CN104761639A - ScFv antibody, encoding gene thereof and application of scFv antibody to preparation of preparation for treating or preventing hepatitis B - Google Patents

Abstract

The invention discloses an scFv antibody, an encoding gene thereof and application of the scFv antibody to preparation of a preparation for treating or preventing hepatitis B. The single-chain antibody is composed of a heavy-chain variable region, a light-chain variable region and a joining region between the heavy-chain variable region and the light-chain variable region, wherein the amino acid sequence of the heavy-chain variable region ranges from the first position to the 127th position counted from the N tail end of a sequence 1 in a sequence table; and the amino acid sequence of the light-chain variable region ranges from the 143rd position to the 255th position counted from the N tail end of a sequence 1 in the sequence table. Compared with a blood product, the single-chain antibody disclosed by the invention has the following advantages that no immune serum is needed, and the problem that the immune serum is limited because of few sources is solved; the risk that diseases are spread through blood because the blood product contains HBIG is avoided; the scFv antibody belongs to a human-derived protein so as not to generate immunological rejection reaction of an organism when being directly applied to a human body; and the scFv antibody is suitable for large-scale industrial production, the yield can be increased, and the cost can be reduced.

Description

ScFv antibody, its encoding gene and the application in preparation treatment or prevention hepatitis B preparation thereof

Technical field

The invention belongs to genetically engineered field, relate to a kind of scFv antibody, its encoding gene and the application in preparation treatment or prevention hepatitis B preparation thereof.

Background technology

Hepatitis B is the worldwide disease caused by hepatitis B virus (HBV), and the number of hepatitis B surface antigen (HbsAg) is carried more than 2.8 hundred million in the whole world according to statistics.China is hepatitis B height Prevalent district, has the crowd of 40-60% to be subject to HBV infection, about has 1.2 hundred million people's Hepatitis B carrier surface antigens.Virus can be passed to newborn infant by the pregnant and lying-in women of Hepatitis B carrier.And life more early infection hepatitis B virus more easily form persistent carriers, not only can cause chronic hepatopathy, wherein a part can also develop into liver cirrhosis and liver cancer.

Prevention hepatitis B has two kinds of biological products: one is Hepatitis B virus vaccine, can provide active immunity, for contacting the prevention of front and back.Another kind is Hepatitis B immunoglobulin (HBIG), provides temporary transient passive protection effect, for the prevention of crowd after some contact.The blocking-up efficiency of alone Hepatitis B virus vaccine to mother-to-baby transmission reaches 50-75%, and with HBIG and combined with hepatitis B vaccine immunity, Interruption of Vertical Transmission rate can be made to reach more than 97%.In addition, the prevention of hepatitis B and the urgent prevention of mishap after HBIG can also be used for transfusing blood, treat hepatitis B with HBIG clinically and also obtain good effect.In a word, HBIG is a kind of important goods preventing hepatitis B.Its effect in hepatitis b precaution and passive immunotherapy is affirmative.

The HBIG overwhelming majority used both at home and abroad for a long time comes from collection high price blood plasma or serum separation and Extraction immunoglobulin (Ig) after hepatitis b vaccine immune Healthy People and makes, and belongs to blood products.Constantly find because blood passes disease in recent years, big area uses HBIG to there is certain potentially dangerous.After ministry of Health of China door in 1996 prohibits the use the blood products of HBIG, at present effective preventive measures are lacked for the prevention of hepatitis B and the urgent prevention of mishap after blood transfusion.

Summary of the invention

An object of the present invention is to provide a kind of single-chain antibody.

Single-chain antibody provided by the present invention, it is the single-chain antibody being specific to hepatitis B surface antigen pre-s1 protein, called after anti-preS1scFv, is made up of variable region of heavy chain, variable region of light chain and the joining region for connecting described variable region of heavy chain and described variable region of light chain;

The aminoacid sequence of described variable region of heavy chain specifically can be following (a) or (b):

A in () sequence table, sequence 1 is from N-terminal 1-127 position;

(b) by (a) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative aminoacid sequence;

The aminoacid sequence of described variable region of light chain specifically can be following (c) or (d):

C in () sequence table, sequence 1 is from N-terminal 143-255 position;

(d) by (c) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative aminoacid sequence.

Described joining region is front 15 amino acid of the CH CH1 of human antibody; Concrete, front 15 amino acid whose sequences of the CH CH1 of described human antibody are following (e) or (f):

E in () sequence table, sequence 1 is from N-terminal 128-142 position;

(f) by (e) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative aminoacid sequence.

Further, described single-chain antibody specifically can be following (g) or (h):

G () is by the protein shown in sequence in sequence table 1;

(h) by (g) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein.

For the ease of the purifying of anti-preS1scFv antibody, the N-terminal of the protein that the amino acid residue sequence of sequence 1 forms or C-terminal label as shown in the table can be connected in by sequence table.

Table: the sequence of label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The nucleic acid molecule of described single-chain antibody of encoding also belongs to protection scope of the present invention.

Described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA, hnRNA or tRNA etc.

In one embodiment of the invention, described nucleic acid molecule is specially the gene of described single-chain antibody of encoding; In described gene, the DNA molecular of described variable region of heavy chain of encoding can be (1) or (2) or (3) as follows:

(1) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 1-381 position Nucleotide;

(2) to hybridize with the DNA sequence dna that (1) limits under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(3) DNA sequence dna limited with (1) or (2) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding;

In described gene, the DNA molecular of described variable region of light chain of encoding can be (4) or (5) or (6) as follows:

(4) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 427-768 position Nucleotide;

(5) to hybridize with the DNA sequence dna that (4) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(6) DNA sequence dna limited with (4) or (5) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.

In described gene, the DNA molecular of described joining region of encoding can be (7) or (8) or (9) as follows:

(7) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 382-426 position Nucleotide;

(8) to hybridize with the DNA sequence dna that (7) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(9) DNA sequence dna limited with (7) or (8) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.

Further, described gene is specially (10) or (11) or (12) as follows:

(10) DNA molecular shown in sequence 2 of sequence table;

(11) to hybridize with the DNA sequence dna that (10) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(12) DNA sequence dna limited with (10) or (11) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.

Above-mentioned stringent condition can be the solution with 6 × SSC, 0.5%SDS, and hybridize at 65 DEG C, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.

Wherein, sequence 2 is made up of 768 Nucleotide, the single-chain antibody shown in sequence 1 in polynucleotide.

Expression cassette containing described nucleic acid molecule, recombinant vectors, transgenic cell line or recombinant bacterium also belong to protection scope of the present invention.

