting diagnosis based on albumen and treatment biological products, in terms of the anti-system of viral disease increasingly by Pay attention to.It is therefore desirable to develop the genetic engineering antibody drug of anti-preS1, the sky using genetic engineering antibody treatment hepatitis B is filled up It is white.

The present embodiment collects the donor blood of surface antigen antibody high-titer, therefrom isolates leucocyte, utilizes Reverse transcription is cDNA after the RNA of TRIZOL extraction peripheral white blood cells.According to the human antibody framework sequence on GenBank, if The degenerate primer for counting out clonal antibody variable region uses the method clonal antibody variable region of PCR using cDNA as template.Use height VH and VL segment are inserted respectively into the upstream and downstream of pTch1 carrier Linker, construct scFv by the electrotransformation method of effect Antibody library is connected into the downstream of pBGD bacterial display vector NlpA leader again, is before this first inserted into antigen fragment The downstream of pelB leader, the bacterium surface displaying library of building antigen-antibody coexpression.Using flow cytometer to antibody text Library is screened, and the monoclonal gene screened is connected into pET-27b carrier, and carry out inducing expression.

One, initial sample

With the peripheral white blood cells of the blood donor of surface antigen antibody high-titer for initial sample, as antibody library gene Source.This can not only increase the kurtosis of natural antibody, and can therefrom pick out the neutralizing antibody for popular strain, reach To the effect got twice the result with half the effort.

Two, the extraction of RNA

Take fresh peripheral blood leukocytes 10⁶Eppendorf (Ep) the Guan Zhongjia cold TRIzol of 1ml of pre-cooling, blows and beats repeatedly, mixes It is even, 10min, 12000rpm, 4 DEG C of centrifugation 10min are placed on ice.Supernatant is transferred in new Ep pipe, 200 μ l is added to be pre-chilled Phenol chloroform (phenol: chloroform=1:5, volume ratio) shakes vigorously and mix well 30sec, 12000rpm, 4 DEG C of centrifugation 10min.Supernatant is taken, weight It is centrifuged after being added with the oscillation of 200 μ l phenol chloroforms.Supernatant is taken, adds isometric cold isopropanol, -20 DEG C of placements 15min, 12000rpm, Room temperature is centrifuged 10min.Supernatant carefully is sucked, centrifuge tube is inverted, liquid feed is made to drain off.75 ﹪ ethyl alcohol are pre-chilled with 1ml, 12000rpm, 4 DEG C of centrifugation 5min wash RNA precipitate, abandon supernatant, be repeated 3 times, drying at room temperature.With 30 μ l sterilizing DEPC water dissolution RNA, -20 DEG C save backup.

Three, the synthesis of cDNA

The total tissue RNA extracted using step 2 is template, Oligo (dT)₁₈For primer, reference reverse transcriptase (M-MLVRT) The synthesis of specification progress first chain of cDNA.

Reaction system and reaction condition are as follows: Oligo (dT)₁₈1.0μl；5.0 μ l of total serum IgE template；DEPC-H₂O 5.0μ l.5min in 70 DEG C of water-baths places 5min on ice, sequentially adds: 1.0 μ l of RNasin；5×M-MLVRT buffer 5.0μl； dNTPs 5.0μl；DTT 5.0μl；M-MLVRT 1.0μl.42 DEG C of water-baths 2h, 70 DEG C of water-bath 15min take 1 μ l product in 1% fine jade Clip size is observed on sepharose electrophoresis.

Four, the design of the library scFv primer is cloned

The Accuracy and high efficiency of primer is the key that clone's variable region gene, and the present inventor is according to GenBank Human antibody framework sequence, design PCR amplification primer are used for the amplification of light chain and heavy chain variable region, and in heavy chain variable region gene Upstream and downstream is separately added into HindI II, Nhe I's restriction enzyme site, and light-chain variable region gene upstream and downstream is separately added into BamH I, I enzyme of Xho Enzyme site, primer are synthesized by TaKaRa company.Primer sequence is specific as follows:

Light chain divides Kappa type and Lambda type

Kappa chain upstream: BamH I restriction enzyme site (underscore part)

KU1:

5'-CGCGGATCCGACATCCAGATGACCCAGT-3'；

5'-CGCGGATCCGACATCGTGATGACCCAGT-3'；

5'-CGCGGATCCGATATTGTGATGACTCAGTCTCCA-3'；

5'-CGCGGATCCGAAATTGTGTTGACGCAGT-3'；

5'-CGCGGATCCGATGTTGTGATGACTCAGTCTCCA-3'；

5'-CGCGGATCCGAAACGACACTCACGCAGTCTCCA-3'。

Kappa chain downstream: Xho I restriction enzyme site (underscore part)

KD1:

5'-CCGCTCGAGTTAACGTTTGATTTCCACCTTGGTCCC-3'；

5'-CCGCTCGAGTTAACGTTTGATCTCCACCTTGGTCCC-3'；

5'-CCGCTCGAGTTAACGTTTGATCTCCAGCTTGGTCCC-3'；

5'-CCGCTCGAGTTAACGTTTTATTTCCACCTTGGTCCC-3'；

5'-CCGCTCGAGTTAACGTTTGATATCCACTTTGGTCCC-3'；

5'-CCGCTCGAGTTAACGTTTAATCTCCAGTCGTGTCCC-3'。

The upstream Lambda: BamH I restriction enzyme site (underscore part)

LU1:

