CN110512008A - Detect multiple PCR reagent kit and its application of a kind of common ten food-borne pathogens - Google Patents
Detect multiple PCR reagent kit and its application of a kind of common ten food-borne pathogens Download PDFInfo
- Publication number
- CN110512008A CN110512008A CN201910539501.XA CN201910539501A CN110512008A CN 110512008 A CN110512008 A CN 110512008A CN 201910539501 A CN201910539501 A CN 201910539501A CN 110512008 A CN110512008 A CN 110512008A
- Authority
- CN
- China
- Prior art keywords
- food
- pcr
- borne pathogens
- detection
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of ten PCR kits and its application that food-borne pathogens detection consensus primer mediates；The multiple PCR technique mediated using consensus primer, it is marked using the specific gene of 11 kinds of common food-borne pathogens (salmonella, listeria monocytogenes, Shigella flexneri, enterohemorrhagic escherichia coli O157, vibrio parahemolyticus, staphylococcus aureus, comma bacillus, A type clostridium botulinum, Bacillus cereus, C.perfringens, yersinia enterocolitica) as detection, a kind of efficient, high specific, high throughput multiplex PCR detection architecture is established, research and development are suitable for the kit for detecting nucleic acid of common food-borne pathogens detection.Consensus primer sensibility reaches 103Copies/ μ L detects the UP-M-PCR system of 11 kinds of food-borne pathogens while building, has good specificity, bacterial genomes DNA detection architecture sensibility up to 0.01ng/ μ L by single mode plate and two template experimental verification UP-M-PCR systems.
Description
Technical field
The invention belongs to bacterial strain detection technique fields, and in particular to the detection technique of food-borne pathogens, more specifically ten
A kind of PCR kit and its application that food-borne pathogens detection consensus primer mediates.
Background technique
Food origin disease, which refers to, to be caused and ingesting into poisonous and harmful substance (including biological pathogen) of human body etc.
Disease caused by cause of disease.It is closed with the development of the social economy, food origin disease has increasingly becomed global public health
Focus on point, can all lead to sizable morbidity and mortality every year, cause huge financial burden.2010 according to world health
Tissue estimation about 2,000,000,000 food origin disease case loads, even also there are about 30% people with food every year for industrialized country
Source property disease.In England and Wales, there are about 236.6 ten thousand people to suffer from food origin disease every year, and 30% epidemic situation is passed by food
It broadcasts, there are 76,000,000 food origin diseases in the U.S. every year, and Australia has 2,000,000 food poisonings to cause every year
4.9 hundred million to 1,900,000,000 Australian Dollars are lost (referring to Hedberg C. Food-related illness and death in the
United States: Emerg Infect Dis. 1999 Nov-Dec;5(6):840-2. doi: 10.3201/
eid0506.990624；Group OFW. Reported foodborne illness and gastroenteritis in
Australia: annual report of the OzfoodNet network, 2004. Commun Dis Intell Q
Rep 2005;29 (2): 165-92).And in China, there are about 200,000,000 food origin disease cases every year, according to China's food origin disease
5021 food origin diseases occur altogether between monitoring net statistics 2001 to 2010, there are about 140,000 human hairs diseases, but due to food-borne disease
Sick Clinical symptoms has slight self-healing, and most of food origin disease case loads is caused to be difficult to report, therefore has report to claim China's food
Source property morbidity statistics number is less than the 10%(actually occurred referring to the epidemiological features and influence factor point of Hu Yunqing food origin disease
Analyse China community doctor (medical speciality) 2010;12 (31): 226).According to the annual food origin disease rate of failing to report in the WHO estimation whole world
Up to 90%, the above statistical data is only the tip of the iceberg of real data.The main reason for causing food origin disease include
This four major class of bacillary, fungoid, of animal or plant nature and chemical food poisoming, in China's food origin disease outburst case,
Major virulent factor is pathogenic bacteria.2023 food poisonings have been broken out in China between -2010 years 2006, are caused by microorganism
Event account for 40.09%, it has also been found that in numerous food origin disease number of cases from the monitoring network data analysis of Chinese food origin disease,
46.4% is accounted for as caused by microorganism, 24.1% is accounted for as caused by chemical substance, accounts for 14.7% as caused by toxic animals and plants.And draw
The common pathogen for playing food poisoning mainly includes salmonella, staphylococcus aureus, Listeria monocytogenes, cholera arc
Bacterium, vibrio parahemolyticus, Bacillus cereus, Escherichia coli O 157: H7, shigella dysenteriae, Enterobacter sakazakii, clostridium botulinum and
C.perfringens etc..
Food origin disease is reduced for the harm of food-borne pathogens in order to effectively contain the propagation of food-borne pathogens
Incidence, establishing effective pathogenic bacteria detection technique and method becomes problem in the urgent need to address.Currently, food-borne pathogens
Detection method mainly include traditional detection method, immunological detection method and molecular biology for detection.Wherein
Traditional detection method is the most reliable and accurate, but traditional detection method is needed by preceding increasing bacterium, is separately cultured, the life of suspicious bacterium colony
Change a series of processes such as identification and Serologic test, thus heavy workload, detection cycle is long and positive rate is low.Immunology detection
Method is that the specific reaction based on antigen-antibody achievees the purpose that detect pathogenic bacteria, mainly includes immunofluorescence technique, enzyme
Join immunoabsorption, immuno magnetic cell separation technology, colloidal gold-labeled method, immuno-chip technology etc., wherein inhaling with enzyme linked immunological
Attached method is most widely used, and has been successfully applied to Escherichia coli O 157: the detection of H7, Staphylococcus aureus enterotoxin etc..
The method of immunology detection pathogenic bacteria tends to be easier, fast and automatically changes at present, is as a result easy to determine, but immunological method
There is also limitations, on the one hand need to provide a fairly large number of purification of bacterial, or collect after sample object bacterium need to be concentrated, no
It can fundamentally solve the problems, such as that conventional method exists；On the other hand, each immunology detection mode all exist antibody with it is non-
Nonspecific reaction between antigenic substance, to be also easy to produce false positive.And with the rapid development of Protocols in Molecular Biology, especially
It is the rapid development of polymerase chain reaction, the advantages that because of its high sensitivity, high specificity, gradually becomes food-borne pathogenic
The main tool that bacterial examination is surveyed.Polymerase chain reaction is one kind by invention in American scientist Mullis etc. 1983 in body
Outer simulation DAN nature reproduction technology, primer and DNA profiling base pair complementarity, under the action of archaeal dna polymerase by denaturation,
Annealing extends three step iterative cycles to achieve the purpose that specific DNA cloning.Standard PCR technology is wide at present
In the general detection for being applied to salmonella, staphylococcus aureus, Bacillus cereus etc..But Standard PCR once can only
It detects single pathogenic bacteria, therefore continues to have developed multiplex PCR, real-time fluorescence quantitative PCR, nest-type PRC, number again on this basis
A series of technologies such as word PCR, wherein multiplex PCR is realized in a reaction tube because multipair primer can be added in the reaction system
Detect multiple target DNAs simultaneously, and other round pcrs detection flux is all due to a variety of causes there are limitation, therefore multiplex PCR
Technology becomes current most promising method, has been widely applied in the detection of food-borne pathogens at present.
For multiplex PCR, theoretically for, as long as optimization PCR reaction condition, so that it may multi-PRC reaction is continuously improved
The quantity of primer pair in system, however in fact with the continuous improvement of primer pair quantity, primer dimer can be caused in succession, drawn
Object mispairing, a series of technical problem such as primer amplification efficiency is different, primer size is difficult to differentiate between, therefore, multiplex PCR is actually
Detection flux be usually no more than 7 weights.In order to increase the detection flux of multiplex PCR, domestic and international expert proposes a variety of solutions
And certain progress is achieved, such as optimization PCR reaction condition, improve DNA polymerase activity, or by multiple PCR technique and other
Technology combines, such as droplet type digital pcr, genetic chip, liquid phase suspension chip technology, but these schemes are not from basic
Upper reduction primer concentration reduces the interaction or complicated for operation between primer, is not easy to promote.
Summary of the invention
The invention discloses PCR kits and its application that food-borne pathogens detection consensus primer mediates, special
Property the end of primer 5 ' addition consensus primer, obtaining reduces specific primer dosage in the reaction system, reduces mutual between primer
Effect largely improves the effect of the detection flux of multiplex PCR.The present invention is mediated multiple using consensus primer
Round pcr, for the common 11 kinds of food-borne pathogens in China, including detection of Salmonella (salmonella), listeria monocytogenes
(Listeria monocytogenes), Shigella flexneri (Shigella flexneri), enterohemorrhagic escherichia coli O157
(Escherichia coli O157:H7), vibrio parahemolyticus (Vibrio parahaemolyticus), Staphylococcus aureus
Bacterium (Staphylococcus aureus), comma bacillus (Vibrio cholerae), A type clostridium botulinum (Botulinum type A), Bacillus cereus (Bacillus cereus), C.perfringens (Clostridium perfringens)
With yersinia enterocolitica (Yersinia enterocolitica), establish one kind can detect simultaneously 11 kinds it is food-borne
The multiplex PCR system that the consensus primer of pathogenic bacteria mediates is propagated to reach effectively control pathogenic microorganism, reduces food-borne disease
The purpose of sick incidence.
The present invention adopts the following technical scheme:
A kind of ten PCR kits that food-borne pathogens detection is mediated with consensus primer, including consensus primer, be directed to food-borne cause
The chimeric primers of germ；The sequence of the consensus primer is SEQ ID NO.1；The chimeric primers for food-borne pathogens
For nucleotide sequence shown in SEQ ID NO.2 to SEQ ID NO.23.
In above-mentioned technical proposal, the PCR kit further includes Taq polymerase, dNTP, MgCl2, PCR buffer, go
Ionized water, positive control primers pair, these are all existing conventional products.
The invention also discloses a kind of methods of food-borne pathogens in testing product, extract product gene group to be detected
DNA carries out PCR in the presence of chimeric primers are with consensus primer and reacts as template, carries out electrophoretic analysis to PCR product and completes
The detection of food-borne pathogens ingredient in sample；The sequence of the consensus primer is SEQ ID NO.1；The chimeric primers are
Nucleotide sequence shown in SEQ ID NO.2 to SEQ ID NO.23.