Wherein, described recombinant vectors can be recombinant expression vector, also can be recombinant cloning vector.Described transgenic cell is do not have cellular omnipotency, can not be become the transgenic cell line of animal individual or plant individual by its Reproductive development.

Antibody based on other form of described single-chain antibody also belongs to protection scope of the present invention.

The antibody of other form described can be the antibody of Fab form, the antibody etc. of IgG form.

The present invention also protects the application of the antibody of described single-chain antibody or other form described in preparing product; The function of described product is following (I), (II) or (III) or (IV):

(I) hepatitis B virus is detected;

(II) assistant identification hepatitis B virus;

(III) hepatitis B is prevented and/or treated;

(IV) prevent and/or treat by the hepatitis b virus infected disease caused.

The product of the antibody containing described single-chain antibody or other form described also belongs to protection scope of the present invention; The function of described product is following (I), (II) or (III) or (IV):

(I) hepatitis B virus is detected;

(II) assistant identification hepatitis B virus;

(III) hepatitis B is prevented and/or treated;

(IV) prevent and/or treat by the hepatitis b virus infected disease caused.

The present invention utilizes prokaryotic system to produce anti-preS1scFv antibody, obtains the recombinant protein of purity more than 95%, and utilizes flow cytometry and ELISA to detect the neutralization of antibody.Result prove this antibody can effectively inhibition of hepatitis b virus to the infection of stem cell.Anti-preS1scFv antibody provided by the present invention is compared with blood products, and tool has the following advantages: do not need immune serum, solves the problem be restricted due to the shortage of immune serum source; Avoid the danger of blood products HBIG Emperical Bayesian method; Essence of the present invention belongs to people source protein matter, can directly apply to human body and not cause the immunological rejection of body; Be adapted to large-scale industrial production, can output be improved, reduce costs.

Accompanying drawing explanation

Fig. 1 behaves the PCR qualification result of heavy chain, light chain and VH-CH1-VL.

Fig. 2 is flow cytometry screening escherichia coli DH5 α (pBGD-Flag-preS1-scFv) display libraries result.

Fig. 3 is the expression of recombinant plasmid pET-27b-anti-preS1scFv in intestinal bacteria.M: protein standard marker 1: induction bacterium supernatant; 2: induction bacterium precipitation.

Fig. 4 is the SDS-PAGE electrophorogram of the anti-preS1scFv antibody protein after purifying.

Fig. 5 is that ELISA detects the specificity of anti-preS1scFv antibody to preS1 albumen and the result of avidity.* represents compared with control group, and in P<0.01 level, difference is extremely remarkable.

Fig. 6 is the combination blocking pre-S1-FITC albumen and CCL 13 or HepG2 cell with anti-preS1scFv.A is CCL 13 (Chang liver cell) correlated results.In A, negative control 1: undressed CCL 13 (Chang liver cell); Negative control 2: replace pre-S1-FITC with pre-S2-FITC 5 μ g/ml.B is HepG2 cell correlated results.In B, negative control 1: undressed HepG2 cell; Negative control 2:pre-S2-FITC 5 μ g/ml replaces pre-S1-FITC.

Fig. 7 is the inhibiting rate of anti-preS1scFv to preS1-FITC albumen.A is CCL 13 (Chang livercell); B is HepG2 cell.Negative control is negative control 2 in Fig. 6.

Fig. 8 blocks HBV infection CCL 13 with anti-preS1scFv.

Embodiment

The experimental technique used in following embodiment if no special instructions, is ordinary method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

The structure of the design of the gene related in following embodiment, synthesis and clone, expression vector, nucleic acid extraction, order-checking and qualification, and the operation steps such as the abstraction and purification of expression product, can carry out according to technology known in the art (see CURRENT PROTOCOLS IN MOLECULAR BIOLOGY).If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.

PET-27b carrier: purchased from Novagen company, Cat.No.69337-3.Intestinal bacteria Rosetta: purchased from Novagen company, Cat.No.71403-4.

HepG2 cell: can obtain from commercial channels, be recorded in document as " discussion of the .HepG2 cell culture processes such as Tang Mengxuan, Zhou Wanjun, Hu Yuanjia and condition. practical preventive medicine, the 12nd volume the 1st phase in 2005 " in.

Chang cell (CCL 13): can obtain from commercial channels, be recorded in document as " Tao Yang. CCL 13 Chang liver cell transplants and improves the prognosis .2013 of acute hepatic failure, the Central China University of Science and Technology, Master's thesis " in.

HepG2.2.15 cell: can obtain from commercial channels, be recorded in document as " Korea Spro builds; Wang Xiaojuan; the revaluation of the .HepG2.2.15 cell model functions such as Liu Peng: secretion HBVDNA, cccDNA and the Dynamic variation of serologic marker thing. Chinese Pathogen Biology magazine, 2013 years 05 phases " in.

The acquisition of embodiment 1, anti-preS1scFv single-chain antibody encoding gene

One, initial sample

Be initial sample with the peripheral blood leucocyte of the blood donor of surface antigen antibody high-titer, as the source of antibody library gene.This not only can increase the kurtosis of natural antibody, and therefrom can pick out the neutralizing antibody for epidemic isolates, reaches the effect of getting twice the result with half the effort.

Two, the extraction of RNA

Get fresh peripheral blood leukocytes 10 ⁶add the cold TRIzol of 1ml in Eppendorf (Ep) pipe of precooling, repeatedly blow and beat, mixing, places 10min on ice, 12000rpm, 4 DEG C of centrifugal 10min.Supernatant is transferred in new Ep pipe, adds the phenol chloroform (phenol: chloroform=1:5, volume ratio) of 200 μ l precoolings, thermal agitation mixing 30sec, 12000rpm, 4 DEG C of centrifugal 10min.Get supernatant, centrifugal after repeating to add 200 μ l phenol chloroform vibrations.Get supernatant, add equal-volume cold isopropanol, place 15min, 12000rpm, the centrifugal 10min of room temperature for-20 DEG C.Carefully suck supernatant liquor, centrifuge tube is inverted, liquid feed is drained off.With 1ml precooling 75 ﹪ ethanol, 12000rpm, 4 DEG C of centrifugal 5min wash RNA precipitation, abandon supernatant, repeat 3 times, drying at room temperature.With 30 μ l sterilizing DEPC water dissolution RNA ,-20 DEG C save backup.

Three, the synthesis of cDNA

With the total tissue RNA of step 2 extraction for template, Oligo (dT) ₁₈for primer, carry out the synthesis of cDNA Article 1 chain with reference to ThermoScript II (M-MLVRT) specification sheets.