5'-CGCGGATCCCAGTCTGCCCTGACTCAGCCTG-3'；

5'-CGCGGATCCCAGTCTGTGCTGACTCAGCCAC-3'；

5'-CGCGGATCCTCCTATGAGCTGACACAGCCAC-3'；

5'-CGCGGATCCTCCTATGAGCTGACTCAGCCAC-3'；

5'-CGCGGATCCTCCTATGAGCTGACTCAGGCAC-3'；

5'-CGCGGATCCAATTTTATGCTGACTCAGCCCC-3'；

5'-CGCGGATCCTCGTCTGAGCTGACTCAGGACC-3'；

5'-CGCGGATCCTCTGAGCTGACTCAGGACCCTG-3'。

The downstream Lambda: Xho I restriction enzyme site (underscore part)

LD1:

5'-CCGCTCGAGTTACTAGGACGGTCAGCTTGGTCC-3；

5'-CCGCTCGAGTTAACCTAGGACGGTGACCTTGGTC-3'；

5'-CCGCTCGAGTTAACCTAGGACGGTCAGCTTGGTC-3'；

5'-CCGCTCGAGTTACTGTGACGGTCAGCTTGGTCCC-3'。

Heavy chain

Ig Gamma chain upstream: Hind III digestion site (underscore part)

IGU1:

5'-CCCAAGCTTGAGGTGCAGCTGCTCGAGTCT-3'；

5'-CCCAAGCTTGAGGTGCAGCTGTTGGAGTCT-3'；

5'-CCCAAGCTTGAGGTGCAGTTGTTGGAGTCT-3'；

5'-CCCAAGCTTGAGGTGCAGCTGGTGGAATCT-3'；

5'-CCCAAGCTTGAGGTGCAGTTGGTGGAGTCT-3'；

5'-CCCAAGCTTGAGGTGCAGCTGGTGGAGTCC-3'；

5'-CCCAAGCTTGAAGTGCAGCTGGTGGAGTCT-3'；

5'-CCCAAGCTTCAGGTGCAGATGGTGGAGTCT-3'；

5'-CCCAAGCTTCAGGTGCAGTTGGTGGAGTCT-3'；

5'-CCCAAGCTTCAGGTGCAACTGGTGGAGTCT-3'；

5'-CCCAAGCTTCAGGTGCAGCTGGTGGAATCT-3'；

5'-CCCAAGCTTCAGGTGCAGCTGGTGGAGTC-3'；

5'-CCCAAGCTTCAGGTGCAGTTGGAAGAATCT-3'；

5'-CCCAAGCTTCAGGTGCAGTTGGAGGAATCT-3'；

5'-CCCAAGCTTCAGGTGCAGCTGCAGGAGTCG-3'；

5'-CCCAAGCTTCAGCTGCAGCTGCAGGAGTCG-3'；

5'-CCCAAGCTTCAGGTGCAGCTGGTGGAGTCT-3'；

5'-CCCAAGCTTGAGGTGCAGCTGCTGGAGTCT-3'；

5'-CCCAAGCTTGAGGTTCAGCTGGTGGAGTCT-3'；

5'-CCCAAGCTTGAGGTGCAGCTGGTGCAGTCT-3'；

5'-CCCAAGCTTCAGGTCCAGCTGGTGCAG-3'；

5'-CCCAAGCTTCAGGTACAGCTGCAGCAGTCA-3'；

Ig Gamma chain downstream: Nhe I restriction enzyme site (underscore part)

IGD1:

5'-CGGCTAGCTGAAGAGACGGTGACCATTGTC-3'；

5'-CGGCTAGCTGAGGAGACGGTGACCATGGTC-3'；

5'-CGGCTAGCTGAGGAGACGGTGACCAGGGTT-3'；

5'-CGGCTAGCTGAAGAGACGGTGACCAGGGTT-3'；

5'-CGGCTAGCTGAGGAGACGGTGACCGTGGTCC-3'；

5'-CGGCTAGCTGAGGAGACGGTGACCAGGATT-3'。

Five, the PCR amplification of antibody variable region

Using the cDNA synthesized in step 3 as template, gradient is carried out with VH upstream and downstream primer and VL upstream and downstream primer respectively PCR amplification, determines optimum annealing temperature.Wherein, it is separated in VL upstream and downstream primer for the primer of Kappa chain and Lambda chain It is used alone, that is, when expanding the VL of Kappa chain, upstream primer is the equimolar mixture of each primer in KU1, downstream primer For the equimolar mixture of each primer in KD1；When expanding the VL of Lambda chain, upstream primer is each primer in LU1 Equimolar mixture, downstream primer be LD1 in each primer equimolar mixture.It is carried out using VH upstream and downstream primer When PCR amplification, upstream primer is the equimolar mixture of each primer in IGU1, and downstream primer is each primer in IGD1 Equimolar mixture.

It is as follows that PCR reacts (25 μ l system): 10 × PCR buffer, 2.5 μ l；dNTPs 2.0μl；1.0 μ l of template (10ng)；1.0 μ l of upstream primer (concentration of primer is 10pmol/ μ l after mixing)；1.0 μ l of downstream primer (primer after mixing Concentration is 10pmol/ μ l)；0.5 μ l of Taq enzyme；ddH₂O 17μl。

PCR amplification is carried out after mixing.Loop parameter are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 1min, Gradient annealing temperature For 48.5 DEG C~61.5 DEG C (48.5 DEG C, 48.9 DEG C, 49.8 DEG C, 51.1 DEG C, 52.6 DEG C, 54.2 DEG C, 55.8 DEG C, 57.4 DEG C, 58.9 DEG C, 60.2 DEG C, 61.1 DEG C, 61.5 DEG C), anneal 1min, 72 DEG C of extensions 1min, after 30 recycle, 72 DEG C of extension 10min.Separately set Negative control, wherein template is not added, remaining ingredient is identical, with sterile deionized water polishing to same volume.