The present invention further discloses a kind of ten food-borne pathogens multiplex PCR detection primers, including consensus primer, needle
To the chimeric primers of food-borne pathogens；The sequence of the consensus primer is SEQ ID NO.1；It is described to be directed to food-borne pathogens
Chimeric primers be SEQ ID NO.2 to SEQ ID NO.23 shown in nucleotide sequence.
The invention also discloses a kind of above-mentioned ten food-borne pathogens multiplex PCR detection primers to prepare above-mentioned ten a kind of
Application or a kind of above-mentioned ten food-borne pathogens in the PCR kit that food-borne pathogens detection consensus primer mediates is more
Application of the weight PCR detection primer in multiplex PCR detection food-borne pathogens.
In the present invention, the sequence SEQ ID NO.1 of the consensus primer and the nucleotide sequence of the chimeric primers are as follows
It is shown:
In above-mentioned technical proposal, consensus primer and food-borne pathogens related gene group are without homology, when with food-borne pathogens
When genome is that template is expanded, no matter condition, should all there is no specific product；When with the amplified production of chimeric primers
When for template, consensus primer can amplify specific product.
In above-mentioned technical proposal, when carrying out PCR reaction, temperature program is 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s,
66 DEG C of annealing 30s, 72 DEG C of annealing 45s, 72 DEG C of extension 3min are recycled for 10 totally；Then 95 DEG C of denaturation 30s, 53 DEG C of annealing
30s, 72 DEG C of extension 45s, totally 30 recycle；Last 72 DEG C of extensions 7min.Entire program creativeness devises two annealing temperature
Degree, preceding 10 circulations, under high annealing temperature, the specific chimeric primer specific amplified target sequence of low concentration, generation is had
The PCR product of consensus primer end；30 circulations afterwards, under low temperature thermal oxidation, what the consensus primer of high concentration was generated with early stage
PCR product with consensus primer sequence is that template carries out massive amplification.It according to the method for the present invention can effective, simplicity inspection
It surveys in product and whether contains food-borne pathogens ingredient, make tremendous contribution for national right to know and food safety.
In above-mentioned technical proposal, when carrying out multi-PRC reaction, using 25 microlitres of systems, the wherein final concentration of consensus primer
It is as follows for the final concentration of the chimeric primers pair of food-borne pathogens for 1600nM: cbA 0.1 μM/μ L, CP, 0.25 μM/μ L,
0.1 μM/Μ of VP 0.2 μM/μ L, VC 0.2 μM/μ L, O157 0.2 μM/μ L, YER 0.3 μM/μ L, SFL 0.025 μM/μ L, LM
L, SA 0.06 μM/μ L, SP, 0.075 μM/μ L, BC, 0.15 μM/μ L.
Food-borne pathogens component nucleic acid detection method disclosed by the invention is accurate, and the chimeric primers are to eat for 11 kinds
The chimeric primers of borne pathogen can detect 11 kinds of target genes simultaneously, and testing result is accurate.
Kit (referred to as UP-M-PCR system) disclosed by the invention can be used for food-borne pathogenic in product especially food
The detection of bacterium ingredient, multiplex PCR disclosed by the invention are the multiplex PCR combination double annealing temperature methods that consensus primer mediates.It follows
Ring early stage, under high annealing temperature, the chimeric primers of low concentration expand target sequence, generate the PCR for having consensus primer end
Product；The later period is recycled, under low temperature thermal oxidation, the consensus primer of high concentration is in early days with the PCR product of consensus primer sequence
Massive amplification is carried out for template.The 25 μ L reaction systems that multiplex PCR uses include: 10 μM of 4 μ L of consensus primer, various concentration
2 μ L, 2 × Taq master Mix of chimeric primers mixture 12.5 μ L, 1 μ L of DNA profiling, sterilize ddH2O 4.5μL；PCR is anti-
Answer condition are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 66 DEG C of annealing 30s, 72 DEG C of annealing 45s, 72 DEG C of extension 3min are total
10 circulations；Then 95 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 30 recycle；Last 72 DEG C of extensions
7min.Then agarose gel electrophoresis analysis is carried out, the results showed that the multiplex PCR reagent of detection food-borne pathogens of the invention
Box can simultaneously 11 kinds of food-borne pathogens of specific detection genome；Embodiment shows system bacterium solution sensibility substantially 102-
103Between cfu/ml, in UP-M-PCR system sensitivity Detection result of the present inventionBotulinum typeASensibility is up to
0.01ng/ μ L is completely out of the expection of those skilled in the art, non-obvious.
Food origin disease is that the whole world is distributed one of most commonly used disease, no matter for developed country or develops China
Family is all the public health problem of significant.Food origin disease virulence factor mainly includes bacterium, virus, helminth, has
Malicious harmful chemical and natural toxin etc. cause food origin disease to cause food poisoning influence the widest in China by bacterium
It is general, account for the 30%-60% of food poisoning sum.Therefore developing can be quick, and sensitive, high-throughput detects food-borne pathogens
Method disease control and prevention are had a very important significance.Multiplex PCR Du's formula of report diagnosis for the first time since 1988
Since muscular dystrophy, because of its high specificity, a series of advantage such as high sensitivity, reaction speed is fast, economic cost is low
Through being widely applied to the every field of genetic test, such as pathogen diagnosis, diagnosing tumor, individualized treatment and Forensic Identification
Deng.However multiplex PCR increases with target, and dimer is easily formed between primer, greatly reduces the detection flux of multiplex PCR.This
Invention utilizes the single strand oligonucleotide of " consensus primer " i.e. in 5 ' ends of every multiple PCR primer addition, one section of 17-22 base
Acid fragment is embedding by the specificity that low concentration is added in PCR system to constitute specific chimeric primer with specific primer
The consensus primer of primer and high concentration is closed, the use concentration of specific chimeric primer in multiplex PCR is reduced, reduces primer dimer
Formation, increase the detection flux of multiplex PCR, so as to realize while the detection to food-borne pathogens in 11, obtain meaning
Unimaginable technical effect.
Detailed description of the invention
Fig. 1 is the temperature ladder of consensus primer of the present invention and comparison primer (ACCTGACACTATTGAATA) to hybrid template
Spend PCR testing result figure；
Fig. 2 is pMD19-T carrier figure；
Fig. 3 is to carry out PCR testing result figure with the plasmid template containing consensus primer crossed through doubling dilution；
Fig. 4 is to carry out PCR testing result figure with the plasmid template for the primer containing comparison crossed through doubling dilution；
Fig. 5 is specific primer specific detection；
Fig. 6 is chimeric primers specific detection；
Fig. 7 is UP-M-PCR system specific detection；
Fig. 8 is the PCR stoste sequencer map of UP-M-PCR system specific detection；
Fig. 9 is two template specific detection of UP-M-PCR system；
Figure 10 is the sensitivity Detection of UP-M-PCR；
Figure 11 is the bacterium solution sensitivity Detection of UP-M-PCR.
Specific embodiment
Experimental strain
| Strain name | Number | Source |
| Listeria monocytogenes (Listeria monocytogenes) | ATCC19115 | Guangdong Province's Culture Collection |
| Vibrio parahemolyticus (Vibrio parahaemolyticus) | ATCC17802 | Guangdong Province's Culture Collection |
| C.perfringens (Clostridium perfringens) | ATCC13124 | Guangdong Province's Culture Collection |
| Shigella flexneri (Shigella flexneri) | ATCC12022 | Guangdong Province's Culture Collection |
| Bacillus cereus (Bacillus cereus) | ATCC14579 | Guangdong Province's Culture Collection |
| Comma bacillus (Vibrio cholerae) | GIM1.449 | Guangdong Province's Culture Collection |
| Enterohemorrhagic escherichia coli O157(Escherichia coli O157:H7) | CICC 10907 | Chinese industrial Culture Collection |
| Escherichia coli (toxin gene containing Clostridium botulinum type A) (Escherichia coli) | CICC 10783 | Chinese industrial Culture Collection |
| Moscow' paratyphi B (Moscow' paratyphi B) | CMCC(B)50094 | Chinese medicine bacterium preservation administrative center |
| Staphylococcus aureus (Staphylococcus aureus) | CMCC(B)26003 | Chinese medicine bacterium preservation administrative center |
| Escherichia coli (Escherichia coli) | CMCC(B)44102 | Chinese medicine bacterium preservation administrative center |
| Yersinia enterocolitica (Yersinia enterocolitica) | ATCC23715 | Guangdong Province's Culture Collection |
Test bacterium separation strains
| Strain name | Quantity (strain) | Source |
| Listeria monocytogenes (Listeria monocytogenes) | 10 | Disease Control and Prevention Center, Suzhou City |
| Vibrio parahemolyticus (Vibrio parahaemolyticus) | 28 | Disease Control and Prevention Center, Suzhou City |
| Shigella flexneri (Shigella flexneri) | 6 | Disease Control and Prevention Center, Suzhou City |
| Bacillus cereus (Bacillus cereus) | 7 | Disease Control and Prevention Center, Suzhou City |
| Comma bacillus (Vibrio cholerae) | 11 | Disease Control and Prevention Center, Suzhou City |
| Enterohemorrhagic escherichia coli O157(Escherichia coli O157:H7) | 2 | Disease Control and Prevention Center, Suzhou City |
| Salmonella (salmonella) | 13 | Disease Control and Prevention Center, Suzhou City |
| Staphylococcus aureus (Staphylococcus aureus) | 16 | Disease Control and Prevention Center, Suzhou City |
| Campylobacter jejuni (Campylobacter jejuni) | 1 | Disease Control and Prevention Center, Suzhou City |
| Campylobacter Coli (Campylobacter coli) | 1 | Disease Control and Prevention Center, Suzhou City |
| Yersinia enterocolitica (Yersinia enterocolitica) | 1 | Disease Control and Prevention Center, Suzhou City |
| Intestines adhesion Escherichia coli (EAEC) | 3 | Disease Control and Prevention Center, Suzhou City |
| Escherichia coli (Escherichia coli) | 1 | Disease Control and Prevention Center, Suzhou City |
Experimental method
The configuration of 1 main solution
1.1 Ampicillin(200 mg/mL): it weighs 4 g ampicillins and sets in 50 mL centrifuge tubes, 15 mL sterilizing is added
ddH2O dissolving and mixing continuously adds sterilizing ddH2O is settled to 20 mL.And with 0.22 μm of filter membrane filtration sterilization.