Reaction system and reaction conditions as follows: Oligo (dT) ₁₈1.0 μ l; Total serum IgE template 5.0 μ l; DEPC-H ₂o5.0 μ l.5min in 70 DEG C of water-baths, places 5min on ice, adds successively: RNasin 1.0 μ l; 5 × M-MLVRT buffer5.0 μ l; DNTPs 5.0 μ l; DTT 5.0 μ l; M-MLVRT 1.0 μ l.42 DEG C of water-bath 2h, 70 DEG C of water-bath 15min, get 1 μ l product and observe clip size on 1% agarose gel electrophoresis.

Four, the design of scFv library primer is cloned

The Accuracy and high efficiency of primer is the key of clone's variable region gene, the present inventor is according to GenBank people's antibody framework region sequences, design pcr amplification primer is used for the amplification of light chain and variable region of heavy chain, and add HindI II, Nhe I's restriction enzyme site respectively in heavy chain variable region gene upstream and downstream, chain variable region gene upstream and downstream adds BamH I, Xho I restriction enzyme site respectively, and primer is synthesized by TaKaRa company.Primer sequence is specific as follows:

Light chain divides Kappa type and Lambda type

Kappa chain upstream: BamH I restriction enzyme site (underscore part)

KU1：

5'-CGC GGATCCGACATCCAGATGACCCAGT-3'；

5'-CGC GGATCCGACATCGTGATGACCCAGT-3'；

5'-CGC GGATCCGATATTGTGATGACTCAGTCTCCA-3'；

5'-CGC GGATCCGAAATTGTGTTGACGCAGT-3'；

5'-CGC GGATCCGATGTTGTGATGACTCAGTCTCCA-3'；

5'-CGC GGATCCGAAACGACACTCACGCAGTCTCCA-3'。

Kappa chain downstream: Xho I restriction enzyme site (underscore part)

KD1：

5'-CCG CTCGAGTTAACGTTTGATTTCCACCTTGGTCCC-3'；

5'-CCG CTCGAGTTAACGTTTGATCTCCACCTTGGTCCC-3'；

5'-CCG CTCGAGTTAACGTTTGATCTCCAGCTTGGTCCC-3'；

5'-CCG CTCGAGTTAACGTTTTATTTCCACCTTGGTCCC-3'；

5'-CCG CTCGAGTTAACGTTTGATATCCACTTTGGTCCC-3'；

5'-CCG CTCGAGTTAACGTTTAATCTCCAGTCGTGTCCC-3'。

Lambda upstream: BamH I restriction enzyme site (underscore part)

LU1：

5'-CGC GGATCCCAGTCTGCCCTGACTCAGCCTG-3'；

5'-CGC GGATCCCAGTCTGTGCTGACTCAGCCAC-3'；

5'-CGC GGATCCTCCTATGAGCTGACACAGCCAC-3'；

5'-CGC GGATCCTCCTATGAGCTGACTCAGCCAC-3'；

5'-CGC GGATCCTCCTATGAGCTGACTCAGGCAC-3'；

5'-CGC GGATCCAATTTTATGCTGACTCAGCCCC-3'；

5'-CGC GGATCCTCGTCTGAGCTGACTCAGGACC-3'；

5'-CGC GGATCCTCTGAGCTGACTCAGGACCCTG-3'。

Lambda downstream: Xho I restriction enzyme site (underscore part)

LD1：

5'-CCG CTCGAGTTACTAGGACGGTCAGCTTGGTCC-3；

5'-CCG CTCGAGTTAACCTAGGACGGTGACCTTGGTC-3'；

5'-CCG CTCGAGTTAACCTAGGACGGTCAGCTTGGTC-3'；

5'-CCG CTCGAGTTACTGTGACGGTCAGCTTGGTCCC-3'。

Heavy chain

Ig Gamma chain upstream: Hind III digestion site (underscore part)

IGU1：

5'-CCC AAGCTTGAGGTGCAGCTGCTCGAGTCT-3'；

5'-CCC AAGCTTGAGGTGCAGCTGTTGGAGTCT-3'；

5'-CCC AAGCTTGAGGTGCAGTTGTTGGAGTCT-3'；

5'-CCC AAGCTTGAGGTGCAGCTGGTGGAATCT-3'；

5'-CCC AAGCTTGAGGTGCAGTTGGTGGAGTCT-3'；

5'-CCC AAGCTTGAGGTGCAGCTGGTGGAGTCC-3'；

5'-CCC AAGCTTGAAGTGCAGCTGGTGGAGTCT-3'；

5'-CCC AAGCTTCAGGTGCAGATGGTGGAGTCT-3'；

5'-CCC AAGCTTCAGGTGCAGTTGGTGGAGTCT-3'；

5'-CCC AAGCTTCAGGTGCAACTGGTGGAGTCT-3'；

5'-CCC AAGCTTCAGGTGCAGCTGGTGGAATCT-3'；

5'-CCC AAGCTTCAGGTGCAGCTGGTGGAGTC-3'；

5'-CCC AAGCTTCAGGTGCAGTTGGAAGAATCT-3'；

5'-CCC AAGCTTCAGGTGCAGTTGGAGGAATCT-3'；

5'-CCC AAGCTTCAGGTGCAGCTGCAGGAGTCG-3'；

5'-CCC AAGCTTCAGCTGCAGCTGCAGGAGTCG-3'；

5'-CCC AAGCTTCAGGTGCAGCTGGTGGAGTCT-3'；

5'-CCC AAGCTTGAGGTGCAGCTGCTGGAGTCT-3'；

5'-CCC AAGCTTGAGGTTCAGCTGGTGGAGTCT-3'；

5'-CCC AAGCTTGAGGTGCAGCTGGTGCAGTCT-3'；

5'-CCC AAGCTTCAGGTCCAGCTGGTGCAG-3'；

5'-CCC AAGCTTCAGGTACAGCTGCAGCAGTCA-3'；

Ig Gamma chain downstream: Nhe I restriction enzyme site (underscore part)

IGD1：

5'-CG GCTAGCTGAAGAGACGGTGACCATTGTC-3'；

5'-CG GCTAGCTGAGGAGACGGTGACCATGGTC-3'；

5'-CG GCTAGCTGAGGAGACGGTGACCAGGGTT-3'；

5'-CGG CTAGCTGAAGAGACGGTGACCAGGGTT-3'；

5'-CGG CTAGCTGAGGAGACGGTGACCGTGGTCC-3'；

5'-CGG CTAGCTGAGGAGACGGTGACCAGGATT-3'。

Five, the pcr amplification of antibody variable region

With the cDNA synthesized in step 3 for template, carry out grads PCR amplification with VH upstream and downstream primer and VL upstream and downstream primer respectively, determine optimum annealing temperature.Wherein, separately be used alone for the primer of Kappa chain and Lambda chain in VL upstream and downstream primer, namely increase the VL of Kappa chain time, upstream primer be each bar primer in KU1 wait molar mixture, downstream primer be each bar primer in KD1 wait molar mixture; During the VL of amplification Lambda chain, upstream primer be each bar primer in LU1 wait molar mixture, downstream primer be each bar primer in LD1 wait molar mixture.When adopting VH upstream and downstream primer to carry out pcr amplification, upstream primer is the molar mixture such as grade of each bar primer in IGU1, and downstream primer is the molar mixture such as grade of each bar primer in IGD1.