After amplification, takes 1 μ l product in observing clip size and brightness on 1% agarose gel electrophoresis, select most suitable Annealing temperature (the most suitable annealing temperature of Kappa chain are as follows: 57.4 DEG C, the most suitable annealing temperature of Lambda chain are as follows: 61.1 DEG C, the most suitable annealing temperature of VH chain are as follows: 58.9 DEG C) carry out antibody variable region amplification.PCR reacts (250 μ l system) such as Under: 10 × PCR buffer, 25 μ l；dNTPs 20μl；10 μ l (10ng) of template；10 μ l of upstream primer (10pmol/ μ l)；Downstream 10 μ l of primer (10pmol/ μ l)；5 μ l of Taq enzyme；ddH₂O 170μl。

PCR product is purified using plain agar sugar gel DNA QIAquick Gel Extraction Kit, and will be to Kappa chain, Lambda chain The amplified production mixing of PCR reaction.Wherein, VH about 385bp, VL about 345bp.

Six, the preparation of Escherichia coli Electroporation-competent cells

The bacillus coli DH 5 alpha bacterium solution that picking freezes is crossed in LB solid plate media surface, 37 DEG C of overnight incubations.It is secondary Day single bacterium colony of picking median size, is inoculated in 10ml LB liquid medium, 37 DEG C, 120rpm shaken cultivation about 10h.With Oese picks in bacterium solution access 10ml LB liquid medium, 37 DEG C, 120rpm shaken cultivation about 10h.It has been activated above-mentioned Strain is in 1/1000 ratio access 200ml LB liquid medium, 37 DEG C, 120rpm shaken cultivation work as OD₆₀₀Reach 0.35 When between~0.4, bacterium solution is collected into 50ml centrifuge tube, and 4 DEG C, 3000rpm are centrifuged 10min.Supernatant is abandoned, 40~50ml is added Deionized water is pre-chilled, thallus is resuspended, 4 DEG C, 3000rpm are centrifuged 10min, and repetitive operation is primary.Supernatant is abandoned, it is pre- that 40~50ml is added Thallus is resuspended in cold 10% (volume fraction) glycerol, and 4 DEG C, 3000rpm are centrifuged 10min, and repetitive operation is primary.Supernatant is exhausted, is added A small amount of 10% (volume fraction) glycerol of fresh pre-cooling dispenses after thallus is resuspended, every 100 μ l of pipe, -80 DEG C freeze it is spare.This step All triangular flasks used in rapid were all impregnated with concentrated acid, on the one hand guaranteed that absolute cleanliness is sterile, and can remove in triangular flask The ion of wall absorption.

5ng pUC19 standard plasmid is added in every pipe competent cell, carries out electricity under the conditions of 3kV, 25 μ F, 200 Ω and turns, is added 400 μ l LB 37 DEG C of shaken cultivation 1h of culture medium, spread plate, 37 DEG C of 12~16h of culture, next day observation electrotransformation result are simultaneously counted Calculate conversion ratio.As the result is shown: transformation efficiency is 1.1 × 10⁹。

Seven, the building in the library pTch1-2-scFv

PTch1-2 carrier is the carrier (sequence 13) of the present inventor's autonomous Design, and linker sequence is people's Preceding 15 amino acid of CH1, for being connected to VH and VL, there are Hind III, Nhe I restriction enzyme site in the front end CH1, and rear end has BamH I, Xho I restriction enzyme site are inserted into convenient for VH segment and VL segment.

The coded sequence of preceding 15 amino acid of the heavy chain constant region CH1 of people:

5 '-the GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCT-3 ' (382-426 of sequence 11 Position)

The sequence of preceding 15 amino acid of the heavy chain constant region CH1 of people is 128-142 of sequence 10 in sequence table.

The VH glue recovery product for taking step 5 to obtain and the progress of pTch1-2 carrier Hind III, Nhe I double digestion, 37 DEG C 3 h of water-bath, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.By VH and pTch1-2 digestion Segment is attached using T4Ligase.The 2 above-mentioned connection products of μ l are added to the bacillus coli DH 5 alpha impression of step 6 preparation In state cell, carries out electrotransformation and construct VH antibody library.

Next day collects all bacterium colonies and extracts plasmid, carries out Xho I, BamH I double digestion, while with XhoI, BamH I Double enzymes are carried out to the VL recovery product that step 5 obtains.Glue recycling is carried out after digestion, connects the large intestine that simultaneously step of converting six obtains Bacillus DH5 α competent cell, spread plate, 37 DEG C are incubated overnight.It collects bacterium colony and extracts plasmid, as pTch1-2-scFv Library.

The library pTch1-2-scFv of building is taken to carry out digestion identification and PCR identification.With Hind III, Nhe I and Xho I, BamH I carries out double digestion to the library pTch1-2-scFv.Taking pTch1-2-scFv Library plasmid is template, uses VH respectively Upstream primer and VL downstream primer carry out PCR identification to it.

(Fig. 4) as the result is shown, VH and VL have been attached to together, size about 770bp.

Eight, antigen is connected into the downstream pBGD plasmid pelB leader

The PCR primer of pre-S 1 antigens of hepatitis B viruses is designed, Nhe I restriction enzyme site is added in upstream primer, and downstream primer is added Flag sequence (nucleotides sequence is classified as in sequence table shown in sequence 3, Flag albumen shown in sequence 2 in polynucleotide) and BamHI restriction enzyme site.

Pre-S 1 antigens of hepatitis B viruses: amino acid sequence is sequence in encoding gene such as sequence table in sequence table shown in sequence 8 Shown in column 9.