The packing of 1.5ml centrifuge tube, -20 DEG C of preservations.
1.2 50 × TAE:Tris-base, 121 g, glacial acetic acid 28.5 mL, 9.305 g EDTANa2, ddH2O is settled to
500 mL, room temperature preservation, when use, are diluted to 1 × TAE working solution concentration.
1.3 60% glycerites: 60 mL glycerites are measured, distilled water is added to be settled to 100 mL, 121 DEG C of high steams
Sterilizing, is sub-packed in 1.5mLEP pipe, 4 DEG C of preservations.In use, isometric bacterium solution is added, mixing is placed on -80 DEG C of refrigerators and protects
It deposits.
1.4 2.5% Ago-Gels: weighing agarose 2.5g and be placed in 250 mL triangular flasks, 100 1 × TAE of mL are added,
Micro-wave oven dissolves by heating (about 6 min), and room temperature is cooled to about 60 DEG C, after 10 μ LGelred mixing is added, injects glue disk glue groove
In to complete solidification, saved in 4 DEG C of refrigerators.
The configuration of main medium
2.1 LB/Amp fluid nutrient mediums: weighing 5 g of tryptone, and yeast extract 2.5g, sodium chloride 5g to 500ml indigo plant lid are tried
In agent bottle, the ddH of 200 mL is added2O shakes reagent bottle until dissolution.PH value is adjusted with about 0.2 mL of 5 mol/L NaOH()
7.0, ddH2O is settled to 500ml.121 DEG C of 15 min of high pressure steam sterilization are sub-packed in 4 DEG C of edge sealing preservations in 10ml centrifuge tube.Make
5 μ l Ampicillin(200 mg/mL are added in used time) to every pipe, so that Ampicillin concentration is 200 μ g/mL.
2.2 LB solid mediums: 5 g of tryptone, 2.5 g of yeast extract, 5 g of sodium chloride, 5 g of agar powder are weighed
Into 500ml indigo plant lid reagent bottle, the ddH of about 480 mL is added2O dissolution, 5 mol/L NaOH adjust pH value to pH=7.0, ddH20
It is settled to 500 mL.121 DEG C of 15 min of high pressure sterilization, are placed in after super-clean bench is cooled to 60 DEG C and pour into culture dish, culture medium solidification
Edge sealing inversion, which is deposited in 4 DEG C of refrigerators, afterwards saves, and uses in one month.
2.3 LB/Amp solid mediums: 5 g of tryptone, 2.5 g of yeast extract, 5 g of sodium chloride, agar powder are weighed
The ddH of about 480 mL is added into 500ml indigo plant lid reagent bottle in 5 g2O dissolution, 5 mol/L NaOH adjusting pH value to pH=7.0,
ddH20 is settled to 500 mL.121 DEG C of 15 min of high pressure sterilization, are placed in when super-clean bench is cooled to 60 DEG C or so and 0.5 mL are added
200 mg/mL, so that the final concentration of 200 μ g/mL of ampicillin, pours into culture dish, seal after culture medium solidification after sufficiently shaking up
Side is inverted to deposit in 4 DEG C of refrigerators and be saved, and uses in one month.
2.4 brain heart infusion agar culture mediums: weighing brain heart infusion agar culture medium 16.0g, and heating stirring is dissolved in
In 500ml distilled water, 121 DEG C of 15 min of high pressure sterilization, bed board is spare.
2.5 TSA blood agar culture-mediums: tryptone 7.5g, phytone 2.5g, sodium chloride 2.5g, agar are weighed
7.5g, stirring and dissolving is in 500ml distilled water, 121 DEG C of 15 min of high pressure sterilization, and sterile working is added when being cooled to 50-55 DEG C
The aseptic de-fiber sheep blood of 5% pre-temperature to 37 DEG C mixes, is poured into sterilized petri dishes.Bed board is spare.
2.6 nutrient agars: weighing peptone 5g, beef extract 1.5g, sodium chloride 2.5g, agar 10g, stirs molten
Solution is in 500ml distilled water, 121 DEG C of 15 min of high pressure sterilization, and bed board is spare.
2.7 C.perfringens agar mediums: tryptone 5g, beef extract 5g, glucose 2.5g, sodium chloride are weighed
2.5g, yeast extract 1.5g, sodium acetate 1.5g, soluble starch 0.5g, L-cysteine hydrochloride 1.5g, agar 7.5g,
Stirring and dissolving is in 500ml distilled water, 121 DEG C of high pressure sterilization 15min, and bed board is spare.
The recovery of bacterial strain is passed on and is frozen
1) it is carried out disinfection with 75% alcohol swab wiping freeze-drying pipe surface, tube top end is evenly heated on alcolhol burner flame envelope.
2) 2 ~ 3 drop sterile water of drop ruptures tube wall in heating position immediately.
3) rent is broken into pieces with tweezers or other suitable tools.
4) 0.5mlLB Liquid Culture is drawn with aseptic straw to be based on all dissolving freeze-dried vaccine powder in freeze-drying pipe.
5) dissolved bacteria suspension is all transferred on corresponding solid medium to (C.perfringens is forwarded to production gas
Capsular clostridium culture medium, Listeria monocytogenes are forwarded to brain-heart infusion medium, and vibrio parahemolyticus is forwarded to the training of TSA blood agar
Support, comma bacillus is forwarded to nutrient agar, remaining bacterium is forwarded to LB solid medium), in 37 DEG C of constant incubators
(wherein C.perfringens is placed in the Anaerobic culturel bag for be put into anaerobic gas generation packet rear 37 DEG C of constant temperature incubations within 2-3 days for culture.)
It is passed on after freeze-dried vaccine recovery according to strain situation, reaches picking single bacterium colony 37 DEG C of 150 r/ in LB liquid medium after two generations
Min shake culture 6h, isometric sterile 60% glycerite of addition freeze spare.
Primer
In the present invention, the sequence SEQ ID NO.1 of the consensus primer and chimeric primers SEQ ID NO.2~SEQ ID
The nucleotide sequence of NO.23 is as follows:
| Number | Primer sequence (5 ' -3 ') |
| SEQ ID NO.1 | ACTGTGTTTACTACTAGA |
| SEQ ID NO.2 | ACTGTGTTTACTACTAGACGAAATGGTTATGGCTCTACTC |
| SEQ ID NO.3 | ACTGTGTTTACTACTAGATGTGCTAATGTTACTGCTGGAT |
| SEQ ID NO.4 | ACTGTGTTTACTACTAGACTGCTAATGTTACTGCCGTTGA |
| SEQ ID NO.5 | ACTGTGTTTACTACTAGACCTCTTGCATATTCTTTTGACC |
| SEQ ID NO.6 | ACTGTGTTTACTACTAGACTGATAACAATGACGCCTCTG |
| SEQ ID NO.7 | ACTGTGTTTACTACTAGAGAGATTCCGCTGGGTTTG |
| SEQ ID NO.8 | ACTGTGTTTACTACTAGAGCGTGTTTGTGGTGAAGCC |
| SEQ ID NO.9 | ACTGTGTTTACTACTAGAGCACGGAGCGTTACGATGT |
| SEQ ID NO.10 | ACTGTGTTTACTACTAGAGGTGAAGGTGGAATGGTTG |
| SEQ ID NO.11 | ACTGTGTTTACTACTAGAGCGGTCCTAGTTAGAATTGAGA |
| SEQ ID NO.12 | ACTGTGTTTACTACTAGATGGGGAGTAATAGGTTCGTTT |
| SEQ ID NO.13 | ACTGTGTTTACTACTAGAATACCCAGCACCAAGCATC |
| SEQ ID NO.14 | ACTGTGTTTACTACTAGATTCCGTGAACAGGTCGCT |
| SEQ ID NO.15 | ACTGTGTTTACTACTAGAGGTCATTTGCTGTCACTCCC |
| SEQ ID NO.16 | ACTGTGTTTACTACTAGACCGTAAGTGGGAAATCTGTCT |
| SEQ ID NO.17 | ACTGTGTTTACTACTAGATGGACGATGTGAAATGAGCT |
| SEQ ID NO.18 | ACTGTGTTTACTACTAGAGGGCAATACGCAAAGAGG |
| SEQ ID NO.19 | ACTGTGTTTACTACTAGATTAGCCAAGCCTTGACGAA |
| SEQ ID NO.20 | ACTGTGTTTACTACTAGAAAAGAAGGGTCGTCGTTAGG |
| SEQ ID NO.21 | ACTGTGTTTACTACTAGACTTCCAGTTGGTCCAGCATA |
| SEQ ID NO.22 | ACTGTGTTTACTACTAGACAAAAGAATGCAAGGGCACA |
| SEQ ID NO.23 | ACTGTGTTTACTACTAGAGTAAGCAACTCCAACTACACGA |
Embodiment one
The extraction of bacterial genomes DNA
Each bacterium is extracted according to the specification of the bacterial genomes DNA extraction kit (article No. DP209-02) of QIAgen company
(11 kinds) genomic DNA, step method therein are as follows.
1) inoculum 1-5ml is drawn, 10000 rpm are centrifuged 5 min, inhale abandon supernatant as far as possible.
2) 200 μ L buffer solution GA are added into bacterial sediment, oscillation thoroughly suspends to thallus.(for the leather of difficult broken wall
Lan Shi positive bacteria may skip second step, and lysozyme is added and carries out broken wall treatment, specific method is that 180 μ L enzyme solutions are added
(20 mM Tris HCl, pH 8.0;2 mM EDTA;1.2% Triton；20 mg/ml lysozyme of final concentration；), 37 DEG C of processing
30min or more.)
3) 20 μ LProteinaseK solution are added into pipe, mix.
4) 220 μ L buffer solution GB are added, vibrate 15s, 70 DEG C of placement 15min, solution strain is limpid, and brief centrifugation is to remove
Remove the droplet of cap wall.
5) 220 μ L dehydrated alcohols are added, sufficiently oscillation mixes 15s, is likely to occur flocculent deposit at this time, brief centrifugation is to remove
Remove the droplet of cap wall.
6) previous step acquired solution and flocculent deposit be all added in an adsorption column CB3 (adsorption column is put into collecting pipe
In), 12000rpm is centrifuged 1min, outwells waste liquid, adsorption column CB3 is put into collecting pipe.