PCR reaction (25 μ l system) is as follows: 10 × PCR buffer 2.5 μ l; DNTPs 2.0 μ l; Template 1.0 μ l (10ng); Upstream primer 1.0 μ l (after mixing, the concentration of primer is 10pmol/ μ l); Downstream primer 1.0 μ l (after mixing, the concentration of primer is 10pmol/ μ l); Taq enzyme 0.5 μ l; ddH ₂o 17 μ l.

Mix the amplification of laggard performing PCR.Loop parameter is: 95 DEG C of denaturation 5min, 95 DEG C of sex change 1min, Gradient annealing temperature is 48.5 DEG C ~ 61.5 DEG C (48.5 DEG C, 48.9 DEG C, 49.8 DEG C, 51.1 DEG C, 52.6 DEG C, 54.2 DEG C, 55.8 DEG C, 57.4 DEG C, 58.9 DEG C, 60.2 DEG C, 61.1 DEG C, 61.5 DEG C), annealing 1min, 72 DEG C extend 1min, after 30 circulations, 72 DEG C extend 10min.Separately establish negative control, wherein do not add template, all the other compositions are identical, with sterilizing deionized water polishing to same volume.

After amplification terminates, get 1 μ l product and observe clip size and brightness on 1% agarose gel electrophoresis, (the suitableeest annealing temperature of Kappa chain is: 57.4 DEG C to select the suitableeest annealing temperature, the suitableeest annealing temperature of Lambda chain is: 61.1 DEG C, and the suitableeest annealing temperature of VH chain is: 58.9 DEG C) carry out the amplification of antibody variable region.PCR reaction (250 μ l system) is as follows: 10 × PCR buffer 25 μ l; DNTPs 20 μ l; Template 10 μ l (10ng); Upstream primer 10 μ l (10pmol/ μ l); Downstream primer 10 μ l (10pmol/ μ l); Taq enzyme 5 μ l; ddH ₂o 170 μ l.

PCR primer utilizes plain agar sugar gel DNA recovery test kit to carry out purifying, and the amplified production mixing will reacted Kappa chain, Lambda chain PCR.Wherein, VH is about 385bp, and VL is about 345bp.

Six, the preparation of intestinal bacteria Electroporation-competent cells

The bacillus coli DH 5 alpha bacterium liquid that picking is frozen, in the line of LB solid plate media surface, 37 DEG C of overnight incubation.The single bacterium colony of picking median size next day, is inoculated in 10ml LB liquid nutrient medium, 37 DEG C, 120rpm shaking culture is about 10h.Pick in bacterium liquid access 10ml LB liquid nutrient medium with transfering loop, 37 DEG C, 120rpm shaking culture is about 10h.By the above-mentioned bacterial classification activated with in the ratio access 200ml LB liquid nutrient medium of 1/1000,37 DEG C, 120rpm shaking culture, work as OD ₆₀₀when reaching between 0.35 ~ 0.4, collect bacterium liquid in 50ml centrifuge tube, 4 DEG C, 3000rpm, centrifugal 10min.Abandon supernatant, add the resuspended thalline of 40 ~ 50ml precooling deionized water, 4 DEG C, 3000rpm, centrifugal 10min, repetitive operation once.Abandon supernatant, add the resuspended thalline of 40 ~ 50ml precooling 10% (volume fraction) glycerine, 4 DEG C, 3000rpm, centrifugal 10min, repetitive operation once.Exhaust supernatant, add a small amount of fresh precooling 10% (volume fraction) glycerine by resuspended for thalline rear packing, often pipe 100 μ l ,-80 DEG C frozen for subsequent use.The all triangular flasks used in this step all soaked with concentrated acid, ensured that absolute cleanliness is aseptic on the one hand, can remove again the ion of triangular flask inwall absorption.

Often pipe competent cell adds 5ng pUC19 standard plasmid, carries out electricity and turns, add 400 μ l LB substratum, 37 DEG C of shaking culture 1h, spread plate under 3kV, 25 μ F, 200 Ω conditions, cultivates 12 ~ 16h, observes electric conversion results next day and calculate transformation efficiency for 37 DEG C.Result shows: transformation efficiency is 1.1 × 10 ⁹.

Seven, the structure in pTch1-2-scFv library

PTch1-2 carrier is the carrier (sequence 3) of the present inventor's autonomous design, front 15 amino acid of the CH1 that its linker sequence is behaved, for being connected to VH and VL, there are Hind III, Nhe I restriction enzyme site in CH1 front end, there are Xho I, BamH I restriction enzyme site in rear end, is convenient to VH fragment and the insertion of VL fragment.

Front 15 amino acid whose encoding sequences of the CH CH1 of people:

5 '-GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCT-3 ' (the 382-426 position of sequence 2)

Front 15 amino acid whose sequences of the CH CH1 of people are the 128-142 position of sequence 1 in sequence table.

VH glue recovery product and the pTch1-2 carrier of getting step 5 acquisition carry out Hind III, Nhe I double digestion, 37 DEG C of water-bath 3h, 1% agarose gel electrophoresis observations.Above-mentioned digestion products is carried out glue recovery.T4Ligase is utilized to connect VH and pTch1-2 endonuclease bamhi.The above-mentioned connection product of 2 μ l is joined in bacillus coli DH 5 alpha competent cell prepared by step 6, carry out electricity and transform and build VH antibody library.

Next day, collect all bacterium colonies and extract plasmid, carrying out Xho I, BamH I double digestion, with XhoI, BamHI, product being reclaimed to the VL that step 5 obtains simultaneously and carry out two enzyme.Enzyme carries out glue recovery after cutting, and connects and the bacillus coli DH 5 alpha competent cell of step of converting six acquisition, spread plate, 37 DEG C of incubated overnight.Collect bacterium colony and extract plasmid, being pTch1-2-scFv library.

The pTch1-2-scFv library of getting structure is carried out enzyme and is cut qualification and PCR identifies.With Hind III, Nhe I and XhoI, BamH I, double digestion is carried out to pTch1-2-scFv library.Getting pTch1-2-scFv Library plasmid is template, uses VH upstream primer and VL downstream primer to carry out PCR qualification to it respectively.