PreS1-F:GCTAGC(underscore part is the identification sequence of Nhe I to ATGGGAGGTTG, and sequence thereafter is sequence 1-11 of sequence 9 in list)

PreS1-R:GGATCC(underscore part is TTACTTATCGTCGTCATCCTTGTAATCGGCCTGAGGATG The identification sequence of BamHI, italicized item are the coding gene sequence of Flag label, and sequence thereafter is sequence 9 in sequence table 346-357 reverse complementary sequences).

With HBV gene group sequence shown in GenBank Accession No.AB205124 in artificial synthesized gene pool It is classified as template, PCR amplification is carried out using primer preS1-F and preS1-R.

It is as follows that PCR reacts (25 μ l system): 10 × PCR buffer, 2.5 μ l；dNTPs 2.0μl；1.0 μ l of template (10ng)；1.0 μ l of upstream primer (10pmol/ μ l)；1.0 μ l of downstream primer (10pmol/ μ l)；0.5 μ l of Taq enzyme；ddH₂O 17μ l。

PCR amplification is carried out after mixing.Loop parameter are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 1min, Gradient annealing temperature It is 40 DEG C~65 DEG C, anneal 1min, 72 DEG C of extension 1min, after 30 circulations, 72 DEG C of extension 10min.Negative control separately is set, wherein Template is not added, remaining ingredient is identical, with sterile deionized water polishing to same volume.

After amplification, takes 1 μ l product in observing clip size and brightness on 1% agarose gel electrophoresis, select most suitable (48.9 DEG C) of annealing temperature progress antibody variable region amplification, PCR product utilize plain agar sugar gel DNA QIAquick Gel Extraction Kit It is purified.

2, the building of pBGD-Flag-preS1 recombinant vector

PBGD carrier is the present inventor's autonomous Design carrier (sequence 1), pelB leader signal peptide on the carrier There are NheI, BamH I restriction enzyme site in encoding gene (167-232 of sequence 1) downstream, is inserted into convenient for antigen fragment.

The preceding S1 glue recovery product and pBGD carrier for taking step 1 to obtain carry out Nhe I, BamH I double digestion, 37 DEG C of water-baths 3 H, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.By preS1 antigen after the recovery and PBGD carrier endonuclease bamhi is attached using T4Ligase.The 2 above-mentioned connection products of μ l are added to the large intestine of step 6 preparation It in bacillus DH5 α competent cell, is converted, next day, picking monoclonal extracts plasmid, carries out Nhe I, BamH I double digestion Identification.

As the result is shown: cutting the preS1-Flag fusion segment that size is about 381bp.

By the correct plasmid sample presentation sequencing of Preliminary Identification.By through be sequenced show pBGD carrier restriction enzyme site Nhe I and Insertion " sequence (the i.e. sequence of preS1-Flag fusion obtained by after sequentially being joined end to end by sequence 9 and sequence 3 between BamH I Column) recombinant plasmid be named as pBGD-preS1-Flag.

Nine, the building in antigen-antibody coexpression library

There is Sfi I in NlpA leader signal DNA encoding peptide (5258-5344 of sequence 1) downstream on pBGD carrier ScFv segment can be scaled off from the library pTch1-2-scFv that step 7 constructs and be connected to step 8 structure by restriction enzyme site The NlpA leader signal DNA encoding peptide downstream for the pBGD-Flag-preS1 carrier built is built into antigen-antibody coexpression Bacterial display library.

The pBGD-Flag-preS1 carrier of the library pTch1-2-scFv for taking step 7 to construct and step 8 building carries out SfiI digestion, 37 DEG C of water-bath 3h, 1% agarose gel electrophoresis observe result.Above-mentioned digestion products are subjected to glue recycling.It will return The scFv segment and pBGD-Flag-preS1 carrier endonuclease bamhi of receipts are attached using T4Ligase.The above-mentioned connection of 2 μ l is produced Object is added in the bacillus coli DH 5 alpha competent cell of step 6 preparation, is carried out electrotransformation and is built into antigen-antibody coexpression Library.Next day picking monoclonal extracts plasmid after conversion, carries out Sfi I digestion identification.

As the result is shown: cutting the scFv library fragments that size is about 760bp.Correct recombinant vector library will be identified through digestion It is named as pBGD-Flag-preS1-scFv.

The identification sequence for the limitation restriction endonuclease (SfiI) used in this step is rare in antibody sequence, can avoid limitation inscribe Enzyme shreds some antibody fragments, and just uses a kind of limitation restriction endonuclease of SfiI, can be to avoid double digestion in the process due to reaction Condition inconsistent and cause digesting efficiency to reduce, cause digestion incomplete, so that the storage capacity of antibody library reduces.

Ten, the induction of bacillus coli DH 5 alpha and spheroplast preparation

All bacterium colonies in library that collection step nine constructs are diluted to OD with LB liquid medium₆₀₀0.2,37 DEG C of culture 2h of ≈, It is allowed to OD₆₀₀IPTG to final concentration of 0.25mmol/L, 37 DEG C of induction 4h is added in ≈ 0.4.

2mL culture is collected, 12 000rpm are centrifuged 1min, abandon supernatant.350 μ l Sucrose of bacterial sediment (0.75mmol/L)/Tris (0.1mol/L) solution is resuspended；The bacteriolyze that 35 μ l concentration are 10mg/ml Fresh is added (solvent is 350 μ l Sucrose (0.75mmol/L)/Tris (0.1mol/L) solution to enzyme mother liquor, and the enzyme activity of lysozyme is 20U/g)；700 μ l, 1 mmol/L EDTA solution (solvent is water), while the mixing that is vortexed is added dropwise；It is incubated for 15min on ice； 50 μ l 0.5mol/L MgCl are added₂Solution, and it is incubated for 10min on ice；4 DEG C, 10 000rpm are centrifuged 10min；Spheroplast Washing is resuspended in precipitating 1ml PBS solution, and 6 000rpm are centrifuged 3min, remove supernatant；Spheroplast precipitating 100 μ l PBS weight It is outstanding.

11, flow cytometry screens bacillus coli DH 5 alpha display libraries

Bacteria cell wall forms spheroplast after being punched by lysozyme, the substances such as antigen, antibody are both transparent for cell at this time Wall is in contact with cell membrane and reacts.With the Flag antibody of FITC label, (Sigma Products, catalog number are F4049) the Flag-preS1 antigen fragment on incubated cell film in conjunction with the scFv of anchoring, if expressed successfully or expressed ScFv is that positive colony is then able to detect that fluorescence, it is on the contrary then cannot.The specific method is as follows:

Be added in the bacterium solution (IPTG induce) that 100 μ l PBS are resuspended 10 μ l, 1% (1g/100ml) BSA storage liquid, The Flag antibody of 5 μ g FITC label, is protected from light is incubated for 1h on ice；8 000rpm are centrifuged 3min, and 1ml PBS resuspension washed once, Precipitating is resuspended with 100 μ l PBS.Negative control is set, recombinant plasmid in the pBGD-Flag-preS1-scFv of recombinant vector library will be contained Bacterium solution (being induced without IPTG) be treated as the Flag antibody incubation marked after spheroplast with FITC.With flow cytometer in Test sample and the fluorescence intensity of negative control under 488nm wavelength laser collect fluorescence intensity in sample and are higher than negative control Part.

Sorting gained bacterium is subjected to plasmid, electroporated to new bacillus coli DH 5 alpha, secondary screens library is constructed, by upper The method stated carries out the second wheel screening (the Flag antibody dosage of FITC label is reduced to 3 μ g), will be thin in each peak ranges Born of the same parents sort out, and convert bacillus coli DH 5 alpha after preparing plasmid, construct secondary screens library, carry out third round sieve by above-mentioned method After choosing (the Flag antibody dosage of FITC label is reduced to 1.5 μ g), picking single colonie 20, flow cytometer is used after spreading cultivation one by one It is detected, selects the fluorescence signal clone stronger than negative control, be sequenced and analyzed.It is gradually dropped in a few step screenings later The Flag antibody of low FITC label, is conducive to screen the stronger antibody of affinity.

The present invention is saved by way of extracting the new bacillus coli DH 5 alpha of plasmid, electrotransformation in the bacterium sorted out Positive antibody gene, simplifies test procedure, also avoids the generation of mutation and strand displacement that normal PCR rescue may cause, Increase the feasibility and practicability of this method.And it is thin that the competence without any plasmid is added when extracting plasmid Bacterium can reduce inevitably lose (adhesion loss) when extracting plasmid in this way, can increase the last total amount for extracting plasmid.

Fluidic cell the selection result is as shown in Figure 5.It is screened by three-wheel, obtaining one has with preS1 antigen in conjunction with energy The monoclonal antibody of power is named as anti-preS1scFv antibody.

The encoding gene of anti-preS1scFv antibody (for single-chain antibody) is coded sequence in sequence table shown in sequence 11 Anti-preS1scFv antibody shown in sequence 10 in table.

12, the building of single-chain antibody expression vector (pET-27b-anti-preS1scFv)

The clone that PCR primer is used for single-chain antibody gene is designed using primer-design software Primer Premier 5.0. Nco I restriction enzyme site is added when designing upstream primer, downstream is added XhoI restriction enzyme site, is synthesized by Invitrogen company.Tool Body primer sequence is as follows:

Anti-preS1scFv-F:CCATGG(underscore part is the identification sequence of Nco I to GT-TCGGTGCAGTTGGTG Column ,-after sequence be 1-15 of sequence 11)；

Anti-preS1scFv-R:CTCGAGTTAACGTTTGATATCC (underscore part is the identification sequence of XhoI ,- Sequence afterwards is 753-768 reverse complementary sequences of sequence 11).

Sequence in sequence table (is carried with the recombinant plasmid obtained through step 11 fluidic cell (FACS) screening using primer DNA fragmentation shown in 11, anti-preS1scFv antibody shown in expressible nucleotide sequence 10) it is template PCR amplifications genetic fragment.Circulation Parameter are as follows: 95 DEG C of initial denaturations 5min, 95 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 72 DEG C of extension 1min, after 20 recycle, 72 DEG C Extend 10min.After amplification, take 1 μ l product in observing clip size on 1% agarose gel electrophoresis.The results show that PCR Primer size is about 768bp.PCR product is purified using plain agar sugar gel DNA QIAquick Gel Extraction Kit.After purification and PMD18-T carrier is attached, converts, picking monoclonal, upgrading grain and send sequencing.It will show through sequencing in pMD18-T carrier On be connected to "CCATGGGT- sequence 11-CTCGAG" shown in recombinant plasmid after DNA fragmentation be named as pMD18-T-anti- preS1scFv。

With restriction enzyme Nco I and XhoI digestion pMD18-T-anti-preS1scFv plasmid, recycling size is about The target fragment of 768bp (is purchased from Novagen company, Cat.No.69337- with the pET-27b carrier by same double digestion 3) skeleton large fragment is connected.The 10 above-mentioned connection products of μ l are first converted with bacillus coli DH 5 alpha competent cell, picking list Clone, Nco I and XhoI digestion is identified after extracting plasmid.By digestion Preliminary Identification it is correct (obtain size be about 5414bp and Two bands of 768bp) recombinant plasmid sequencing.By through be sequenced show pET-27b carrier restriction enzyme site Nco I and Recombinant plasmid after inserting DNA fragmentation shown in " GT- sequence 11 " between XhoI is named as pET-27b-anti-preS1scFv.

13, expression and purifying of the recombinant plasmid pET-27b-anti-preS1scFv in Escherichia coli

The positive recombinant plasmid pET-27b-anti-preS1scFv conversion Rosetta for taking 10ng step 12 to obtain (DE3) competence bacteria is coated in the LB solid medium tablets containing 50 μ g/ml Kan, 37 DEG C of 12~16h of culture.

The several transformed bacterias of picking are inoculated in respectively in the LB liquid medium of the 50 μ g/ml Kan containing concentration, 37 DEG C of oscillation trainings It supports overnight, collects thallus and carry out PCR identification.

Picking identifies that correct pET-scFv converts Rosetta (DE3) single colonie, is inoculated in containing 50 μ g/ml Kan's In LB liquid medium.Next day takes above-mentioned culture to be inoculated according to the ratio of 1% (volume ratio) containing 100 μ g/ml Kan's In culture medium, 37 DEG C of culture 2h work as OD₆₀₀When value is to about 0.4, IPTG (to final concentration of 0.25mmol/L), 37 DEG C of trainings are added It supports, induces 4h.The control group that IPTG induction is not added separately is set, remaining condition is identical.

Induction group and control group culture 1ml is taken to be added in 1.5ml Ep pipe after induction respectively, room temperature 12000r/m It is centrifuged 1min and collects thallus.Abandon supernatant, precipitated with pre-cooling PBS (pH7.4) washing thalline of 100 μ l, 12 000r/m of room temperature from Supernatant is abandoned after heart 1min.Be added into induction group thallus 100 μ l pre-cooling PBS (pH7.4) suspend after ultrasonication, 12 000 R/m is centrifuged 10min, draws supernatant into another Ep pipe, and 100 μ l pre-cooling PBS (pH7.4) is added into precipitating and is resuspended.It is right simultaneously It is resuspended according to group with 100 μ l pre-cooling PBS (pH7.4).

1/3 volume 4 × SDS Sample Buffer is added into induction group supernatant, induction group precipitation and control group thallus suspension liquid Liquid (contains DTT), and 100 DEG C are boiled 5min.20 μ l samples are taken to carry out 15%SDS-PAGE.After electrophoresis, through coomassie brilliant blue R_250 Dyeing, methanol-glacial acetic acid destainer decoloration observe result to determine the expression of destination protein.

Supernatant is abandoned into thallus centrifugation after the induction of induction group, is resuspended with appropriate PBS and adds lysozyme to final concentration of 1mg/mL, 60min is placed on ice, and ultrasonication, 4 DEG C, 10000g is centrifuged 30min, inclusion body is collected, with dissolution buffer after washing (8mol/L urea liquid, pH8.0) sufficiently dissolves.It is filled with 100 milliliters of dissolution buffers (8mol/L aqueous solution of urea, pH8.0) Divide dissolution, is then splined on HiLoad 16/60Superdex75pg pillar (purchased from GE company), it is then slow with 500 milliliters of renaturation Fliud flushing (2mol/L aqueous solution of urea, pH8.0) elutes and collected the eluent after column, then dialyses in PBS buffer solution At night, obtaining solution is anti-preS1scFv antibody-solutions.All steps are under 4 DEG C of environment.Albumen after purification carries out SDS-PAGE electrophoretic analysis analyzes its purity using high performance liquid chromatograph (being purchased from Waters company).And with ultraviolet Spectrophotometer (ND-1000 type Spectrophotometer) detects its concentration.As the result is shown: albumen after purification is through SDS- The protein band (protein band size is consistent with expected results) (Fig. 6) that size is about 27.1KD can be obtained in PAGE electrophoresis, Recycling protein band is simultaneously sequenced, 1-15 amino acids residue institute of 15 amino acid residues such as sequence 10 in sequence table before N-terminal Show, i.e. SVQLVESGGGLVQPG.In addition, purity of protein reaches 78%, concentration reaches 1.7mg/ml.

14, ELISA detects the affinity power of anti-preS1scFv antibody

Anti-preS1scFv antibody prepared by step 13 is coated in elisa plate and 4 DEG C are stayed overnight, peridium concentration gradient For 100 μ g/mL, 50 μ g/mL, 10 μ g/mL, 5 μ g/mL, for detecting anti-preS1scFv to the specificity of preS1 albumen, Negative control group is set simultaneously.Coating is washed 3 times, each 2min after overnight with PBST, with 5% (5g/100ml) skimmed milk power 37 After washing the preS1 albumen (amino acid sequence be sequence table in sequence 8) of 10 μ g/mL is added, 37 DEG C incubate in DEG C closing 2h 1h is educated, washing is the same, and primary antibody (preS1 monoclonal antibody, Fitzgerald (Massachusetts, America) company is added Product, catalog number Cat.No.10-H07A；2000 times of dilution), it is incubated for washing and is same as above.Add secondary antibody (HRP- Goat anti-mouse antibody, eBioscienc (San Diego, America) Products, catalog number are Cat.No.11-7018；7500 times of dilution), 37 DEG C of incubation 1h after washing, are added tmb substrate liquid, are protected from light colour developing in 37 DEG C The 50 μ L terminate liquid (H of 2mol/L are added in 5min, every hole₂SO₄), its OD value is detected under wavelength 450nm with microplate reader.

It is arranged and replaces anti-preS1scFv antibody-solutions, preS1 albumen and antibody with isometric PBS buffer solution PBS group.The control group 1 for being added without preS1 albumen is set, the control group 2 of antibody is added without, is added without preS1 albumen and is not added The control group 3 for entering antibody, with the scFv of anti-hIL-1 β that is isometric and waiting protein concentrations, (amino acid sequence is sequence in sequence table 14) control group 4 of anti-preS1scFv is replaced.

3 multiple holes are arranged in each processing.

As a result see Fig. 7: ELISA the result shows that, anti-preS1scFv antibody can be in conjunction with preS1 protein-specific.

15, the neutralization activity identification of anti-preS1scFv antibody

Anti-preS1scFv antibody prepared by step 13, it is each with 5 μ g/mL of concentration gradient, 25 μ g/mL, 50 μ g/mL The preS1-FITC preS1 albumen of label (FITC) of 200 μ l and 5 μ g/mL after 4 DEG C of pre-reaction 1h, by reaction solution and HepG2 cell or Chang cell (also referred to as CCL 13 or Chang liver cell) (10⁵A cell) it is incubated at 4 DEG C After 1h, PBS washs cell twice, is detected with flow cytometer.Provided with the blank control group for not adding reaction solution, only add The positive controls of 5 μ g/mL preS1-FITC and with 5 μ g/mL preS2-FITC (FITC label preS2 albumen, preS2 The amino acid sequence of albumen is by sequence 15 in sequence table) replace the negative control group of 5 μ g/mL preS1-FITC.

As a result as shown in Figure 8, it is seen that preS1-FITC can be specifically bound with HepG2 cell or CCL 13, Anti-preS1scFv antibody can be combined with the functional epitope of preS1 albumen, prevent preS1-FITC and HepG2 cell or The combination that CCL 13 occurs.Fig. 9 is inhibiting rate of the anti-preS1scFv antibody to preS1-FITC albumen, with Fig. 8's As a result convert come inhibiting rate, formula are as follows: [(average fluorescent strength-anti-preS1scFv of preS1-FITC group with The average fluorescent strength of preS1-FITC group)/(1 group of average fluorescent strength-negative control of mean fluorecence of preS1-FITC group Intensity)] × 100.It can be seen that anti-preS1scFv antibody is to the inhibition of preS1-FITC albumen at metering dependence.

10 are collected from HepG2.2.15 cells and supernatant⁴The HBV virion and concentration of copy be 50 μ g/ml, The anti-preS1scFv antibody mixing of 100 μ g/ml is abundant, in (25 DEG C) reaction 1h of room temperature.By mixture and Chang cell (10⁵A cell) after 37 DEG C of incubation 1h, Incubating Solution is discarded with PBS and washs cell twice, and culture medium is added in 37 DEG C of incubators In continue culture cell 72 hours.Cell conditioned medium is collected respectively, in the method detection Chang cell conditioned medium of quantitative fluorescent PCR The content of HBV virion, with the secretion situation of HBV e antigen in HBeAg ELISA detection kit detection cell conditioned medium, tool Steps are as follows for body:

HBV DNA, DNA in cell conditioned medium are extracted with viral DNA extracts kit (Omega Bio-tek, Inc.USA) Content fluorescence quantitative PCR detection, reaction system are as follows: 25 μ l FastStart Universal Probe Master (Roche, Mannheim, Germany), 0.5 μ l fluorescence probe, 0.5 μ l upstream primer, 0.5 μ l downstream primer, 18.5 μ l water mix well The HBV DNA of 5 μ l extraction is added afterwards.Cycling condition: 94 DEG C of initial denaturation 10min expand 40 according to 94 DEG C of 15s → 60 DEG C 60s Circulation.The hepatitis B that the content of HBV e antigen is produced with Shanghai Kehua Bio-engineering Co., Ltd in cell conditioned medium Malicious e diagnostic antigen kit (enzyme-linked immunization) is detected, and specific steps are referring to specification.

Wherein, fluorescence probe: 5'-FAM-CCTCTTCATCCTGCTGCTATGCCTCATC-TAMRA-3'；

Upstream primer: 5'-CCATGGGTCTAGTGCAGATGGTG-3'；

Downstream primer: 5'-GACAAACGGGCAACATACCTT-3'.

Experiment while the following control of setting: positive control is only to use HBV infection CCL 13；Negative control is with anti- The scFv (amino acid sequence is by sequence 14 in sequence table) of hIL-1 β replaces anti-preS1scFv.

The results are shown in Figure 10, it is seen that the content of HBV virion and containing for HBeAg in experimental group Chang cell conditioned medium Amount will be lower than control group, and there are significant difference, illustrates that anti-preS1scFv antibody can prevent HBV virus infection Family name liver cell.HBeAg is converted into inhibiting rate, formula are as follows: [(positive control OD₄₅₀Plus the OD of anti-preS1scFv₄₅₀) / Positive control OD₄₅₀]×100.From result (table 4) it can be seen that anti-preS1scFv antibody prevents HBV virus infection Zhang Shi liver Cell is at metering dependence.

The inhibiting rate of table 4anti-preS1scFv antibody prevention HBV virus infection CCL 13

Claims (10)

1. a kind of obtain the method for being specific to the encoding gene of target single-chain antibody of target antigen, include the following steps:

A) the gene code database being made of according to the method building included the following steps different single-chain antibody encoding genes to be detected:

(a1) according to known antibody framework region sequences, the degenerate primer pair for expanding antibody heavy chain variable region is designed and synthesized 1, and degenerate primer for expanding antibody's light chain variable region is to 2；

The known antibody framework region sequences are the antibody framework of the host from the microorganism for carrying the target antigen Region sequence；

(a2) using the degenerate primer 1 and the degenerate primer to 2 from initial sample respectively amplification obtain heavy chain of antibody can Become area's set and antibody's light chain variable region set；

Contain the antibody library being made of the antibody not of the same race for resisting the target antigen in the initial sample；

The antibody heavy chain variable region set is the set being made of different heavy chains variable region；The light chain variable region set is served as reasons The set of different light chain variable region compositions；

It (a3) will be in the different heavy chains variable region and the antibody's light chain variable region set in the antibody heavy chain variable region set Different light chain variable regions connected at random by heavy chain constant region CH1, obtain by different single-chain antibodies coding bases to be detected Because of the gene code database of composition；

The heavy chain constant region CH1 is the heavy chain constant region CH1's of the host from the microorganism for carrying the target antigen Preceding 15 amino acid；

B the gene volume for being specific to the target single-chain antibody of the target antigen) is obtained according to the method included the following steps Code sequence:

(b1) each single-chain antibody encoding gene to be detected in the gene code database is melted with target antigen-label protein respectively It closes gene and is implemented in same expression vector jointly, and the single-chain antibody encoding gene to be detected is made to be blended in the volume of signalase 11 The downstream of code gene, makes the target antigen-label protein fusion be blended in the downstream of the encoding gene of signal peptide 2, obtains Obtain recombinant expression carrier library；Containing the target antigen-label protein fusion on each carrier in the recombinant expression carrier library Gene and any single-chain antibody encoding gene to be detected；

The target antigen-label protein fusion is by the encoding gene of the target antigen and the volume of the label protein Fusion made of code Gene Fusion；

The signalase 11 is the signal peptide with following function: the destination protein merged with it is showed on the outside of bacterial inner membrane；

The signal peptide 2 is the signal peptide with following function: after the destination protein merged with it is transported to bacterium interstitial chamber Itself is degradable, and it is intracavitary that the destination protein is free on the bacterium interstitial；

The expression vector is pBGD carrier；The sequence of the pBGD carrier is as shown in sequence 1 in sequence table；

(b2) each recombinant expression carrier in the recombinant expression carrier library is transferred to host bacteria, obtains recombinant bacteria library；Institute It states and contains any recombinant expression carrier in recombinant bacteria library in each recombinant bacteria；

(b3) the recombinant bacteria library is cultivated, induces the recombinant expression carrier to be expressed, by the single-chain antibody to be detected Encoding gene encodes resulting single-chain antibody to be detected and is showed on the outside of the bacterial inner membrane, by the target antigen-label It is intracavitary that the resulting target antigen-tag fusion protein of protein fusion gene coding is free on the bacterium interstitial；

(b4) outer membrane for removing each recombinant bacteria in the recombinant bacteria library, obtains spheroplast library；In the spheroplast library Show there is any single-chain antibody to be detected on each spheroplast, the target being free on outside the spheroplast is anti- Original-tag fusion protein can be captured by the specific single-chain antibody in the single-chain antibody to be detected, form antigen-antibody Compound；

(b5) the spheroplast library and the antibody for resisting the label protein through fluorescent marker are incubated for jointly, only surface shape It can be labeled the upper fluorescence at the spheroplast of the antigen antibody complex, obtain table from the spheroplast library The labeled spheroplast for the fluorescence in face, is denoted as fluorescence-spheroplast；The surface display of the fluorescence-spheroplast The single-chain antibody to be detected be the target single-chain antibody；

(b6) plasmid is extracted from the fluorescence-spheroplast, is transferred to the host bacteria again, the expansion for carrying out the plasmid is numerous Culture, extracts the plasmid, conservation from the bacterium after culture；

To the gene coded sequence for obtaining the target single-chain antibody after the plasmid order-checking.

2. a kind of obtain the method for being specific to the target single-chain antibody of target antigen, it is characterised in that: the method includes rights It is required that the A in 1) step and the B) step, in the B) further include following steps C after step)

C) according to the gene coded sequence of step B) the target single-chain antibody obtained, protein expression is carried out, the mesh is obtained Mark single-chain antibody.

3. according to the method described in claim 1, it is characterized by: the signalase 11 is NlpA leader signal peptide.

4. according to the method described in claim 1, it is characterized by: the signal peptide 2 is pelB leader signal peptide.

5. the method according to claim 3 or 4, it is characterised in that: the host bacteria is Escherichia coli.

6. according to the method described in claim 5, it is characterized by: the Escherichia coli are bacillus coli DH 5 alpha.

7. according to the method described in claim 1, it is characterized by: the label protein is Flag albumen.

8. a kind of be specific to the target single-chain antibody of target antigen or the kit of its encoding gene for obtaining, including expression carries Body, host bacteria, anti-label protein through fluorescent marker antibody；

The expression vector contain claim 1-7 it is any described in signalase 11 encoding gene and the signal peptide 2 Encoding gene, for co-express claim 1-7 it is any described in single-chain antibody to be detected and any middle institute of claim 1-7 Target antigen-the tag fusion protein stated；

The host bacteria is the host bacteria described in claim 1-7 is any；

The antibody of the anti-label protein through fluorescent marker is the anti-mark through fluorescent marker described in claim 1-7 is any Sign the antibody of albumen.

9. kit according to claim 8, it is characterised in that: also contain in the kit and record claim 1- The readable carrier of any the method in 7.

10. target single-chain antibody or its encoding gene that kit described in claim 8 or 9 is specific to target antigen obtaining In application.