7) 500 μ L buffer GD, 12000rpm centrifugation 1min are added into adsorption column CB3, waste liquid are outwelled, by adsorption column
CB3 is put into collecting pipe.
8) 600 μ L rinsing liquid PW, 12000rpm centrifugation 1min are added into adsorption column CB3, waste liquid are outwelled, by adsorption column
CB3 is put into collecting pipe.
9) repetitive operation step 8.
10) adsorption column is put back in collecting pipe, 12000rpm is centrifuged 2min, outwells waste liquid, adsorption column CB3 is placed in room temperature and is put
It sets 5 minutes or so, thoroughly to dry rinsing liquid remaining in adsorbent material.
11) it is transferred in a clean centrifuge tube to adsorption column CB3,70 μ is vacantly added dropwise to position among absorption iris
LddH20, it is placed at room temperature for 5min, 12000rpm is centrifuged 2min, solution is collected into centrifuge tube, -20 DEG C of preservations.
Consensus primer specificity
By the detection of Salmonella of said extracted, listeria monocytogenes, Shigella flexneri, enterohemorrhagic escherichia coli O157, pair
Hemolytic vibrios, staphylococcus aureus, comma bacillus, A type clostridium botulinum, Bacillus cereus, C.perfringens, small intestine
This 11 kinds of pathogenic bacteria of enteocolitica are mixed into hybrid template, carry out temperature gradient PCR detection specificity to consensus primer,
Temperature gradient is followed successively by 53.0 DEG C, and 53.2 DEG C, 53.8 DEG C, 54.7 DEG C, 55.9 DEG C, 57.4 DEG C, 59.3 DEG C, 60.9
DEG C, 62.1 DEG C, 63.2 DEG C, 63.7 DEG C, 64.0 DEG C, while negative control is set.Specific detection amplification system such as the following table 1:
The amplification system of 1 consensus primer specific detection of table
The amplification program of 2 consensus primer specific detection of table
Fig. 1 is the temperature ladder of consensus primer of the present invention and comparison consensus primer (ACCTGACACTATTGAATA) to hybrid template
PCR testing result is spent, wherein 1-12 swimming lane respectively corresponds 53.0 DEG C, and 53.2 DEG C, 53.8 DEG C, 54.7 DEG C, 55.9 DEG C,
57.4 DEG C, 59.3 DEG C, 60.9 DEG C, 62.1 DEG C, 63.2 DEG C, 63.7 DEG C, 64.0 DEG C；As can be seen that of the invention is public
Primer and comparison consensus primer will not all expand a kind of ten pathogenic bacteria.
The detection of consensus primer sensibility
Selecting bacteria 16S rDNA gene order is as template, using bacterial 16 S rDNA specific primer, that is, D1 and D2, product
Size is 566 bp.In 5 ' the end connections consensus primer sequence of the present invention of special primer D1, restriction enzyme SphI digestion position
Point and protection base (ACATGCATGC), constitute long primer LP1；Consensus primer sequence of the present invention is connected at the 5 ' ends of special primer B2
Column, restriction enzyme XbaI enzyme cutting site and protection base (GCTCTAGA), constitute long primer LP2, pass through double digestion molecule
Plasmid template of clone's building containing consensus primer, detects consensus primer sensibility.Primer is by Suzhou Jin Weizhi biotechnology
Co., Ltd's synthesis, sequence are shown in Table 2.
3 consensus primer of table, special primer and long primer sequence
The amplification of target gene and the preparation of target fragment
PCR amplification is carried out to escherichia coli (CMCC (B) 4410216) genomic DNA using special primer D1 and D2, is obtained
The first PCR product only containing bacterial 16 S rDNA gene order.Using the first PCR product as template, with long primer LP1 and LP2
Second of PCR amplification is carried out, the second PCR product with long primer sequence is obtained.It cuts glue purification and recycles the second PCR product, obtain
Amplification system to the target fragment of the sequence containing consensus primer, twice PCR amplification is consistent with reaction condition, is shown in Table 3, table 4.
The amplification system of the preparation target fragment of table 4
The PCR reaction condition of the preparation target fragment of table 5
The purification and recovery of PCR product
After identifying the second PCR product, according to the universal DNA purification and recovery kit specification (article No. DP214) of Tiangeng company into
Row PCR purification process:
1) column equilibration step: 500 μ L equilibrium liquid BL, 12000 rpm 1 min of centrifugation are added into adsorption column CB2, outwell collection
Adsorption column is replaced in recycling collector by pipe waste liquid.
2) Ago-Gel target DNA band (excision is more than part as far as possible) is cut, is put into clean centrifuge tube, claims
Amount.
3) the sol solutions PC(such as gel that equimultiple volume is added into centrifuge tube weighs 0.1 g, then volume is considered as 100 μ L),
It constantly mildly spins upside down centrifuge tube during 50 DEG C of about 10 min(of water-bath to dissolve completely to glue).
4) sol solution is taken out, is cooled to room temperature and is added in equilibrated adsorption column CB2 (adsorption column is put into collecting pipe),
12000 rpm are centrifuged 1 min, outwell the waste liquid in collecting pipe, adsorption column CB2 is put into collecting pipe.
5) 600 μ L rinsing liquid PW(PW are added in CB2 into adsorption column, dehydrated alcohol are added in advance), 12000 rpm from
1 min of the heart, outwells the waste liquid in collecting pipe, and adsorption column CB2 is put into collecting pipe.
6) repetitive operation step 5.
7) adsorption column is placed in collecting pipe, 12000 rpm skies eliminate rinsing liquid PW from 3 min(as far as possible).
8) adsorption column is placed at room temperature for 5 minutes, thoroughly dried.
9) adsorption column is placed in clean EP pipe, ddH is vacantly added dropwise to iris270 μ L of O, is stored at room temperature 2 min,
12000 rpm are centrifuged 2 min, collect DNA solution, and obtained DNA is placed -20 DEG C of preservations.
Target gene is connect with carrier
Using double digestion method, digestion is carried out to the second PCR product of pMD19-T carrier and recycling respectively with XbaI and SphI,
The two is linked together with T4 ligase after recycling digestion products.Double digestion system and linked system are respectively such as table 5, table 6.
6 double digestion system of table
Above-mentioned system is in 37 DEG C of constant temperature 1.5-2 h of PCR instrument.
7 coupled reaction system of table
The 16 DEG C of reactions in PCR instrument of above-mentioned system are stayed overnight.
The conversion of plasmid
It is converted after connection, recombinant plasmid is transferred in DH5 α competent cell, specific step is as follows for conversion:
1) 10 μ L connection reaction solutions are taken to be added in 50 μ L DH5 α competent cells, ice sets 30 min.
2) 42 DEG C of 42 s of heating water bath, then ice set 5 min.
3) it is added in 800 μ L Amp feminine gender LB liquid mediums, 37 DEG C of 1 h of shake culture.
4) product will be totally converted to be coated on the LB solid medium containing Amp, after bacterium solution blots, is inverted culture dish,
The overnight incubation in 37 DEG C of insulating boxs.
5) picking single bacterium colony is inoculated in respectively in 5 mL Amp positive fluid nutrient mediums, 37 DEG C of 150 r/min concussion
Overnight incubation, upgrading grain, Fig. 2 are pMD19-T Vector map.
Plasmid is small to be mentioned
Plasmid template is extracted to be grasped according to the specification of AxyPrep Plasmid DNA small volume of reagent box (article No. AP-MN-P-50G)
Make.
1) column equilibration step: 500 μ L equilibrium liquid BL, 12000 rpm centrifugation 1min are added into adsorption column CP3, outwell receipts
Waste liquid in collector, adsorption column is put back in collecting pipe.
2) bacterium solution for taking 5ml to be incubated overnight is added in centrifuge tube, and 12000 rpm are centrifuged 1min, inhales abandon supernatant as far as possible.
3) Rnase is added before 250 μ L solution P1(uses are added in the centrifuge tube of Xiang Liuyou bacterial sediment), use liquid relief
Rifle or vortex oscillator sink to the bottom suspended bacterial precipitating.
4) 250 μ L solution P2 are added into centrifuge tube, mild spins upside down 6-8 times and crack thallus sufficiently.
5) 350 μ L solution P3 are added into centrifuge tube, mild immediately spins upside down 6-8 times, mixes well, and will go out at this time
Existing white flock precipitate.12000 rpm are centrifuged 10min.
6) supernatant that previous step is collected is transferred in adsorption column CB3 (adsorption column is put into collecting pipe) with liquid-transfering gun,
Notice that metering not wash out precipitating.12000 rpm are centrifuged 1min, outwell the waste liquid in collecting pipe, adsorption column CB3 is put into collection
Guan Zhong.
7) 600 μ L rinsing liquid PW(are added into adsorption column CB3 please check whether and dehydrated alcohol has been added), 12000 rpm
It is centrifuged 1min, the waste liquid in collecting pipe is outwelled, adsorption column CB3 is put into collecting pipe.
8) step 7 is repeated.
9) adsorption column CB3 is put into collecting pipe, 12000 rpm are centrifuged 2min, it is therefore an objective to by drift remaining in adsorption column
Washing lotion removal.Adsorption column CB3 uncaps, and is placed at room temperature for 5min, thoroughly to dry rinsing liquid remaining in adsorbent material.
10) adsorption column CB3 is put into clean centrifuge tube, is added 72 DEG C to position among absorption iris, 50 μ
LddH2O, is placed at room temperature for 2min, and plasmid solution is collected into centrifuge tube by 12000 rpm centrifugation 2min.
The identification of recombinant plasmid
The identification of recombinant plasmid includes PCR identification and sequencing.PCR identification: it using recombinant plasmid as template, is carried out with specific primer
Expand rear electrophoresis identification.Sequencing identification: being that plasmid after identifying PCR send to Suzhou Jin Weizhi company and is sequenced, sequencing result can
It compares and analyzes, further determines that its correctness.
The detection of consensus primer sensibility
The plasmid template of the sequence containing consensus primer is subjected to 10 times of gradient dilutions with deionized water after extracting in Escherichia coli, according to
It is secondary to obtain 107、106、105、104、103、102With the plasmid template solution of 10 copies/ μ L dilutions.Each dilution takes 1
μ L carries out PCR reaction to consensus primer respectively as template, detects consensus primer sensibility.Amplification system is shown in Table 3, reacts item
Part is shown in Table 7.