Result display (Fig. 1): VH and VL connects together, and size is about 770bp.

Eight, antigen is connected into pBGD plasmid pelB leader downstream

The PCR primer of design pre-S 1 antigens of hepatitis B viruses, upstream primer adds Nhe I restriction enzyme site, and downstream primer adds Flag sequence and BamHI restriction enzyme site.

Pre-S 1 antigens of hepatitis B viruses: aminoacid sequence is for shown in sequence in sequence table 4, and its encoding gene is as shown in sequence in sequence table 5.

PreS1-F: gCTAGCaTGGGAGGTTG (underscore part is the recognition sequence of Nhe I, and sequence is thereafter the 1-11 position of sequence 5 in sequence table)

PreS1-R: gGATCC(underscore part is the recognition sequence of BamHI to TTACTTATCGTCGTCATCCTTGTAATCGGCCTGAGGATG, italicized item is the coding gene sequence of Flag label, and sequence is thereafter the reverse complementary sequence of the 346-357 position of sequence 5 in sequence table).

With the HBV gene group sequence in the gene pool of synthetic shown in GenBank Accession No.AB205124 for template, primer preS1-F and preS1-R is adopted to carry out pcr amplification.

PCR reaction (25 μ l system) is as follows: 10 × PCR buffer 2.5 μ l; DNTPs 2.0 μ l; Template 1.0 μ l (10ng); Upstream primer 1.0 μ l (10pmol/ μ l); Downstream primer 1.0 μ l (10pmol/ μ l); Taq enzyme 0.5 μ l; ddH ₂o 17 μ l.

Mix the amplification of laggard performing PCR.Loop parameter is: 95 DEG C of denaturation 5min, 95 DEG C of sex change 1min, and Gradient annealing temperature is 40 DEG C ~ 65 DEG C, annealing 1min, and 72 DEG C extend 1min, and after 30 circulations, 72 DEG C extend 10min.Separately establish negative control, wherein do not add template, all the other compositions are identical, with sterilizing deionized water polishing to same volume.

After amplification terminates, get 1 μ l product and observe clip size and brightness on 1% agarose gel electrophoresis, select the suitableeest annealing temperature (48.9 DEG C) to carry out the amplification of antibody variable region, PCR primer utilizes plain agar sugar gel DNA recovery test kit to carry out purifying.

2, the structure of pBGD-Flag-preS1 recombinant vectors

PBGD carrier is the present inventor's autonomous design carrier (sequence 6), on this carrier, there is NheI, BamH I restriction enzyme site in pelB leader signal peptide encoding gene (the 167-232 position of sequence 6) downstream, is convenient to antigen fragment and inserts.

Front S1 glue recovery product and the pBGD carrier of getting step 1 acquisition carry out Nhe I, BamH I double digestion, 37 DEG C of water-bath 3h, 1% agarose gel electrophoresis observations.Above-mentioned digestion products is carried out glue recovery.T4Ligase is utilized to connect the preS1 antigen after recovery and pBGD carrier endonuclease bamhi.Joined by the above-mentioned connection product of 2 μ l in bacillus coli DH 5 alpha competent cell prepared by step 6, transform, next day, picking mono-clonal extracts plasmid, carries out Nhe I, the qualification of BamH I double digestion.

Result shows: cut the preS1-Flag fusion gene fragment that size is about 381bp.

Plasmid sample presentation correct for preliminary evaluation is checked order.The recombinant plasmid called after pBGD-preS1-Flag inserting DNA fragmentation (i.e. the sequence of preS1-Flag fusion gene) shown in " sequence 5+GATTACAAGGATGACGA CGATAAG " between the restriction enzyme site Nhe I and BamH I of pBGD carrier is shown by through order-checking.

Nine, the structure in antigen-antibody coexpression library

On pBGD carrier, there is SfiI restriction enzyme site in NlpA leader signal peptide encoding gene (the 5258-5344 position of sequence 6) downstream, scFv fragment can be scaled off the NlpA leader signal peptide encoding gene downstream being connected to the pBGD-Flag-preS1 carrier that step 8 builds from the pTch1-2-scFv library that step 7 builds, be built into antigen-antibody coexpression bacterial display library.

The pBGD-Flag-preS1 carrier in the pTch1-2-scFv library and step 8 structure of getting step 7 structure carries out SfiI enzyme and cuts, 37 DEG C of water-bath 3h, 1% agarose gel electrophoresis observations.Above-mentioned digestion products is carried out glue recovery.T4Ligase is utilized to connect the scFv fragment of recovery and pBGD-Flag-preS1 carrier endonuclease bamhi.The above-mentioned connection product of 2 μ l is joined in bacillus coli DH 5 alpha competent cell prepared by step 6, carry out electricity and transform the library being built into antigen-antibody coexpression.After transforming, picking mono-clonal extraction next day plasmid, carries out Sfi I enzyme and cuts qualification.

Result shows: cut the scFv library fragments that size is about 760bp.The correct recombinant vectors storehouse called after pBGD-Flag-preS1-scFv of qualification will be cut through enzyme.

The recognition sequence of the restriction restriction endonuclease (SfiI) used in this step is rare in antibody sequence, restriction restriction endonuclease can be avoided to be shredded by some antibody fragments, and just limit restriction endonuclease with SfiI mono-kind, can avoid causing digesting efficiency to reduce due to the inconsistent of reaction conditions in double digestion process, cause enzyme to be cut not exclusively, so that the storage capacity of antibody library reduce.

Ten, the induction of bacillus coli DH 5 alpha and spheroplast preparation

The library all bacterium colony LB liquid nutrient medium collecting step 9 structure is diluted to OD ₆₀₀≈ 0.2,37 DEG C cultivates 2h, makes it OD ₆₀₀≈ 0.4, adding IPTG to final concentration is 0.25mmol/L, 37 DEG C of induction 4h.

Collect 2mL culture, the centrifugal 1min of 12000rpm, abandons supernatant.Bacterial sediment 350 μ l Sucrose (0.75mmol/L)/Tris (0.1mol/L) solution is resuspended; Adding 35 μ l concentration is the freshly prepared N,O-Diacetylmuramidase mother liquor of 10mg/ml (solvent is 350 μ l Sucrose (0.75mmol/L)/Tris (0.1mol/L) solution, and the enzyme of N,O-Diacetylmuramidase is lived as 20U/g); Dropwise add 700 μ l 1mmol/L EDTA solution (solvent is water), vortex mixing simultaneously; Hatch 15min on ice; Add 50 μ l 0.5mol/L MgCl ₂solution, and hatch 10min on ice; 4 DEG C, the centrifugal 10min of 10000rpm; The resuspended washing of spheroplast precipitation 1ml PBS solution, the centrifugal 3min of 6000rpm, removes supernatant; Spheroplast precipitation is resuspended with 100 μ l PBS.