The reaction condition of 8 consensus primer sensitivity Detection of table
Fig. 3 is to carry out PCR testing result with the plasmid template containing consensus primer crossed through doubling dilution, wherein middle 1-7 swimming lane pair
The plasmid template concentration answered is followed successively by 107Copies/ μ L ~ 10copies/ μ L, as the result is shown consensus primer sensibility be
103copies/μL。
According to the above method, consensus primer is replaced with into comparison consensus primer (ACCTGACACTATTGAATA), remaining one
Sample, its sensibility is 10 as the result is shown5Copies/ μ L, is shown in Fig. 4, wherein the corresponding plasmid template concentration of middle 1-7 swimming lane is followed successively by
107Copies/ μ L ~ 10copies/ μ L, consensus primer more of the present invention are poor.
Aiming at the problem that multiple PCR technique detects flux limitation, the present invention holds one section of public affairs of addition in specific primer 5 '
Primer is altogether to constitute specific chimeric primer.The consensus primer of high concentration and low is added simultaneously in multi-PRC reaction system
The chimeric primers of concentration, the chimeric primers and DNA profiling complementary pairing of reaction starting low concentration are amplified containing consensus primer
PCR product, as the chimeric primers of low concentration exhaust, the consensus primer of high concentration continues to produce with the PCR containing consensus primer
Object complementary pairing amplifies more target gene.Consensus primer of the invention not only under series of temperatures gradient with 11 kinds of food sources
Property pathogenic bacteria genomic DNA do not generate any non-specific band, and the introducing of consensus primer, can be by multiplex PCR
The concentration of specific primer pair is from 10 in system12Copy is reduced to 103Copy, to substantially reduce the phase interaction between primer pair
With improving the detection flux of multiplex PCR, obtain unexpected technical effect.
Embodiment two
For 11 kinds of China common food-borne pathogens (detection of Salmonella, listeria monocytogenes, Shigella flexneri, enterohemorrhagic
Escherichia coli O157, vibrio parahemolyticus, staphylococcus aureus, comma bacillus, A type clostridium botulinum, Bacillus cereus,
C.perfringens, yersinia enterocolitica) design the multiplex PCR detection architecture for establishing one " consensus primer " mediation
(Universal primers mediated multiplex PCR, UP-M-PCR system) carries out system sensibility and special
Property detection and actual sample detection.UP-M-PCR system include the consensus primer of SEQ ID NO.1, table 9 chimeric primers with
And conventional PCR component, form a kind of ten PCR kits that food-borne pathogens detection is mediated with consensus primer.
Pathogen detection target gene is most important to entire technology, conservative, accuracy and the specificity of target sequence
It is directly related to the accuracy and specificity of pathogen detection, specific primer of the invention and existing disclosed each germ are special
Property primer it is different, the accuracy and specificity of pathogen detection can be improved in creative design of primers, and the Tm value of primer is 60
DEG C or so, in addition, the present invention keeps the consistent of each primer amplification efficiency, the size between amplified production differs small, amplified fragments
Length concentrates on 200-750 bp, and chimeric primers are not present hairpin structure, do not have the dimerization bodily form plus after consensus primer
At there is no the joint efficiency of mispairing product and primer and template high, obtain unexpected technical effect.
9 specific primer sequence of table
The chimeric primers sequence of the present invention of table 10
Underscore part is consensus primer sequence；The corresponding upper case abbreviations of pathogenic bacteria genome are successively are as follows:Botulinum type A(cbA)、C.perfringens(CP)、V.parahaemolyticu(VP)、V.cholera(VC)、EHEC O157:H7
(O157)、Y.enterocolitica(YER)、S.flexneri(SFL)、 L. monocytogenes(LM)、S. aureus
(SA)、salmonella(SP)、B.cereus(BC)。
Chimeric primers specific detection
The specific detection of chimeric primers: using the PCR method of single primer+multi-template, by 11 kinds of food-borne pathogens genomes
DNA(concentration is 20ng/uL) it is homogenously mixed together, 11 kinds of food-borne causes are expanded using each chimeric primers (table 9) respectively
The hybrid template of germ genomic DNA, while 11 kinds of food-borne pathogens genomic DNAs are expanded with specific primer (table 8)
Hybrid template is more specific, and PCR amplification system and response procedures are shown in Table 10 and table 11.Specific primer (table 8) and specificity
Chimeric primers (table 9) specific detection result is as it can be seen in figures 5 and 6,1-11 swimming lane respectively corresponds specific primers ofBotulinum typeA;C.perfringens;V.parahaemolyticus;V.cholerae;EHEC O157:H7; Y.enterocolitica;S.flexneri;L.monocytogenes;S.aureus;Salmonella;B.cereus;M is
100 bp DNA marker.There is expected purpose band in each swimming lane, clear bright, existing specific primer and spy
Anisotropic chimeric primers only generate purpose band with target gene, with other 10 kinds of non-target gene without any non-specific band
It generates.Thus illustrate the consensus primer of 5 ' end of specific chimeric primer addition of the present invention on the specific without influence of primer.
11 specific chimeric primer specific detection PCR amplification system of table
12 specific chimeric primer specific detection PCR amplification program of table
The specific detection of UP-M-PCR system
This experiment is using two step temperature methods, i.e., high annealing temperature PCR and low temperature thermal oxidation PCR.Circulation early stage anneals in height
At a temperature of (66 DEG C), the chimeric primers of low concentration expand target sequence, generate the PCR product for having consensus primer sequence.Circulation
In the later period, under low temperature thermal oxidation (53 DEG C), the PCR product that the consensus primer of high concentration is generated using early stage carries out a large amount of as template
Amplification.
UP-M-PCR system single mode plate specific detection: using more primers+single mode plate PCR method, amplification system and anti-
It answers condition to be shown in Table 12 and 14, each pipe chimeric primers is diluted to corresponding concentration according to shown in table 13, draw each primer solution extremely
In one new EP pipe, ddH2O is added to complement to 25ul, sufficiently oscillation mixes, and expands the gene of 11 kinds of food-borne pathogens respectively
Group DNA, is compared with specific primer substance PCR and chimeric primers substance PCR, and observation specificity, primer sequence is referring to table
9.UP-M-PCR system single mode plate specific detection result is as shown in fig. 7, swimming lane 1-11 is respectively as follows: specific primers
of Botulinum typeA;C.perfringens;V.parahaemolyticus;V.cholerae;EHEC O157:H7; Y.enterocolitica;S.flexneri;L.monocytogenes;S.aureus;Salmonella;B.cereus;M is
100 bp DNA marker.Only there is expected purpose band in each swimming lane, and band brightness is substantially uniform clear, and nothing is appointed
What non-specific band generates.Illustrate that UP-M-PCR system of the invention has preferable specificity, can be applied to this 11 kinds
The detection of food-borne pathogens.If using the PCR reaction condition of existing " 201710167334.1 ", some (S.flexneri; V.parahaemolyticus;V.cholerae;Y.enterocolitica; B.cereus) amplified production can not pass through electrophoresis
Figure detects.If the PCR method of above-mentioned more primers+single mode plate is used for only with the specific primer of table 9, since specificity is drawn
Excessive primer dimer is generated between object, can not prepare the system that can amplify 11 purpose bands.
Above-mentioned PCR reaction product is sent to sequencing, sequencing result is as shown in figure 8, sequencing result is shown amplifies really
Expected purpose band, the UP-MPCR for 11 kinds of food-borne pathogens for illustrating that the present invention designs can be amplified accurately
The purpose band that size can divide.
Two template specific detection of UP-M-PCR system: make after randomly selecting each 1 μ L mixing of genomic DNA of two kinds of bacteriums
For template, amplification system and reaction condition are shown in Table 12 and 14, and each pipe chimeric primers are diluted to corresponding concentration according to shown in table 13,
Each primer solution is drawn into a new EP pipe, ddH2O is added to complement to 25ul, sufficiently oscillation mixes, and verifies UP-M-PCR
System specificity, primer sequence is referring to table 9.Two template specific detection result of UP-M-PCR system is as shown in figure 9, wherein (a):
Swimming lane 1-10 be cbA, CP, cbA, VP, cbA, VC, cbA, O157, cbA, YER, cbA, SFL, cbA, LM, cbA, SA, cbA,
SP,cbA,BC;(b): swimming lane 1-9 be CP, VP, CP, VC, CP, O157, CP, YER, CP, SFL, CP, LM, CP, SA, CP, SP,
CP,BC;(c): swimming lane 1-8 is VP, VC, VP, O157, VP, YER, VP, SFL, VP, LM, VP, SA, VP, SP, VP, BC;
(d): swimming lane 1-7 is VC, O157, VC, YER, VC, SFL, VC, LM, VC, SA, VC, SP, VC, BC;(e): swimming lane 1-6
For O157, YER, O157, SFL, O157, LM, O157, SA, O157, SP, O157, BC;(f): swimming lane 1-9 be YER, SFL, YER,
LM,YER,SA,YER,SP,YER,BC,SFL,LM,SFL,SA,SFL,SP,SFL,BC;(g): swimming lane 1-6 be LM, SA, LM,
SP、LM,BC、SA,SP、SA,BC、SP,BC; Lane N, negative control of UP-M-PCR without
template;M is 100 bp DNA marker.From the figure, it can be seen that only occurring in the range that marker can measure
Specific band and the generation of specific band nothing but illustrate that UP-M-PCR system specificity of the invention is good, meet detection
It is required that.
The sensitivity Detection of UP-M-PCR system of the present invention
After extracting 11 kinds of food-borne pathogens bacterial genomes DNA, gradient dilution is carried out to it using deionized water, is successively obtained
20,10,1,0.1,0.05, the genomic DNA template solution of 0.01ng/ μ L dilution.Take the genomic DNA of each dilution
1 μ L of template solution is template, is carried out using template gradient of the UP-M-PCR kit of the present invention to 11 kinds of food-borne pathogens
PCR reacts (amplification system and reaction condition are shown in Table 13 and 15), while with ddH2O is template as negative control.UP-M-PCR
The results are shown in Figure 10 for system bacterial genomes DNA sensitivity Detection, the corresponding genomic DNA concentration of swimming lane 1-6 is followed successively by 20,
10,1,0.1,0.05, the corresponding genomic DNA template of 0.01ng/ μ L, picture a-k is followed successively byBotulinum typeA、 C.perfringens、V.parahaemolyticus、V.cholerae、EHEC O157:H7、Y.enterocolitica、 S.flexneri、L. monocytogenes、S.aureus、SalmonellaWithB.cereus.UP-M-PCR system sensibility
In testing resultBotulinum typeASensibility up to 0.01ng/ μ L, remaining antimicrobial susceptibility testing result is mostly 0.05
Or 0.1ng/ μ L, illustrate that UP-M-PCR detection architecture sensibility of the invention is higher, can be used for food-borne pathogens pathogen
Detection.
Bacterium solution sensitivity Detection
11 plants of food-borne pathogens reference cultures are incubated overnight, the bacterium solution that 100 μ L are incubated overnight is drawn and adds 900 μ LLB Liquid Cultures
Base is diluted to 1:10 to its 10 times8.Draw 20 μ L10-5, 10-6, 10-7, 10-8The bacterium solution dilution of four dilutions is coated on LB
Solid medium is incubated overnight for 37 DEG C in constant incubator in duplicate, and second day carries out bacterium colony plate count, to count
Calculate the bacterial solution concentration being incubated overnight.The DNA of bacterium solution doubling dilution liquid is mentioned, UP-M-PCR system bacterium solution sensibility is detected
(amplification system and reaction condition are shown in Table 13 and 15).UP-M-PCR system bacterial solution sensitivity Detection result such as Figure 11 of the present invention
Shown, the corresponding pathogenic bacteria of picture a-k are followed successively byBotulinum typeA、C.perfringens、 V.parahaemolyticus、V.cholerae、EHEC O157:H7、Y.enterocolitica、S.flexneri、L. monocytogenes、S.aureus、SalmonellaWithB.cereus.Specifically, a, cbA of Botulinum typeA
, swimming lane 1-8 corresponding concentration is 24 × 108cfu/ml, 24×107cfu/ml, 24×106cfu/ml, 24×105cfu/ml,
24×104cfu/ml, 24×103cfu/ml, 24×102cfu/ml, 24×101cfu/ml; b, cpA
ofC.perfringens, swimming lane 1-9 corresponding concentration is 14 × 109cfu/ml,14×108cfu/ml, 14×107cfu/ml,
14×106cfu/ml, 14×105cfu/ml, 14×104cfu/ml, 14×103cfu/ml, 14×102cfu/ml, 14×
101cfu/ml; c,toxR of V.parahaemolyticus, swimming lane 1-8 corresponding concentration is 144 × 108cfu/ml, 144
×107cfu/ml, 144×106cfu/ml, 144×105cfu/ml, 144×104cfu/ml, 144×103cfu/ml,
144×102cfu/ml, 144×101cfu/ml; d, EPSM of V.cholerae, swimming lane 1-8 corresponding concentration be 6 ×
108cfu/ml, 6×107cfu/ml, 6×106cfu/ml, 6×105cfu/ml, 6×104cfu/ml, 6×103cfu/
ml, 6×102cfu/ml, 6×101cfu/ml; e, rfbE of EHEC O157:H7, swimming lane 1-8 corresponding concentration is 161
×108cfu/ml, 161×107cfu/ml, 161×106cfu/ml, 161×105cfu/ml, 161×104cfu/ml,
161×103cfu/ml, 161×102cfu/ml, 161×101cfu/ml; f, ail of Y.enterocolitica, swimming
Road 1-8 corresponding concentration is 23 × 108cfu/ml, 23×107cfu/ml, 23×106cfu/ml, 23×105cfu/ml, 23
×104cfu/ml, 23×103cfu/ml, 23×102cfu/ml, 23×101cfu/ml; g, ipaH ofS.flexneri, swimming lane 1-8 corresponding concentration is 60.5 × 108cfu/ml, 60.5×107cfu/ml, 60.5×106cfu/
ml, 60.5×105cfu/ml, 60.5×104cfu/ml, 60.5×103cfu/ml, 60.5×102cfu/ml, 60.5×
101cfu/ml; h,hly of L. monocytogenes, swimming lane 1-9 corresponding concentration is 28 × 109cfu/ml, 28×
108cfu/ml, 28×107cfu/ml, 28×106cfu/ml, 28×105cfu/ml, 28×104cfu/ml, 28×
103cfu/ml, 28×102cfu/ml, 28×101cfu/ml;i,nuc of S.aureus, swimming lane 1-9 corresponding concentration is 24
×109cfu/ml, 24×108cfu/ml, 24×107cfu/ml, 24×106cfu/ml, 24×105cfu/ml, 24×
104cfu/ml, 24×103cfu/ml, 24×102cfu/ml, 24×101cfu/ml;j,invA of Salmonella,
Swimming lane 1-9 corresponding concentration is 12 × 1010cfu/ml, 12×109cfu/ml, 12×108cfu/ml, 12×107cfu/ml,
12×106cfu/ml, 12×105cfu/ml, 12×104cfu/ml, 12×103cfu/ml, 12×102cfu/ml, 12×
101cfu/ml;j,hblA of B.cereus, swimming lane 1-8 corresponding concentration is 2 × 108cfu/ml, 2×107cfu/ml, 2×
106cfu/ml, 2×105cfu/ml, 2×104cfu/ml, 2×103cfu/ml, 2×102cfu/ml, 2×101cfu/
ml.A type clostridium botulinum bacterium solution sensibility is 24 × 102Cfu/ml, C.perfringens bacterium solution sensibility are 14 × 103Cfu/ml,
Vibrio parahemolyticus bacterium solution sensibility 144 × 101Cfu/ml, comma bacillus bacterium solution sensibility are 6 × 102Cfu/ml, large intestine bar
Bacterium O157 bacterium solution sensibility 161 × 101Cfu/ml, yersinia enterocolitica bacterium solution sensibility 23 × 102Cfu/ml, good fortune formula
Shigella dysenteriae bacterium solution sensibility 60.5 × 101Cfu/ml, Listeria monocytogenes piquid-sensitive perceptual 28 × 102Cfu/ml, golden yellow grape
Coccus bacterium solution sensibility 24 × 103Cfu/ml, salmonella bacterium solution sensibility 12 × 102Cfu/ml, Bacillus cereus bacterium solution
Sensibility 2 × 103cfu/ml.System bacterium solution sensibility is substantially 102-103Between cfu/ml, sensibility is enough to be applied to reality
In the pattern detection of border.
Embodiment three
The assessment of system practical application
The 100 plants of food-borne pathogens collected from Suzhou Disease Control and Prevention Center are detected using UP-M-PCR system of the present invention.Institute
After selecting bacterial strain to be all made of the recovery of LB solid medium, mixed using disposably taking bacterium colony to be placed in 1ml Sterile Saline with cotton swab stroke
Bacterial genomes DNA is extracted afterwards.It is eaten simultaneously using the present invention to the 60 parts of anus swab samples collected from Disease Control and Prevention Center and from Suzhou
It examines collected 16 parts of food sample enrichment liquids to be detected, positive sample uses patent primer or the People's Republic of China (PRC)
The verifying of inspection and quarantining for import/export professional standard primer, specific primer sequence are shown in Table 10.Positive amplification product is sent into golden dimension simultaneously
The reliability of intelligence sequence verification result.It is each that amplification system when UP-M-PCR system expands is shown in Table 13, chimeric primers mixed liquor
Primer dosage is shown in Table 14, amplification condition and is shown in Table 15.
It is clinically separated pathogenic strain testing result
100 plants of UP-M-PCR system specific detection collection of the present invention are clinically separated pathogenic strain, and aimed strain generates in advance
The band of phase size, non-targeted bacterial strain are generated without any non-specific band, and wherein clostridium botulinum is not received with C.perfringens
Collect clinical separation strain, is specifically shown in Table 16.
Part anus swab sample and 16 parts of food sample enrichment liquid testing results
To evaluate the ability that UP-M-PCR system of the present invention detects actual sample, to the 60 portions of doubtful foods collected from Disease Control and Prevention Center
Property bacterial disease anus in source wipes sample and from the collected 16 parts of food sample enrichment liquids of Suzhou food inspection using UP-M-PCR system
(amplification system and reaction condition are shown in Table 13 and 15) is detected, wherein there are 4 parts of testing results for sun in 60 parts of anus swab samples
Property, wherein there is 3 parts to detect containing C.perfringens, portion contains C.perfringens, Listeria monocytogenes and sand
Door Salmonella；There are 8 parts of detection Bacillus cereus, 7 parts of detection vibrio parahemolyticus, 4 parts of detections in 16 parts of food sample enrichment liquids
Yersinia enterocolitica, 3 parts of detection good fortune formula shigella dysenteriaes, 2 parts of detection enterorrhagia Bacillus coil 0157s, 2 parts of detection sramana
Salmonella.It will test the PCR product that result is positive sample and send to sequencing, sequencing result is also shown and aimed strain target-gene sequence
Unanimously, while to using existing People's Republic of China's inspection and quarantining for import/export professional standard primer pair positive sample it examines
It surveys, testing result is also consistent with UP-M-PCR system testing result of the present invention.