11, flow cytometry screening escherichia coli DH5 α display libraries

Bacteria cell wall forms spheroplast after being punched by N,O-Diacetylmuramidase, and now the material such as antigen, antibody all can pass through cell walls and contacts with cytolemma and react.With Flag antibody (the Sigma Products of FITC mark, its catalog number is F4049) Flag-preS1 antigen fragment that incubated cell film is combined with the scFv of grappling, if express successfully or expressed scFv be positive colony; could fluorescence be detected, otherwise then can not.Concrete grammar is as follows:

In the bacterium liquid (IPTG induction) that 100 μ l PBS are resuspended, add the Flag antibody of 10 μ l 1% (1g/100ml) BSA stock solutions, 5 μ g FITC marks, lucifuge hatches 1h on ice; 8000rpm, the resuspended washing of centrifugal 3min, 1mlPBS once, precipitates resuspended with 100 μ l PBS.Negative control is set, the Flag antibody incubation marked with FITC after the bacterium liquid (without IPTG induction) containing recombinant plasmid in the pBGD-Flag-preS1-scFv of recombinant vectors storehouse is treated as spheroplast.Under 488nm wavelength laser, detect the fluorescence intensity of sample and negative control with flow cytometer, in collection sample, fluorescence intensity is higher than the part of negative control.

Sorting gained bacterium is carried out plasmid, electroporated to new bacillus coli DH 5 alpha, build secondary screens storehouse, undertaken second by above-mentioned method and take turns screening (the Flag antibody consumption of FITC mark is reduced to 3 μ g), by the cell sorting in each peak ranges out, prepare transformation of E. coli DH5 α after plasmid, build secondary screens storehouse, after carrying out third round screening (the Flag antibody consumption of FITC mark is reduced to 1.5 μ g) by above-mentioned method, picking list bacterium colony 20, detect with flow cytometer one by one after spreading cultivation, select the clone that fluorescent signal is stronger than negative control, carry out checking order and analyzing.Reduce the Flag antibody of FITC mark later in a few step screening gradually, be conducive to screening the stronger antibody of avidity.

The present invention saves positive antibody gene by the mode extracting plasmid from the bacterium sorted out, electricity transforms new bacillus coli DH 5 alpha, simplify testing sequence, it also avoid the generation that normal PCR saves sudden change and the strand displacement that may cause, add feasibility and the practicality of the method.And add when extracting plasmid not containing the competence bacterium of any plasmid, can reduce like this when extracting plasmid and inevitably lose (adhesion loss), the last total amount extracting plasmid can be increased.

Fluidic cell the selection result as shown in Figure 2.Through three-wheel screening, obtain one and there is the monoclonal antibody of binding ability, by its called after anti-preS1scFv antibody with preS1 antigen.

The encoding gene of anti-preS1scFv antibody (for single-chain antibody) for shown in sequence in sequence table 2, the anti-preS1scFv antibody in polynucleotide shown in sequence 1.

The preparation of embodiment 2, anti-preS1scFv single-chain antibody

One, the structure of single-chain antibody expression vector (pET-27b-anti-preS1scFv)

Primer-design software Primer Premier 5.0 is utilized to design the clone of PCR primer for single-chain antibody gene.Add Nco I restriction enzyme site during design upstream primer, downstream adds XhoI restriction enzyme site, is synthesized by Invitrogen company.Concrete primer sequence is as follows:

Anti-preS1scFv-F: cCATGGgT-TCGGTGCAGTTGGTG (underscore part is the recognition sequence of Nco I ,-after sequence be the 1-15 position of sequence 2);

Anti-preS1scFv-R: cTCGAGtTAACGTTTGATATCC (underscore part is the recognition sequence of XhoI ,-after sequence be the reverse complementary sequence of the 753-768 position of sequence 2).

Primer is used to be template PCR amplifications gene fragment to screen the recombinant plasmid (carrying DNA fragmentation shown in sequence 2 in sequence table, anti-preS1scFv antibody shown in expressible nucleotide sequence 1) obtained through embodiment 1 fluidic cell (FACS).Loop parameter is: 95 DEG C of denaturation 5min, 95 DEG C of sex change 1min, 55 DEG C of annealing 1min, and 72 DEG C extend 1min, and after 20 circulations, 72 DEG C extend 10min.After amplification terminates, get 1 μ l product and observe clip size on 1% agarose gel electrophoresis.Result shows, and PCR primer size is about 768bp.PCR primer utilizes plain agar sugar gel DNA recovery test kit to carry out purifying.Carry out with pMD18-T carrier after purifying being connected, transform, picking mono-clonal, upgrading grain send order-checking.To show to be connected on pMD18-T carrier through order-checking " cCATGGgT-sequence 2- cTCGAG" shown in recombinant plasmid called after pMD18-T-anti-preS1scFv after DNA fragmentation.

PMD18-T-anti-preS1scFv plasmid is cut with restriction enzyme Nco I and XhoI enzyme, reclaim the object fragment that size is about 768bp, be connected with pET-27b carrier (purchased from Novagen company, Cat.No.69337-3) the skeleton large fragment through same double digestion.First transformed with bacillus coli DH 5 alpha competent cell by the above-mentioned connection product of 10 μ l, picking mono-clonal, after extracting plasmid, Nco I and XhoI enzyme cut qualification.Enzyme is cut the recombinant plasmid order-checking of preliminary evaluation correct (obtaining two bands that size is about 5414bp and 768bp).The recombinant plasmid called after pET-27b-anti-preS1scFv inserting DNA fragmentation shown in " GT-sequence 2 " between restriction enzyme site Nco I and XhoI of pET-27b carrier is shown by through order-checking.

Two, the expression and purification of recombinant plasmid pET-27b-anti-preS1scFv in intestinal bacteria

Get positive recombinant plasmid pET-27b-anti-preS1 scFv conversion Rosetta (DE3) competence bacteria that 10ng step one obtains, coat on the LB solid medium flat board containing 50 μ g/ml Kan, cultivate 12 ~ 16h for 37 DEG C.

The several transformed bacteria of picking is inoculated in the LB liquid nutrient medium containing concentration 50 μ g/ml Kan respectively, and 37 DEG C of shaking culture are spent the night, and collects thalline and carries out PCR qualification.

Picking identifies that correct pET-scFv transforms Rosetta (DE3) single bacterium colony, is inoculated in the LB liquid nutrient medium containing 50 μ g/ml Kan.Getting above-mentioned culture next day is inoculated in the substratum containing 100 μ g/mlKan according to the ratio of 1% (volume ratio), cultivates 2h, works as OD for 37 DEG C ₆₀₀value to about 0.4 time, add IPTG (be 0.25mmol/L to final concentration), 37 DEG C of cultivation, induce 4h.Separately establish the control group not adding IPTG induction, all the other conditions are identical.

Induction terminates to get induction group respectively and control group culture 1ml adds in 1.5ml Ep pipe afterwards, and the centrifugal 1min of room temperature 12000r/m collects thalline.Abandon supernatant, wash bacterial sediment with the precooling PBS (pH7.4) of 100 μ l, after the centrifugal 1min of room temperature 12000r/m, abandon supernatant.Ultrasonication after the precooling PBS (pH7.4) adding 100 μ l in induction group thalline suspends, the centrifugal 10min of 12000r/m, draws supernatant in another Ep pipe, adds 100 μ l precoolings PBS (pH7.4) resuspended in precipitation.Control group is resuspended with 100 μ l precoolings PBS (pH7.4) simultaneously.

In induction group supernatant, induction group precipitation and control group thallus suspension liquid, add 1/3 volume 4 × SDS sample buffer (containing DTT), 100 DEG C are boiled 5min.Get 20 μ l samples and carry out 15%SDS-PAGE.After electrophoresis, through coomassie brilliant blue R_250 dyeing, methyl alcohol-glacial acetic acid destainer decolouring observations is to determine the expression of target protein.

Result display (Fig. 3): anti-preS1scFv antibody is mainly expressed in intestinal bacteria with the form of inclusion body.

After induction group being induced, thalline is centrifugal abandons supernatant, resuspended and to add N,O-Diacetylmuramidase to final concentration be 1mg/mL with appropriate PBS, place 60min on ice, ultrasonication, 4 DEG C, the centrifugal 30min of 10000g, collects inclusion body, fully dissolve with dissolving damping fluid (8mol/L urea soln, pH8.0) after washing.Damping fluid (8mol/L aqueous solution of urea is dissolved with 100 milliliters, pH8.0) fully dissolve, then HiLoad 16/60Superdex75pg pillar (purchased from GE company) is splined on, then 500 milliliters of renaturation buffer (2mol/L aqueous solution of urea are used, pH8.0) wash-out elutriant after collecting post, then dialysed overnight in PBS damping fluid, obtains solution and is anti-preS1scFv antibody-solutions.Institute is in steps all under 4 DEG C of environment.Albumen after purifying carries out SDS-PAGE electrophoretic analysis, utilizes high performance liquid chromatograph (purchased from Waters company) to analyze its purity.And detect its concentration with ultraviolet spectrophotometer (ND-1000 type Spectrophotometer).Result shows: the albumen after purifying can obtain through SDS-PAGE electrophoresis the protein band (protein band size is consistent with expected results) (Fig. 4) that size is about 27.1KD, reclaim protein band and check order, N holds front 15 amino-acid residues as shown in the 1-15 amino acids residue of sequence in sequence table 10, i.e. SVQLVESGGGLVQPG.In addition, purity of protein reaches 78%, and concentration reaches 1.7mg/ml.

Embodiment 3, anti-preS1scFv single-chain antibody Performance Detection

One, ELISA detects the avidity power of anti-preS1 scFv antibody

Anti-preS1 scFv antibody embodiment 2 prepared is coated in elisa plate 4 DEG C and spends the night, bag is 100 μ g/mL, 50 μ g/mL, 10 μ g/mL, 5 μ g/mL by concentration gradient, for detecting the specificity of anti-preS1scFv to preS1 albumen, negative control group is set simultaneously.3 times are washed with PBST after bag is spent the night, each 2min, with 5% (5g/100ml) skim-milk, 37 DEG C of closed 2h, after washing, add the preS1 albumen (aminoacid sequence is sequence 4 in sequence table) of 10 μ g/mL, hatch 1h for 37 DEG C, washing is the same, adds primary antibodie (preS1 monoclonal antibody, Fitzgerald (Massachusetts, America) Products, its catalog number is Cat.No.10-H07A; Dilute 2000 times), hatch washing the same.Adding two again, anti-(its catalog number is Cat.No.11-7018 for HRP-goat anti-mouse antibody, eBioscienc (SanDiego, America) Products; Dilute 7500 times), hatch 1h for 37 DEG C, after washing, add tmb substrate liquid, in 37 DEG C of lucifuge colour developing 5min, every hole adds the 50 μ L stop buffer (H of 2mol/L ₂sO ₄), under wavelength 450nm, detect its OD value by microplate reader.

The PBS group replacing anti-preS1 scFv antibody-solutions, preS1 albumen and antibody with isopyknic PBS damping fluid is set.The control group 1 not adding preS1 albumen is set, do not add the control group 2 of antibody, do not add preS1 albumen and do not add the control group 3 of antibody, waiting the scFv (aminoacid sequence is sequence 7 in sequence table) of the anti-hIL-1 β of protein concentration to replace the control group 4 of anti-preS1 scFv with equal-volume.Each process arranges 3 multiple holes.

The results are shown in Figure 5.ELISA result shows, anti-preS1 scFv antibody can be combined with preS1 protein-specific.

Two, the Neutralization effect qualification of anti-preS1scFv antibody

Anti-preS1scFv antibody prepared by embodiment 2, with the preS1-FITC of concentration gradient 5 μ g/mL, 25 μ g/mL, 50 μ g/mL each 200 μ l and 5 μ g/mL (FITC mark preS1 albumen) after 4 DEG C of pre-reaction 1h, by reaction solution and HepG2 cell or Chang cell (also claiming CCL 13 or Chang liver cell) (10 ⁵individual cell) hatch 1h at 4 DEG C after, PBS washed cell twice, detects with flow cytometer.Be provided with the blank group not adding reaction solution, only add the positive controls of 5 μ g/mL preS1-FITC and replace the negative control group of 5 μ g/mLpreS1-FITC with 5 μ g/mL preS2-FITC (the preS2 albumen of FITC mark, the aminoacid sequence of preS2 albumen is sequence 8 in sequence table).

Result as shown in Figure 6, visible preS1-FITC can with HepG2 cell or CCL 13 generation specific binding, anti-preS1 scFv antibody can combine with the functional epitope of preS1 albumen, stops the combination that preS1-FITC and HepG2 cell or CCL 13 occur.Fig. 7 is the inhibiting rate of anti-preS1scFv antibody to preS1-FITC albumen, with the inhibiting rate that the result conversion of Fig. 5 comes, formula is: [(average fluorescent strength-anti-preS1scFv of preS1-FITC group and the average fluorescent strength of preS1-FITC group)/(average fluorescent strength of the average fluorescent strength-negative control 1 group of preS1-FITC group)] × 100.Can find out that anti-preS1 scFv antibody is suppressed to metering dependency to preS1-FITC albumen.

10 are collected from HepG2.2.15 cells and supernatant ⁴the HBV virion of copy, and concentration be 50 μ g/ml, 100 μ g/ml the mixing of anti-preS1scFv antibody fully, at room temperature (25 DEG C) reaction 1h.By mixture and Chang cell (10 ⁵individual cell) hatch 1h at 37 DEG C after, discard Incubating Solution PBS washed cell twice, add substratum and in 37 DEG C of incubators, continue culturing cell 72 hours.Collecting cell supernatant respectively, detect the content of HBV virion in Chang cell conditioned medium by the method for quantitative fluorescent PCR, detect the secretion situation of HBV e antigen in cell conditioned medium by HBeAg ELISA detection kit, concrete steps are as follows:

Test kit (Omega Bio-tek is extracted with viral DNA, Inc.USA) HBV DNA in cell conditioned medium is extracted, its DNA content fluorescence quantitative PCR detection, reaction system is: 25 μ l FastStart Universal Probe Master (Roche, Mannheim, Germany), 0.5 μ l fluorescent probe, 0.5 μ l upstream primer, 0.5 μ l downstream primer, 18.5 μ l water add after fully mixing 5 μ l extract HBV DNA.Cycling condition: 94 DEG C of denaturation 10min, increases 40 according to 94 DEG C of 15s → 60 DEG C 60s and circulates.The hepatitis B virus e antigen diagnostic kit (euzymelinked immunosorbent assay (ELISA)) that in cell conditioned medium, the content Shanghai Ke Hua biotechnology limited-liability company of HBV e antigen produces detects, and concrete steps are see specification sheets.

Wherein, fluorescent probe: 5'-FAM-CCTCTTCATCCTGCTGCTATGCCTCATC-TAMRA-3';

Upstream primer: 5'-CCATGGGTCTAGTGCAGATGGTG-3';

Downstream primer: 5'-GACAAACGGGCAACATACCTT-3'.

Result as shown in Figure 8, in visible experimental group Chang cell conditioned medium the content of HBV virion and the content of HBeAg all low than control group, and there is significant difference, illustrate that anti-preS1scFv antibody can stop HBV virus infection CCL 13.Positive control is only use HBV infection CCL 13, and negative control is replace scFv-9 that HBeAg is converted into inhibiting rate with the scFv of anti-hIL-1 β, and formula is: [(positive control OD ₄₅₀the OD of-Jia anti-preS1scFv ₄₅₀)/positive control OD ₄₅₀] × 100.Can find out that anti-preS1scFv antibody stops HBV virus infection CCL 13 to become metering dependency from result (table 1).

Table 1anti-preS1scFv antibody stops the inhibiting rate of HBV virus infection CCL 13

Claims (10)

1. a single-chain antibody, is made up of variable region of heavy chain, variable region of light chain and the joining region for connecting described variable region of heavy chain and described variable region of light chain;

The aminoacid sequence of described variable region of heavy chain is following (a) or (b):

A in () sequence table, sequence 1 is from N-terminal 1-127 position;

(b) by (a) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative aminoacid sequence;

The aminoacid sequence of described variable region of light chain is following (c) or (d):

C in () sequence table, sequence 1 is from N-terminal 143-255 position;

(d) by (c) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative aminoacid sequence.

2. single-chain antibody according to claim 1, is characterized in that: described joining region is front 15 amino acid of the CH CH1 of human antibody;

Concrete, front 15 amino acid whose sequences of the CH CH1 of described human antibody are following (e) or (f):

E in () sequence table, sequence 1 is from N-terminal 128-142 position;

(f) by (e) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative aminoacid sequence.

3. single-chain antibody according to claim 1 and 2, is characterized in that: described single-chain antibody is following (g) or (h):

G () is by the protein shown in sequence in sequence table 1;

(h) by (g) through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have identical activity by its derivative protein.

4. to encode the nucleic acid molecule of arbitrary described single-chain antibody in claim 1-3.

5. nucleic acid molecule according to claim 4, is characterized in that: described nucleic acid molecule is the gene of single-chain antibody described in coding claim 1 or 2; In described gene, the DNA molecular of described variable region of heavy chain of encoding is following (1) or (2) or (3):

(1) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 1-381 position Nucleotide;

(2) to hybridize with the DNA sequence dna that (1) limits under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(3) DNA sequence dna limited with (1) or (2) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding;

In described gene, the DNA molecular of described variable region of light chain of encoding is following (4) or (5) or (6):

(4) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 427-768 position Nucleotide;

(5) to hybridize with the DNA sequence dna that (4) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(6) DNA sequence dna limited with (4) or (5) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.

6. the nucleic acid molecule according to claim 4 or 5, is characterized in that: in described gene, and the DNA molecular of described link zone of encoding is following (7) or (8) or (9):

(7) sequence 2 of sequence table is from the DNA molecular shown in 5 ' end 382-426 position Nucleotide;

(8) to hybridize with the DNA sequence dna that (7) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(9) DNA sequence dna limited with (7) or (8) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.

7. according to described nucleic acid molecule arbitrary in claim 4-6, it is characterized in that: described gene is following (10) or (11) or (12):

(10) DNA molecular shown in sequence 2 of sequence table;

(11) to hybridize with the DNA sequence dna that (10) limit under strict conditions and the DNA molecular of the albumen with identical activity of encoding;

(12) DNA sequence dna limited with (10) or (11) at least has more than 90% homology and the DNA molecular of the albumen with identical activity of encoding.

8. the expression cassette containing arbitrary described nucleic acid molecule in claim 4-7, recombinant vectors, transgenic cell line or recombinant bacterium.

9. based on the antibody of other form of described single-chain antibody arbitrary in claim 1-3.

10. the application of antibody in preparing product of arbitrary described single-chain antibody or other form according to claim 9 in claim 1-3;

The function of described product is following (I), (II) or (III) or (IV):

(I) hepatitis B virus is detected;

(II) assistant identification hepatitis B virus;

(III) hepatitis B is prevented and/or treated;

(IV) prevent and/or treat by the hepatitis b virus infected disease caused; Or

Product containing the antibody of arbitrary described single-chain antibody or other form according to claim 9 in claim 1-3;

The function of described product is following (I), (II) or (III) or (IV):

(I) hepatitis B virus is detected;

(II) assistant identification hepatitis B virus;

(III) hepatitis B is prevented and/or treated;

(IV) prevent and/or treat by the hepatitis b virus infected disease caused.