The amplification system of 13 UP-M-PCR of table
The each primer dosage of 14 chimeric primers mixed liquor of table
The reaction condition of 15 UP-M-PCR of table
Detection of 16 UP-M-PCR of table to 100 plants of clinical separation strains
With the development of the social economy, the food origin disease as caused by pathogenic bacteria has increasingly becomed global public health concern
Emphasis can all lead to sizable morbidity and mortality every year, cause huge financial burden.Detection method based on DNA
Such as PCR, testing result can be quickly obtained, greatly shortens clinical explosion time, has been developed in recent years for some food sources
The different detection methods of the based on PCR of pathogen.Traditional PCR method can not detect various pathogens simultaneously, multiplex PCR because
It can detect a variety of targets simultaneously becomes current most promising one of method, has been widely applied to food at present
In the detection of borne pathogen.The present invention have developed one kind can single tube and meanwhile detect 11 kinds of food-borne pathogens include sramana
Salmonella, listeria monocytogenes, Shigella flexneri, enterohemorrhagic escherichia coli O157, vibrio parahemolyticus, golden yellow Portugal
Grape coccus, comma bacillus, A type clostridium botulinum, Bacillus cereus, C.perfringens, yersinia enterocolitica by
The multiple PCR technique that consensus primer mediates.It can detect that various pathogens can save largely simultaneously by individually reacting
Time and efforts.For multiplex PCR, as long as optimizing PCR reaction condition for theoretically, so that it may it is anti-that multiplex PCR be continuously improved
Answer the quantity of primer pair in system, however in fact with the continuous improvement of primer pair quantity, can cause in succession primer dimer,
Primer mispairing, a series of technical problem such as primer amplification efficiency is different, primer size is difficult to differentiate between.Therefore, the invention
Property devise specific primer, while introducing consensus primer, by consensus primer be connected to the end of specific primer 5 ' constitute it is special
The consensus primer of high concentration and the chimeric primers of low concentration is added in sex-mosaicism primer simultaneously in multi-PRC reaction system.Entirely
The reaction of UP-MPCR system is carried out in two steps, and under high annealing temperature, the specific chimeric primer and template of low concentration expand the first step
Increase production the raw product containing consensus primer sequence；Second step, under low temperature thermal oxidation, the consensus primer of high concentration and the first round
PCR product continues to expand.In the multiplex PCR system that the present invention constructs, the dense of 11 pairs of specific chimeric primers pair is greatly reduced
Degree, wherein the specific chimeric primer dosage of Shigella flexneri is down to 0.025 μM, yersinia enterocolitica specific chimeric
Primer dosage highest also only to 0.3 μM, thus greatly reduces the interaction between primer pair, improves the inspection of multiplex PCR
Survey flux.The present invention is most important to the design of 11 kinds of pathogenic bacteria specific chimeric primers, decides UP-MPCR system detection side
The accuracy and reliability of method, each pair of primer of the invention only shows positive expansion to embodiment in the presence of target gene as the result is shown
Increasing, it was demonstrated that the specificity between oligonucleotides and its target illustrates that UP-MPCR system of the present invention embodies good specificity,
It is template or the random combination of two of pathogenic bacteria into two templates progress PCR amplification using single pathogenic bacteria, target gene amplifies mesh
Band, nothing but specific band generate.Further 100 plants of clinical bacteria separation strains of collection are detected, detection knot
Fruit also be actually consistent, purpose bacterial strain generates specific band, and non-purpose bacterial strain is generated without any non-specific band.It uses
The UP-MPCR system that the present invention constructs detects the bacterium gradient dilution liquid being incubated overnight, sensibility up to 102-
103Cfu/ml, it is sufficient to be applied in actually detected.UP-M-PCR system of the present invention is applied in actual sample and is detected,
60 parts of anus swab samples also have 4 parts to be detected the positive, 8 parts of detection Bacillus cereus in 16 parts of food sample enrichment liquids, and 7 parts
Detect vibrio parahemolyticus, 4 parts of detection yersinia enterocolitica, 3 parts of detection good fortune formula shigella dysenteriaes, 2 parts of detection enterohemorrhagics
Escherichia coli O 157,2 parts of detection salmonellas, positive amplification product sequencing result also demonstrate the reliability of result.
To sum up, detection of the multiple PCR technique of the invention mediated based on consensus primer for food-borne pathogens
Quickly, sensitive and high-throughput, for controlling the propagation of pathogenic microorganism, prevention food poisoning has great importance.
Sequence table
<110>University Of Suzhou
<120>a kind of multiple PCR reagent kit of the food-borne pathogens of detection common ten and its application
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>artificial sequence (Artificial)
<400> 1
actgtgttta ctactaga 18
<210> 2
<211> 40
<212> DNA
<213>artificial sequence (Artificial)
<400> 2
actgtgttta ctactagacg aaatggttat ggctctactc 40
<210> 3
<211> 40
<212> DNA
<213>artificial sequence (Artificial)
<400> 3
actgtgttta ctactagatg tgctaatgtt actgctggat 40
<210> 4
<211> 40
<212> DNA
<213>artificial sequence (Artificial)
<400> 4
actgtgttta ctactagact gctaatgtta ctgccgttga 40
<210> 5
<211> 40
<212> DNA
<213>artificial sequence (Artificial)
<400> 5
actgtgttta ctactagacc tcttgcatat tcttttgacc 40
<210> 6
<211> 39
<212> DNA
<213>artificial sequence (Artificial)
<400> 6
actgtgttta ctactagact gataacaatg acgcctctg 39
<210> 7
<211> 36
<212> DNA
<213>artificial sequence (Artificial)
<400> 7
actgtgttta ctactagaga gattccgctg ggtttg 36
<210> 8
<211> 37
<212> DNA
<213>artificial sequence (Artificial)
<400> 8
actgtgttta ctactagagc gtgtttgtgg tgaagcc 37
<210> 9
<211> 37
<212> DNA
<213>artificial sequence (Artificial)
<400> 9
actgtgttta ctactagagc acggagcgtt acgatgt 37
<210> 10
<211> 37
<212> DNA
<213>artificial sequence (Artificial)
<400> 10
actgtgttta ctactagagg tgaaggtgga atggttg 37
<210> 11
<211> 40
<212> DNA
<213>artificial sequence (Artificial)
<400> 11
actgtgttta ctactagagc ggtcctagtt agaattgaga 40
<210> 12
<211> 39
<212> DNA
<213>artificial sequence (Artificial)
<400> 12
actgtgttta ctactagatg gggagtaata ggttcgttt 39
<210> 13
<211> 37
<212> DNA
<213>artificial sequence (Artificial)
<400> 13
actgtgttta ctactagaat acccagcacc aagcatc 37
<210> 14
<211> 36
<212> DNA
<213>artificial sequence (Artificial)
<400> 14
actgtgttta ctactagatt ccgtgaacag gtcgct 36
<210> 15
<211> 38
<212> DNA
<213>artificial sequence (Artificial)
<400> 15
actgtgttta ctactagagg tcatttgctg tcactccc 38
<210> 16
<211> 39
<212> DNA
<213>artificial sequence (Artificial)
<400> 16
actgtgttta ctactagacc gtaagtggga aatctgtct 39
<210> 17
<211> 38
<212> DNA
<213>artificial sequence (Artificial)
<400> 17
actgtgttta ctactagatg gacgatgtga aatgagct 38
<210> 18
<211> 36
<212> DNA
<213>artificial sequence (Artificial)
<400> 18
actgtgttta ctactagagg gcaatacgca aagagg 36
<210> 19
<211> 37
<212> DNA
<213>artificial sequence (Artificial)
<400> 19
actgtgttta ctactagatt agccaagcct tgacgaa 37
<210> 20
<211> 38
<212> DNA
<213>artificial sequence (Artificial)
<400> 20
actgtgttta ctactagaaa agaagggtcg tcgttagg 38
<210> 21
<211> 38
<212> DNA
<213>artificial sequence (Artificial)
<400> 21
actgtgttta ctactagact tccagttggt ccagcata 38
<210> 22
<211> 38
<212> DNA
<213>artificial sequence (Artificial)
<400> 22
actgtgttta ctactagaca aaagaatgca agggcaca 38
<210> 23
<211> 40
<212> DNA
<213>artificial sequence (Artificial)
<400> 23
actgtgttta ctactagagt aagcaactcc aactacacga 40
<210> 24
<211> 18
<212> DNA
<213>artificial sequence (Artificial)
<400> 24
acctgacact attgaata 18
Claims (10)
1. detect a kind of common ten multiple PCR reagent kit of food-borne pathogens, including consensus primer, it is directed to food-borne pathogens
Chimeric primers；The sequence of the consensus primer is SEQ ID NO.1；The chimeric primers for food-borne pathogens are
Nucleotide sequence shown in SEQ ID NO.2 to SEQ ID NO.23.
2. detecting a kind of common ten multiple PCR reagent kits of food-borne pathogens according to claim 1, which is characterized in that
The PCR kit that the ten a kind of food-borne pathogens detection consensus primer mediates further include 2 × Taq master Mix,
Water.
3. a kind of multiple PCR reagent kit of food-borne pathogens of detection common ten described in claim 1 is utilizing multiplex PCR simultaneously
Detect a kind of the more of the food-borne pathogens of detection common ten described in application or the claim 1 in a kind of ten food-borne pathogens
Weight PCR kit is preparing the application in multiplex PCR while a kind of food-borne pathogens kit of detection ten.
4. application according to claim 3, which is characterized in that the temperature program of multiplex PCR is 95 DEG C of initial denaturation 5min；95
DEG C denaturation 30s, 66 DEG C of annealing 30s, 72 DEG C of annealing 45s, 72 DEG C of extension 3min totally 10 recycle；Then 95 DEG C of denaturation 30s, 53
DEG C annealing 30s, 72 DEG C of extensions 45s, totally 30 recycle；Last 72 DEG C of extensions 7min.
5. application according to claim 3, which is characterized in that multiplex PCR uses 25 microlitres of systems, wherein consensus primer
Final concentration of 1600nM, it is as follows for the final concentration of the chimeric primers pair of food-borne pathogens: 0.25 μ of 0.1 μM/μ of cbA L, CP
M/ μ L, VP 0.2 μM/μ L, VC, 0.2 μM/μ L, O157,0.2 μM/μ L, YER, 0.3 μM/μ L, SFL, 0.025 μM/μ L, LM 0.1
μM/Μ l, SA 0.06 μM/μ L, SP, 0.075 μM/μ L, BC, 0.15 μM/μ L.
6. ten a kind of food-borne pathogens multiplex PCR detection primers, including consensus primer, for the chimeric of food-borne pathogens
Primer；The sequence of the consensus primer is SEQ ID NO.1；The chimeric primers for food-borne pathogens are SEQ ID
Nucleotide sequence shown in NO.2 to SEQ ID NO.23.
7. ten a kind of food-borne pathogens multiplex PCR detection primer detection described in preparation claim 1 described in claim 6
Application in a kind of common ten multiple PCR reagent kit of food-borne pathogens.
8. ten a kind of food-borne pathogens multiplex PCR detection primers described in claim 6 are detecting ten using multiplex PCR simultaneously
A kind of application in food-borne pathogens.
9. it is a kind of using a kind of ten methods of food-borne pathogens in multiplex PCR simultaneously testing product, extract product base to be detected
Because group DNA is as template, PCR being carried out in the presence of chimeric primers are with consensus primer and is reacted, carrying out electrophoretic analysis to PCR product is
Complete the detection of food-borne pathogens ingredient in product；The sequence of the consensus primer is SEQ ID NO.1；The chimeric primers
For nucleotide sequence shown in SEQ ID NO.2 to SEQ ID NO.23.
10. a kind of ten methods of food-borne pathogens in multiplex PCR while test sample are utilized according to claim 9,
It is characterized in that, the temperature program of multiplex PCR is 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 66 DEG C of annealing 30s, 72 DEG C are annealed
45s, 72 DEG C of extension 3min are recycled for 10 totally；Then 95 DEG C of denaturation 30s, 53 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 30
Circulation；Last 72 DEG C of extensions 7min；Multiplex PCR uses 25 microlitres of systems, wherein the final concentration of 1600nM of consensus primer, for
The final concentration of the chimeric primers pair of food-borne pathogens is as follows: cbA 0.1 μM/μ L, CP, 0.25 μM/μ L, VP, 0.2 μM/μ L, VC
0.2 μM/μ L, O157,0.2 μM/μ L, YER, 0.3 μM/μ L, SFL, 0.025 μM/μ L, LM, 0.1 μM/Μ l, SA, 0.06 μM/μ L,
SP 0.075 μM/μ L, BC, 0.15 μM/μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910539501.XA CN110512008B (en) | 2019-06-20 | 2019-06-20 | Multiplex PCR (polymerase chain reaction) kit for detecting eleven common food-borne pathogenic bacteria and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910539501.XA CN110512008B (en) | 2019-06-20 | 2019-06-20 | Multiplex PCR (polymerase chain reaction) kit for detecting eleven common food-borne pathogenic bacteria and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110512008A true CN110512008A (en) | 2019-11-29 |
| CN110512008B CN110512008B (en) | 2022-04-15 |
Family
ID=68622441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910539501.XA Active CN110512008B (en) | 2019-06-20 | 2019-06-20 | Multiplex PCR (polymerase chain reaction) kit for detecting eleven common food-borne pathogenic bacteria and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110512008B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111560448A (en) * | 2020-04-21 | 2020-08-21 | 江苏省家禽科学研究所 | Method for detecting 4 common food-borne pathogenic bacteria in poultry by high-resolution dissolution curve technology |
| CN112195258A (en) * | 2020-10-26 | 2021-01-08 | 贵州省畜牧兽医研究所 | Multiple PCR detection kit for various pathogenic bacteria of waterfowl and application thereof |
| CN113151515A (en) * | 2021-03-31 | 2021-07-23 | 广东产品质量监督检验研究院（国家质量技术监督局广州电气安全检验所、广东省试验认证研究院、华安实验室） | Detection kit and detection method for food-borne pathogenic bacteria |
| CN114277170A (en) * | 2022-02-17 | 2022-04-05 | 重庆市计量质量检测研究院 | Primers and kit for multiple PCR detection of ten food-borne pathogenic bacteria |
| CN114381536B (en) * | 2022-01-21 | 2024-05-17 | 江西省检验检测认证总院食品检验检测研究院 | Multiplex PCR detection primer group, kit and method for five food-borne pathogens |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101591704A (en) * | 2009-03-20 | 2009-12-02 | 郑秋月 | The detection kit of three kinds of spore production bacterias and detection method thereof in the food |
| CN102851356A (en) * | 2012-03-22 | 2013-01-02 | 冯家望 | Composite gene chip and method for detection of fourteen common pathogenic bacteria |
| CN103074450A (en) * | 2013-01-25 | 2013-05-01 | 海尔施生物医药股份有限公司 | Kit for synchronously detecting thirty diarrhea pathogens and detection method of kit |
| CN103484546A (en) * | 2013-09-17 | 2014-01-01 | 北京卓诚惠生生物科技有限公司 | Fourteen-food-borne pathogenic bacterium multiplex PCR detection primer set and kit |
| CN103981278A (en) * | 2014-06-06 | 2014-08-13 | 黑龙江出入境检验检疫局检验检疫技术中心 | PCR (polymerase chain reaction)-detection-based universal primer pair for detecting multiple pathogens by using Tem-PCR technique |
| CN105525031A (en) * | 2016-03-08 | 2016-04-27 | 南京美宁康诚生物科技有限公司 | Multiple PCR detection kit for 11 intestinal pathogen nucleic acid and application of detection kit |
| CN105734164A (en) * | 2016-05-06 | 2016-07-06 | 苏州大学 | Multiplex PCR kit for detecting bacterial meningitis pathogens |
-
2019
- 2019-06-20 CN CN201910539501.XA patent/CN110512008B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101591704A (en) * | 2009-03-20 | 2009-12-02 | 郑秋月 | The detection kit of three kinds of spore production bacterias and detection method thereof in the food |
| CN102851356A (en) * | 2012-03-22 | 2013-01-02 | 冯家望 | Composite gene chip and method for detection of fourteen common pathogenic bacteria |
| CN103074450A (en) * | 2013-01-25 | 2013-05-01 | 海尔施生物医药股份有限公司 | Kit for synchronously detecting thirty diarrhea pathogens and detection method of kit |
| CN103484546A (en) * | 2013-09-17 | 2014-01-01 | 北京卓诚惠生生物科技有限公司 | Fourteen-food-borne pathogenic bacterium multiplex PCR detection primer set and kit |
| CN103981278A (en) * | 2014-06-06 | 2014-08-13 | 黑龙江出入境检验检疫局检验检疫技术中心 | PCR (polymerase chain reaction)-detection-based universal primer pair for detecting multiple pathogens by using Tem-PCR technique |
| CN105525031A (en) * | 2016-03-08 | 2016-04-27 | 南京美宁康诚生物科技有限公司 | Multiple PCR detection kit for 11 intestinal pathogen nucleic acid and application of detection kit |
| CN105734164A (en) * | 2016-05-06 | 2016-07-06 | 苏州大学 | Multiplex PCR kit for detecting bacterial meningitis pathogens |
Non-Patent Citations (2)
| Title |
|---|
| 崔晓燕等: "食源性致病菌多重聚合酶链反应快速检测", 《现代预防医学》 * |
| 郑秋月: "热加工食品和水产品中致病菌检测技术体系建立", 《中国博士学位论文全文数据库 工程科技I辑》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111560448A (en) * | 2020-04-21 | 2020-08-21 | 江苏省家禽科学研究所 | Method for detecting 4 common food-borne pathogenic bacteria in poultry by high-resolution dissolution curve technology |
| CN112195258A (en) * | 2020-10-26 | 2021-01-08 | 贵州省畜牧兽医研究所 | Multiple PCR detection kit for various pathogenic bacteria of waterfowl and application thereof |
| CN112195258B (en) * | 2020-10-26 | 2023-10-13 | 贵州省畜牧兽医研究所 | Multiplex PCR detection kit for multiple pathogenic bacteria of waterfowl and application thereof |
| CN113151515A (en) * | 2021-03-31 | 2021-07-23 | 广东产品质量监督检验研究院（国家质量技术监督局广州电气安全检验所、广东省试验认证研究院、华安实验室） | Detection kit and detection method for food-borne pathogenic bacteria |
| CN114381536B (en) * | 2022-01-21 | 2024-05-17 | 江西省检验检测认证总院食品检验检测研究院 | Multiplex PCR detection primer group, kit and method for five food-borne pathogens |
| CN114277170A (en) * | 2022-02-17 | 2022-04-05 | 重庆市计量质量检测研究院 | Primers and kit for multiple PCR detection of ten food-borne pathogenic bacteria |
| CN114277170B (en) * | 2022-02-17 | 2024-02-13 | 重庆市计量质量检测研究院 | Primer and kit for detecting nine food-borne pathogenic bacteria through multiplex PCR (polymerase chain reaction) |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110512008B (en) | 2022-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110512008A (en) | Detect multiple PCR reagent kit and its application of a kind of common ten food-borne pathogens | |
| Kosoy et al. | Identification of Bartonella infections in febrile human patients from Thailand and their potential animal reservoirs | |
| Tee et al. | Atypical campylobacters associated with gastroenteritis | |
| CN104611466B (en) | A kind of molecular agents box of three kinds of piglet virus diarrheas of quick discriminating and application | |
| CN103320535B (en) | Method for identifying wild strain and vaccine strain of hog cholera virus | |
| CN106399486B (en) | The primer sets and kit for causing diarrhea helminth are detected for multiplex PCR | |
| CN109735508A (en) | New bacteriophage, its composition and their preparation method and application | |
| Houng et al. | Development of a ceuE-based multiplex polymerase chain reaction (PCR) assay for direct detection and differentiation of Campylobacter jejuni and Campylobacter coli in Thailand | |
| CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
| CN113583973A (en) | High-lytic Klebsiella pneumoniae RDP-KP-20007 and application thereof | |
| Callens et al. | Highly sensitive detection of swine vesicular disease virus based on a single tube RT-PCR system and DIG-ELISA detection | |
| Li et al. | Vancomycin-modified poly-l-lysine magnetic separation combined with multiplex polymerase chain reaction assay for efficient detection of Bacillus cereus in milk | |
| CN103088039A (en) | Amplification method of porcine epidemic diarrhea virus S-gene epitope | |
| CN106834308A (en) | The preparation method and applications of Rofe source of fish Streptococcusagalactiae recombinant C BP protein vaccines | |
| Park et al. | Molecular detection and characterization of unclassified bovine enteric caliciviruses in South Korea | |
| Møller et al. | Comparison of Toxicity Neutralization-, ELISA-and PCR Tests for Typing ofClostridium perfringensand Detection of the Enterotoxin Gene by PCR | |
| CN107653230A (en) | A kind of II type pseudoabies poison strain and its application | |
| CN108559790A (en) | The kit and its application method of three kinds of respiratory pathogens are detected based on micro-fluidic chip | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN107304416A (en) | One plant of Porcine epidemic diarrhea virus and its cultural method and application | |
| CN108251547A (en) | The IC-PCR detection primers group of klebsiella pneumoniae and its application | |
| Xu et al. | Development and application of DETECTR-based rapid detection for pathogenic Bacillus anthracis | |
| CN108103152A (en) | A kind of Listonella anguillarum rapid detection method | |
| CN101423874B (en) | Foot-and-mouth disease virus multiple RT-PCR detection kit, preparation method thereof and application | |
| Nakamura et al. | Usefulness of a combination of pulsed-field gel electrophoresis and enrichment culture in laboratory investigation of a foodborne outbreak due to Clostridium perfringens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |