CN105132350B - The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application - Google Patents
The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application Download PDFInfo
- Publication number
- CN105132350B CN105132350B CN201510638456.5A CN201510638456A CN105132350B CN 105132350 B CN105132350 B CN 105132350B CN 201510638456 A CN201510638456 A CN 201510638456A CN 105132350 B CN105132350 B CN 105132350B
- Authority
- CN
- China
- Prior art keywords
- rfbb
- rffg
- gene
- salmonella typhimurium
- pya4278
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention provides one plant of attenuated salmonella typhimuriumSalmonella Typimurium S496, it is characterised in that the attenuated salmonella typhimuriumSalmonella Typimurium S496 missings are ownrfbBGene andrffGGene；WillpagLGene replaces with have changed SD sequences and initiation codon containing arabinose regulating and controlling sequencerfbBGene, it is described to have changed SD sequences and initiation codon containing arabinose regulating and controlling sequencerfbBThe nucleotide sequence of gene is as shown in SEQ ID No.1；The Classification And Nomenclature of the attenuated strain isSalmonella Typimurium S496, China typical culture collection center is preserved in, preserving number is CCTCC M 2015562, and the preservation time is：On September 21st, 2015.Present invention also offers a kind of construction method of attenuated salmonella typhimurium.Application of the attenuated strain built invention also provides above-mentioned bacterial strains or by above-mentioned construction method on vaccine.
Description
Technical field
The invention belongs to gene engineering technology field, it is related to construction method and its institute of a kind of attenuated salmonella typhimurium
Obtain bacterial strain and application；A kind of more particularly to Typhic Salmonella lines for regulating and controlling LPS and ECA synthesis simultaneously with arabinose
And its construction method.
Background technology
Lipopolysaccharides（Lipopolysaccharide, LPS）It is the important virulence factor of bacterium, it is directly connected to cause of disease
Infection ability of the bacterium to body.And enterobacteria common antigen (Enterobacterial Common Antigen, ECA) is intestines bar
The jointly owned glycolipid structure of bacterium family member, in different bacteriums to host body sour environment, cholate resistance, purulence
Blister formation, virulence etc. play an important role, and also contribute to infection ability of the pathogen to body.There are some researches show cut
O antigens and prevention O antigens express the Critical policies for being used as living salmonella vaccine attenuation in vivo on disconnected salmonella LPS,
Good attenuating effects can be reached.In salmonella typhimurium, ECA is in bacterium to host body cholate resistance and virulence side
Face plays key player.The blocking of salmonella typhimurium LPS and ECA synthesis, can cause bacterium to be effectively attenuated.
In general, one plant of preferable salmonella vaccine or carrier should be kept while attenuation with wild strain phase
When resistance host gastrointestinal tract acid, cholate and adhesion, intrusion gut associated lymphoid tissue and deep lymphoid tissue ability.
However, for salmonella typhimurium, individually lackrfbBGene orrffGGene, not only attenuating effects are not
It is fully up to expectations, it is often more important that if LPS or ECA biosynthesis blocks, attenuated strain is to the resistance from host body survival pressure
Power will decline, and then have a strong impact on bacterial immune response level；And ifrfbBWithrffGAfter Gene Double missing, LPS and ECA
It can not synthesize, bacterium can more be severely impacted to the resistance from host body survival pressure.
Therefore, how while being effectively attenuated to mouse salmonella, it is maintained to press being survived from host body
The resistance of power, it is research puzzle urgently to be resolved hurrily.
The content of the invention
In view of the shortcomings of the prior art, it is an object of the invention to provide one plant of attenuated salmonella typhimuriumSalmonella Typimurium S496, it is characterised in that the attenuated salmonella typhimuriumSalmonella
Typimurium S496 missings are ownrfbBGene andrffGGene；WillpagLGene replaces with regulates and controls sequence containing arabinose
Row have changed SD sequences and initiation codonrfbBGene, it is described to have changed SD sequences containing arabinose regulating and controlling sequence
With initiation codonrfbBThe nucleotide sequence of gene is as shown in SEQ ID No.1；The Classification And Nomenclature of the attenuated strain isSalmonella Typimurium S496, the China typical culture collection center for being preserved in wuchang, wuhan Luo Jia Shan are (military
Chinese university), preserving number is CCTCC M 2015562, and the preservation time is：On September 21st, 2015.
Second object of the present invention is to provide a kind of construction method of attenuated salmonella typhimurium, and its feature exists
In the construction method comprises the following steps：
1）The methods of homologous recombination mediated using suicide plasmid, by salmonella typhimurium bacterial genomesrfbBBase
Cause andrffGGene knockout, do not containedrfbBGene andrffGThe mutant strain of gene；
2）Obtained using PCR TRAPs and have changed SD sequences and initiation codon containing arabinose regulating and controlling sequencerfbBGene, then will have changed SD sequences and initiation codon containing arabinose regulating and controlling sequence with homologous recombination methodrfbB
Gene orrffGGene nothing to do with gene is replaced；Obtain available arabinose while regulate and control subtracting for bacterium LPS and ECA synthesis
Malicious salmonella typhimurium.
In salmonella typhimurium,RfbB and rffGGene is located at O antigen gene clusters and ECA respectivelyrffGene cluster
On, encode identical gene outcome dTDP-D- glucose -4,6- dehydratases.
The present inventor gropes by many experiments, finds to synthesize in salmonella typhimurium LPS and ECA first
Cheng Zhong,RfbB and rffGThe function of gene being capable of complete complementary.rfbBWithrffGThe single missing of gene has no effect on bacterium LPS
With ECA synthesis.Therefore, first salmonella typhimurium can be had by oneselfRfbB and rffGGene carries out missing processing, then inserts
Enter PCR amplification synthesisrfbBOrrffGGene, by way of regulating and expressing, cultivation stage adds arabinose in vitro,rfbBOrrffGGene normal expression so that bacterium possesses the resistance host existence as wild strain initial stage in infection host
The ability of pressure.After bacterial colonization host body, due to the shortage of internal arabinose,rfbBOrrffGGene no longer table
Reach, blocked bacterium LPS and ECA synthesis, virulence is significantly reduced.
It is described to have changed SD sequences and initiation codon containing arabinose regulating and controlling sequencerfbBThe nucleotides of gene
Sequence is as shown in SEQ ID No.1.
What deserves to be explained is the present inventor is found that firstRfbB and rffGThe function of gene can be completely mutual
Mend.Under this conclusion, it is readily appreciated that, no matter had by oneself in missing bacteriumrfbBStillrffGGene and then insertion change
SD sequences and initiation codonrfbBGene orrffGGene, the technique effect of gained is the same.
The independent basis is because including pagLGene,lpxRGene,relAGene etc..The deletion of these genes is to detection of Salmonella
Toxic effect is small, and the synthesis with O- antigens is also unrelated.
Preferably, the methods of homologous recombination of the suicide plasmid mediation comprises the following steps：
（1）Build suicide plasmid pYA4278-rfbBAnd pYA4278-rffG；
（2）By step（1）Gained suicide plasmid is transformed into λpirEscherichia coli, and engaged naturally with salmonella, make
Homologous fragment imports salmonella gene group, by first time exchange and Cm+ resistance screenings, obtains positive colony；
（3）Positive colony is cultivated, spontaneous mutation is brought it about and produces secondary exchange, with the Screening of Media containing sucrose,
Obtain to antibiotic sensitive and to the clone of sucrose resistance；
（4）Screened and be free of by PCRrfbBWithrffGThe mutant strain of gene.
The suicide plasmid pYA4278-rfbBAnd pYA4278-rffGConstruction step it is as follows：
ContainrfbBThe suicide plasmid pYA4278- of gene upstream and downstream homology armrfbBStructure：
Salmonella typhimurium UK-1 whole genome sequences, Serial No. are derived from according to what Genbank was announced：
CP002614, designrfbBThe upstream and downstream homology arm of gene, with Vecter NTI Software for Design following primers：
DrfbB-1F: 5’ CATAGAGCAGCTTTTGCATG 3’
DrfbB-1R: 5’ GTCCTTCATATTTTCTATTCCATAAGGCGTA 3’
DrfbB-2F: 5’ GAATAGAAAATATGAAGGACGCCAGTAATG 3’
DrfbB-2R: 5’ GCGAAATTATTGCCCTTACC 3’
Extraction, as template, is expanded with upstream and downstream homology arm primer respectively in exponential phase S100 genomic DNAs
Increase, obtain the amplified production of its upstream and downstream homology arm, recovery product carries out fusion DNA vaccine amplification, i.e., with primer DrfbB- 1F and
DrfbB- 2R is expanded, and the upstream and downstream homology arm amplified production merged, then use+A reaction kits enter in fragment ends
Row+A processing, and withAhdPYA4278 digestion products are obtained after I digestions to be attached in the presence of T4 ligases, and are converted
Enter λpirIn Escherichia coli, recombinant plasmid pYA4278- is obtainedrfbB；By recombinant plasmid transformed to the λ for needing DAP to growpirTo carry out the structure of follow-up mutant strain in Escherichia coli；
ContainrffGThe suicide plasmid pYA4278- of gene upstream and downstream homology armrffGStructure：
Salmonella typhimurium UK-1 whole genome sequences, Serial No. are derived from according to what Genbank was announced：
CP002614, designrffGThe upstream and downstream homology arm of gene, with Vecter NTI Software for Design following primers：
DrffG-1F: 5’ CGACGGCAAACCGCACTGGG 3’
DrffG-1R: 5’ CTGCCGTTTATCAGCGCCAGACTCCTTTGG 3’
DrffG-2F: 5’ CTGGCGCTGATAAACGGCAGGTTCTTACTC 3’
DrffG-2R: 5’ GCGTTGCCACGCCTGCAGTG 3’
Extraction, as template, is expanded with upstream and downstream homology arm primer respectively in exponential phase S100 genomic DNAs
Increase, obtain the amplified production of its upstream and downstream homology arm, recovery product carries out fusion DNA vaccine amplification, i.e., with primer DrffG- 1F and
DrffG- 2R is expanded, and the upstream and downstream homology arm amplified production merged, then use+A reaction kits enter in fragment ends
Row+A processing, and withAhdPYA4278 digestion products are obtained after I digestions to be attached in the presence of T4 ligases, and are converted
Enter λpirIn Escherichia coli, recombinant plasmid pYA4278- is obtainedrffG；By recombinant plasmid transformed to the λ for needing DAP to growpirTo carry out the structure of follow-up mutant strain in Escherichia coli.
Recombinate suicide plasmid to survive due to that can not replicate in salmonella, the λ of restructuring suicide plasmid will be transferred topirLarge intestine
Bacillus engages naturally with salmonella, homologous fragment is imported salmonella gene group, and by homologous recombination, by first
Secondary exchange and resistance screening（Cm+Resistance）, positive colony is obtained, then cultivates positive colony, brings it about spontaneous mutation generation
Secondary exchange, with the Screening of Media containing sucrose, obtain to antibiotic sensitive and to the clone of sucrose resistance, last PCR's
Method screens to obtain mutant strain.With the method for homologous recombination, our structures obtain Typhic Salmonella lines S100
∆rfbB ∆rffG。
Preferably, the independent basis becausepagLGene.
Preferably, step 2）In, using have changed SD sequences and initiation codonrfbBGene.
Preferably, step 2）In specific method be：
Salmonella typhimurium UK-1 whole genome sequences, Serial No. are derived from according to what Genbank was announced：
CP002614, design expand different SD sequences and initiation codonrfbBGene primer, with Vecter NTI Software for Design
Following primer：
ara rfbB-F1：5’ CCGCTCGAGAGGAGTCATTGTGAAGATACTTATTACTGG
CGGG 3’
ara rfbB-F2：5’ CCGCTCGAGAGGAGTCATTATGAAGATACTTATTACTGG
CGGG3’
ara rfbB-F3: 5’ CCGCTCGAGGGAAGTCATTATGAAGATACTTATTACTGG
CGGG 3’
ara rfbB-F4: 5’ CCGCTCGAGGGAAGTCATTGTG AAGATACTTATTACTGG
CGGG 3’
ara rfbB-R: 5’ CCGGAATTCCTGCAGGTTACTGGCGTCCTTCATAGTTCTG
3’
By what is amplifiedrfbBGenetic fragment and plasmid pYA3700（Regulating and controlling sequence containing arabinosearaC PBAD）Use enzymeXhoI、EcoRAfter I double digestions, it is attached, converts, willrfbBGenetic fragment is connected to sequence TTaraC PBADAfterwards, obtain
Recombinant plasmid pYA3700-rfbB。
With plasmid pYA3700-rfbBFor template, with primer T4 and ara rfbB- R expands TTaraC PBAD rfbBFragment,
The primer is as follows：
T4: ATGCGGCCGCAGATCTTTTATTATTCTATCC
ara rfbB-R: CCGGAATTCCTGCAGGTTACTGGCGTCCTTCATAGTTCTG
The TT that will be amplifiedaraCPBAD rfbBFragment and laboratory preserve plasmid pYA4278- ΔspagLUse restriction enzyme
EnzymeNotI、sbfAfter I carries out double digestion, it is attached, converts.Obtain recombinating suicide plasmid pYA4278- ΔspagL-TT araC
PBAD rfbB。
Restructuring suicide plasmid pYA4278- Δs will be transferred topagL-TT araC PBAD rfbBλpirEscherichia coli and missing
Strain S100 (ΔsrfbBΔrffG) engage naturally, homologous fragment is imported salmonella gene group, and pass through homologous recombination, warp
Cross exchange and resistance screening for the first time（Cm+Resistance）, positive colony is obtained, then cultivates positive colony, is brought it about spontaneous prominent
Become and produce secondary exchange, with the Screening of Media containing sucrose, obtain to antibiotic sensitive and to the clone of sucrose resistance, finally
PCR method screens to obtain mutant strain.With the method for homologous recombination, our structures have obtained one plant of attenuated Salmonella typhinaurium sramana
SalmonellaSalmonella typimurium S496。
It is based onrfbBWithrffGThe characteristic that gene can replace mutually, added in salmonella typhimurium culture medium 0.1% Ah
Uncle's sugar is drawn,rfbBGene normal expression, regulate and control mutant strain S100 (ΔsrfbBΔrffGΔpagL::TT araC PBAD rfbB) as
Parent plant equally synthesizes complete LPS and ECA structures.Arabinose is not added in culture medium, then bacteriumrfbBGene is not expressed,
And then bacterium LPS and ECA synthesis has been blocked simultaneously.
Present invention also offers attenuated salmonella typhimuriumSalmonella Typimurium S496 are on vaccine
Using.
Beneficial effects of the present invention：
1）Gained attenuated strain lacksrfbBWithrffGGene, there are outstanding attenuating effects；
2）Obtained strains can regulate and control bacterium LPS and ECA synthesis simultaneously with arabinose, possess supporting as wild strain
The ability of anti-host's survival pressure；The present invention uses arabinose regulating strategy, and cultivation stage adds arabinose in vitro, carefully
Bacterium normally synthesizes LPS and ECA, keeps survival pressure and colonization ability in the resistance host suitable with wild strain；Bacterial colonization
After host body, due to the shortage of arabinose in body, bacterium LPS and ECA synthesis block, and bacterium is effectively attenuated, and then produce
Grow long and lasting immune response；Under conditions of arabinose is lacked, after bacterial outer membrane LPS and ECA synthesis block, carefully
Bacterium outer membrane can be reset, and due to being not present for both structures, bacterium can expose more outer membrane proteins, and then produce more
Good immune protective effect.
Brief description of the drawings
Fig. 1 identifies electrophoretogram for the related PCR of the present invention, wherein, A is S100 Δs in the present inventionrfbBThe PCR mirror of mutant strain
Determine electrophoresis result, M represents MarkerIII, and 1, which represents mutant strain 2, represents wild strain；B is S100 Δs in the present inventionrffGMutant strain
PCR identification electrophoresis results, M represents MarkerIII, and 1, which represents mutant strain 2, represents wild strain；C is S100 Δs in the present inventionrfbBΔrffGThe PCR identification electrophoresis results of mutant strain, M represent MarkerIII, and 1 and 3 represent mutant strain, and 2 and 4 represent wild
Strain；
In Fig. 2, A is S100 Δs in the present inventionrfbB、S100ΔrffGWith S100 ΔsrfbBΔrffGThe LPS tables of mutant strain
Type, 1 in figure:S100,2: S100ΔrfbB, 3: S100ΔrffG, 4: S100ΔrfbBΔrffG；B is in the present invention
S100ΔrfbB、S100ΔrffGWith S100 ΔsrfbBΔrffGThe ECA phenotypes of mutant strain, 1 in figure:S100,2: S100ΔrfbB, 3: S100ΔrffG, 4: S100ΔrfbBΔrffG；
In Fig. 3, A is S100 ΔsrfbBΔrffGMutant strain LPS covers phenotype；1 in figure:S100,2: S100ΔrfbB
ΔrffG , 3: S100ΔrfbBΔrffG+“15A-rfbB", 4: S100ΔrfbBΔrffG+“15A-rffG", B is S100
ΔrfbBΔrffGMutant strain ECA covers phenotype, 1 in figure:S100,2: S100ΔrfbBΔrffG, 3: S100ΔrfbBΔrffG+“15A-rfbB", 4: S100ΔrfbBΔrffG+“15A-rffG”；
Fig. 4 is S100 (ΔsrfbBΔrffGΔpagL::TT araC PBAD rfbB) arabinose regulation and control strain PCR identification
Electrophoresis result；
In Fig. 5, A is S100 (ΔsrfbBΔrffGΔpagL::TT araC PBAD rfbB) arabinose regulation and control strain LPS
Regulate and control phenotype, 1 and 10 represent S100 in figure；2 and 3 represent S494；4 and 5 represent S495；6 and 7 represent S496；8 and 9 represent
S497；B is S100 (ΔsrfbBΔrffGΔpagL::TT araC PBAD rfbB) arabinose regulation and control strain ECA regulation and control phenotype,
1 represents S100 in figure；2 and 3 represent S494；4 and 5 represent S495；6 and 7 represent S496；8 and 9 represent S497.
Embodiment
The present invention is specifically described below by embodiment, it is necessary to it is pointed out here that be following examples simply use
It is further detailed in the present invention, it is impossible to be interpreted as limiting the scope of the invention, the field is skilled in technique
Some nonessential modifications and adaptations that personnel are made according to foregoing invention content, still fall within protection scope of the present invention.
Embodiment 1
1、∆rfbBDesign of primers
Salmonella typhimurium UK-1 whole genome sequences are derived from according to what Genbank was announced（Sequence number：
CP002614）, design two pairs of primers and expand respectivelyrfbBThe upstream and downstream homology arm of gene, amplified fragments size are respectively 410
Bp, 497 bp, above-mentioned primer synthesize by Beijing Huada gene company, and primer sequence is as follows：
DrfbB-1F：5’ CATAGAGCAGCTTTTGCATG3’
DrfbB-1R：5’ GTCCTTCATATTTTCTATTCCATAAGGCGTA3’
DrfbB-2F：5’ GAATAGAAAATATGAAGGACGCCAGTAATG3’
DrfbB-2R：5’ GCGAAATTATTGCCCTTACC3’
2、rfbBThe amplification and fusion of the upstream and downstream homology arm of gene
Picking salmonella typhimurium S100 single bacteriums fall within 5 mL LB fluid nutrient mediums and be incubated overnight (37 DEG C,
180rpm), carried out with the bacterial genomes extraction agent box of Tiangeng biochemical technology Co., Ltd, operating procedure to specifications
Genome extracts.
Pcr amplification reaction is carried out in 50 μ L system, and reaction system is as follows：Template DNA 1 μ L, 2 × primeSTAR
Max (precious biological Co., Ltd) 25 μ L, the μ L of sense primer 1, sense primer 1 μ L, ddH2O 22 μL。
Amplification condition is：Entering circulation after 94 DEG C of denaturation 2min, loop parameter is 94 DEG C of 10 sec, 55 DEG C of 15 sec,
72℃ 10 sec.After 30 circulations, 72 DEG C of extension 8min.The PCR primer of amplification is analyzed through 1% agarose gel electrophoresis, is expanded
It is respectively 410 bp and 497 bp to increase two clip sizes, is consistent with expected size.
The fusion of upstream and downstream homology arm：By upstream and downstream homology arm according to molal quantity 1:1 ratio, total template amount are 2 μ L
Template is expanded as PCR, utilizes primer DrfbB- 1F and DrfbB- 2R is carried out under system as before and amplification condition
Amplification, obtain fusion fragment of the size for 900bp or so.
、pYA4278-rfbThe structure of B suicide plasmids
Will fusion fragment progress+A processing.Utilize the plus A reaction kits of Tiangeng biochemical technology Co., Ltd, reaction
System is：The μ L of 15 μ L, plus A buffer of template, 4 μ L, Taq enzymes 1；Reaction condition is：72℃ 30min.
The preparation of suicide plasmid pYA4278 endonuclease bamhis：WithAhdI digestion pYA4278 plasmids, go out T by plasmid fragments digestion
Cohesive end, recovery carrier pYA4278.
The fusion fragment of+A processing is connected with the pYA4278 plasmids after digestion with T4 DNA ligase, 16 DEG C of water
Bath overnight, converts λpirCompetent escherichia coli cell, treat that it grows laggard performing PCR identification, obtain positive restructuring suicide plasmid
pYA4278-rfbB.The handsome Bioisystech Co., Ltd in Shanghai will be sent to after plasmid extraction to be sequenced, it was demonstrated that the suicide of structure
Plasmid is correct.
、S100ΔrfbBThe structure of mutant strain and identification
The restructuring suicide plasmid pYA4278- that will be builtrfbBConvert to λpirIn coli strain（The bacterial strain lacks
asdGene is, it is necessary to which DAP can grow, for subsequently engaging the screening of transfer）, suicide plasmid pYA4278- will be carriedrfbBλpirEscherichia coli carry out engagement transfer with salmonella typhimurium S100, are screened on the LB flat boards of chlorampenicol resistant
Positive bacterium colony, positive bacterium colony is cultivated to propagation in the LB fluid nutrient mediums without chlorampenicol resistant, sieved on 10% sucrose plate
The bacterium colony of resistance to sucrose is selected, and picking single bacterium colony enters performing PCR identification.
Identification：Using bacterium colony to be checked as template, with primer DrfbB-1F/DrfbB- 2R enters performing PCR amplification.Bacterial strain lacksrfbB
Afterwards, primer DrfbB-1F/DrfbB- 2R amplified productions size merges homology armrfbB- UD sizes (897 bp).If do not lack
Successful then PCR primer stripe size is 1974 bp.As a result, gene-deleted strain PCR identifies that stripe size is consistent with theory, showsrfbB
Gene-deleted strain successfully constructs.Mutant strain is named as S100 ΔsrfbB, such as Figure 1A.
Embodiment 2
1、∆rffGDesign of primers
Salmonella typhimurium S100 whole genome sequences are derived from according to what Genbank was announced（Sequence number：
CP002614）, design two pairs of primers and expand respectivelyrffGThe upstream and downstream homology arm of gene, amplified fragments size are respectively 398
Bp, 376bp, above-mentioned primer synthesize by Beijing Huada gene company, and primer sequence is as follows：
DrffG-1F：5’ CGACGGCAAACCGCACTGGG3’
DrffG-1R：5’ CTGCCGTTTATCAGCGCCAGACTCCTTTGG3’
DrffG-2F：5’ CTGGCGCTGATAAACGGCAGGTTCTTACTC3’
DrffG-2R：5’ GCGTTGCCACGCCTGCAGTG3’
2、rffGThe amplification and fusion of the upstream and downstream homology arm of gene
Picking salmonella typhimurium S100 single bacteriums fall within 5 mL LB fluid nutrient mediums and be incubated overnight (37 DEG C,
180rpm), carried out with the bacterial genomes extraction agent box of Tiangeng biochemical technology Co., Ltd, operating procedure to specifications
Genome extracts.
Pcr amplification reaction is carried out in 50 μ L system, and reaction system is as follows：Template DNA 1 μ L, 2 × primeSTAR
Max (precious biological Co., Ltd) 25 μ L, the μ L of sense primer 1, sense primer 1 μ L, ddH2O 22μL。
Amplification condition is：Entering circulation after 94 DEG C of denaturation 2min, loop parameter is 94 DEG C of 10 sec, 55 DEG C of 15 sec,
72℃ 10 sec.After 30 circulations, 72 DEG C of extension 8min.The PCR primer of amplification is analyzed through 1% agarose gel electrophoresis, is expanded
It is respectively 398 bp and 376 bp to increase two clip sizes, is consistent with expected size.
The fusion of upstream and downstream homology arm：By upstream and downstream homology arm according to molal quantity 1:1 ratio, total template amount are 2 μ L
Template is expanded as PCR, utilizes primer DrffG- 1F and D rffG- 2R is carried out under system as before and amplification condition
Amplification, obtain fusion fragment of the size for 764bp or so.
、pYA4278-rffGThe structure of suicide plasmid
Will fusion fragment progress+A processing.Utilize the plus A reaction kits of Tiangeng biochemical technology Co., Ltd, reaction
System is：The μ L of 15 μ L, plus A buffer of template, 4 μ L, Taq enzymes 1；Reaction condition is：72℃ 30min.
The preparation of suicide plasmid pYA4278 endonuclease bamhis：WithAhdI digestion pYA4278 plasmids, plasmid fragments digestion is gone out
T cohesive ends, recovery carrier pYA4278.
The fusion fragment of+A processing is connected with the pYA4278 plasmids after digestion with T4 DNA ligase, 16 DEG C of water
Bath overnight, converts λpirCompetent escherichia coli cell, treat that it grows laggard performing PCR identification, obtain positive restructuring suicide plasmid
pYA4278-rffG.The handsome Bioisystech Co., Ltd in Shanghai will be sent to after plasmid extraction to be sequenced, it was demonstrated that the suicide of structure
Plasmid is correct.
、S100ΔrffGThe structure of mutant strain and identification
The restructuring suicide plasmid pYA4278- that will be builtrffGConvert to λpirIn coli strain（The bacterial strain lacks
asdGene is, it is necessary to which DAP can grow, for subsequently engaging the screening of transfer）, suicide plasmid pYA4278- will be carriedrffGλpirEscherichia coli carry out engagement transfer with salmonella typhimurium S100, are screened on the LB flat boards of chlorampenicol resistant
Positive bacterium colony, positive bacterium colony is cultivated to propagation in the LB fluid nutrient mediums without chlorampenicol resistant, sieved on 10% sucrose plate
The bacterium colony of resistance to sucrose is selected, and picking single bacterium colony enters performing PCR identification.
Identification：Using bacterium colony to be checked as template, with primer DrffG-1F/DrffG- 2R enters performing PCR amplification.Bacterial strain lacksrffG
Afterwards, primer DrffG-1F/DrffG- 2R amplified productions size merges homology armrffG- UD sizes (764 bp).If do not lack
Successful then PCR primer stripe size is 1818 bp.As a result, gene-deleted strain PCR identifies that stripe size is consistent with theory, such as Figure 1B.Table
It is brightrffGGene-deleted strain successfully constructs.Mutant strain is named as S100 ΔsrffG。
Embodiment 3
S100ΔrfbBΔrffGThe structure of mutant strain and identification
Suicide plasmid pYA4278- will be carriedrffGλpirEscherichia coli and salmonella typhimurium S100 ΔsrfbB
Engagement transfer is carried out, positive bacterium colony is screened on the LB flat boards of chlorampenicol resistant, by positive bacterium colony without chlorampenicol resistant
Propagation is cultivated in LB fluid nutrient mediums, the bacterium colony of resistance to sucrose is screened on 10% sucrose plate, and picking single bacterium colony enters performing PCR identification.
Identification：Using bacterium colony to be checked as template, with primer DrfbB-1F/DrfbB- 2R and DrffG-1F/DrffG- 2R is carried out
PCR is expanded.Bacterial strain lacksrfbBAfterwards, primer DrfbB-1F/DrfbB- 2R amplified productions size merges homology armrfbB- UD is big
Small (897 bp), PCR primer stripe size is 1974 bp if not lacking successfully；Bacterial strain lacksrffGAfter gene, primer
DrffG-1F/DrffG- 2R amplified productions merge homology armrffG- UD sizes (764 bp), PCR is produced if not lacking successfully
Thing stripe size is 1818 bp.PCR primer passes through 1% agarose electrophoresis, and gene-deleted strain stripe size is consistent with theory, such as Fig. 1 C.
ShowrfbB、rffGGene Double gene-deleted strain is successfully constructed, and mutant strain is named as into S100 (ΔsrfbBΔrffG)。
Embodiment 4
1.rfbB、rffGGene-deleted strain LPS phenotype collection of illustrative plates
Sample treatment：Picking wild strain S100 and mutant strain S100 (Δs respectivelyrfbB)、S100(ΔrffG) and S100 (ΔsrfbBΔrffG) single bacterium falls within 3 mL liquid LB and be incubated overnight, next day, bacterium solution surveys OD600After, the bacterium of equal quantities is taken respectively
Body (typically takes OD600For 1 when, the biomass in 1 mL bacterium solutions) in EP pipes, centrifuge (4000 rpm, 10 min), outwell
Clearly, thalline is resuspended with PBS, then centrifuges, repeated washing 2 times.150 μ L bacterial lysates are added into each EP pipes, are resuspended simultaneously
Crack thalline.After boiling 10 min, room temperature is cooled to, is centrifuged (12,000 rpm, 10 min).Take the μ L of supernatant 10 to add and contain 90
In the EP pipes of μ L sample-loading buffers, then 1 μ L Proteinase Ks are added into each EP pipes, fully mix after, be placed in 37 DEG C it is incubated
Case is incubated 1h.
SDS-GAGE：After 12.5% separation gel and the preparation of 5% concentration glue is carried out by formula, by bacterial strain S100, S100 (ΔrfbB)、S100(ΔrffG)、S100(ΔrfbBΔrffG) loading order, 10 μ L samples are added into hole, to unnecessary
The sample-loading buffer of equivalent is added in hole, is finished with being changed to 120V after the min of 80V electrophoresis 20 to electrophoresis.
Silver staining：Glue after SDS-PAGE is handled in the following order.It is fixed：200 mL are added into clean beaker
The fixer of Fresh, then the glue after PAGE is put into beaker, after being sealed with preservative film, it is placed on horizontal shaker and fixes 4
h；Oxidation：After fixer is outwelled, the oxidation solution of Fresh is added into beaker, horizontal shaker is placed in and shakes 7 min；Drift
Wash：Oxidation solution is outwelled, with 200 mL milli-Q waters 3 times, 15 min/ times；Silver staining：The silver staining liquid of Fresh is added into beaker
In, horizontal shaker shakes 10 min；Rinsing：Silver staining liquid is outwelled, with 200 mL milli-Q waters 3 times, 15 min/ times；Development：
The developer solution of Fresh is added in beaker, is placed in horizontal shaker, observes when shaking, develops to band；Terminate：Outwell
Developer solution, add 200 mL ultra-pure waters and terminate development；Photograph：Glue is taken out, is positioned in gel imaging system preservation of taking a picture.
Acquired results are as shown in Figure 2 A.ShowrfbBWithrffGThe single missing of gene has no effect on LPS synthesis, andrfbBWithrffGGene lacks simultaneously after, LPS synthesis has been blocked, LPS is imperfect.
rfbB、rffGGene-deleted strain ECA phenotype collection of illustrative plates
Sample treatment：Picking wild strain S100 and mutant strain S100 (Δs respectivelyrfbB)、S100(ΔrffG) and S100 (ΔsrfbBΔrffG) single bacterium falls within 3 mL liquid LB and be incubated overnight, next day, bacterium solution surveys OD600After, the bacterium of equal quantities is taken respectively
Body (typically takes OD600For 1 when, the biomass in 1 mL bacterium solutions) in EP pipes, centrifuge (4000 rpm, 10 min), outwell
Clearly, thalline is resuspended with PBS, then centrifuges, repeated washing 2 times.100 μ L bacterial lysates are added into each EP pipes, are resuspended simultaneously
Crack thalline.After boiling 10 min, room temperature is cooled to, is centrifuged (12,000 rpm, 10 min).Supernatant is taken to be managed in new EP
In, then 1 μ L Proteinase Ks are added into each EP pipes, 60 DEG C, overnight.Next day, the bromine phenol of 2 μ L 0.5% is added into each EP pipes
Blue solution, it is standby after fully mixing.
SDS-GAGE：After 12.5% separation gel and the preparation of 5% concentration glue is carried out by formula, by bacterial strain S100, S100 (ΔrfbB)、S100(ΔrffG)、S100(ΔrfbBΔrffG) loading order, 10 μ L samples are added into hole, to unnecessary
The sample-loading buffer of equivalent is added in hole, is finished with being changed to 120V after the min of 80V electrophoresis 20 to electrophoresis.
Western-blot：Transferring film (half-dried transfer printing)：After electrophoresis, glue is taken out, is placed on glass plate, measures size
Afterwards, invaded and steeped in the glass dish equipped with transferring film liquid.Then thick filter paper and pvdf membrane are cut out according to the length and width of glue, will
Pvdf membrane after cutting out invades bubble methanol 1-2 min, and filter paper, which is invaded, to be steeped in transferring film liquid.Stacked successively by order from top to bottom：Filter
Paper, pvdf membrane, glue, filter paper.Finally, put it into transferring film instrument and carry out the min of 10V constant pressures transferring film 30；Closing：Pvdf membrane is taken
Go out, be placed in glass dish, after 1 × TBST drip wash 3 times, add the confining liquid of Fresh, be placed in 4 DEG C, closing is overnight；Wash
Wash：Next day, after confining liquid is reclaimed, 1 × TBST of addition proper volume into glass dish, shaken at room temperature rinsing 3 times, 10
Min/ times；It is incubated primary antibody mouse source mAb898：1 is pressed into 5 mL confining liquids (3% BSA):200 ratios add salmonella rabbit source
O4 serum, it is poured into after mixing in sample sack, then the pvdf membrane after washing is put into sample sack, after discharging bubble, by sample
Product bag seals, and is placed on horizontal shaker, is incubated at room temperature 1 h.Secondary antibody is incubated after washing：1 is pressed into 51 × TBST of mL:20000
Ratio add biotin labeling goat anti-rabbit igg secondary antibody, be incubated 1h altogether with film.After washing, marked by streptavidin is incubated
AP：1 is pressed into 51 × TBST of mL:1000 ratio adds the AP that marked by streptavidin is, 1h is incubated altogether with film.After washing
Developed the color：Pvdf membrane is taken out, is placed in glass dish.By developer 1 × AP buffer, A liquid, B liquid by 1000 μ L, 50 μ L,
After being mixed in 50 μ L volume addition EP pipes, it is added drop-wise on pvdf membrane, lucifuge, which develops the color to cause band, to be shown.Photograph：It is aobvious by terminating
The pvdf membrane of color is placed in gel imaging system, and photograph preserves result.
Acquired results are as shown in Figure 2 B.ShowrfbBWithrffGThe single missing of gene has no effect on ECA synthesis, andrfbBWithrffGGene lacks simultaneously after, ECA synthesis has been blocked.
Embodiment 5
S100(ΔrfbBΔrffG) mutant strain covering and phenotypic evaluation
1. design of primers
Salmonella typhimurium S100 whole genome sequences are derived from according to what Genbank was announced（Sequence number：
CP002614）, design two pairs of primers and expand respectivelyrfbBWithrffGGene, amplified fragments size be respectively 1091 bp,
1073bp, above-mentioned primer synthesize by Beijing Huada gene company, and primer sequence is as follows：
rfbB-F：5’ GGATCCTGAAGATACTTATTACTGGC3’
rfbB-R：5’ AAGCTTTTACTGGCGTCCTTCATAG3’
rffG-F：5’ GGATCCTGAAACGCATTCTGGTGACCG 3’
rffG-R：5’ AAGCTTTTAGCGTTTCAGTCCTAAGC3’
2. cover plasmid p15a-rfbBAnd p15a- rffGStructure
Using wild strain S100 genomes as template, primer is used respectivelyrfbB-F/rfbB- R andrffG-F/rffG- R expandsrfbB
Gene andrffGGene.Recovery will be expandedrfbBWithrffGGenetic fragment and low-copy plasmid p15a restriction enzymesBamH I、HindIII carries out double digestion.After digestionrfbBWithrffGGenetic fragment and plasmid p15a T4 DNA after digestion
Ligase connections, 16 DEG C of water-baths are stayed overnight, and convert competent escherichia coli cell DH5 α, are treated that it grows laggard performing PCR identification, are obtained
Obtain positive recombinant plasmid p15a- rfbBAnd p15a-rffG.The handsome Bioisystech Co., Ltd in Shanghai will be sent to after plasmid extraction
It is sequenced, it was demonstrated that the covering plasmid of structure is correct.
3. S100(ΔrfbBΔrffG) covering strain phenotypic evaluation
The mode that the covering plasmid built in 2. is converted with calcium is transformed into gene-deleted strain competence S100 (Δs respectivelyrfbB
ΔrffG) in.According to the operating procedure in embodiment 4 by wild strain S100, mutant strain S100 (ΔsrfbBΔrffG) and plasmid
Cover strain and carry out LPS and ECA phenotypic evaluations.LPS silver staining results show, S100 (ΔsrfbBΔrffG) complete LPS can not be synthesized,
And pass through plasmid p15a-rfbBAnd p15a-rffGIt can be synthesized and the LPS of wild strain S100 same levels after covering；ECA leads to
Cross Western-blot results to show, S100 (ΔsrfbBΔrffG) ECA is unable to, and pass through plasmid p15a-rfbBAnd p15a-rffGIt can be synthesized and the ECA amounts of wild strain S100 similar levels after covering.Show, no matterrfbBThe covering of gene is stillrffG
The covering of gene can be bacterium while recover to synthesize LPS and ECA ability,rfbBWithrffGGene functionally can be complete
Complementary, replacement.
Embodiment 6
Arabinose regulates and controlsrfbBThe structure of mutant strain
1. design of primers
Announced according to GenBank (CP002614)rfbBGene order, separately design and include different SD sequences for expanding
Row and initiation codonrfbBGene and other required primers, primer is by Beijing Liuhe Huada Genomics Technology Co., Ltd
Synthesis, primer sequence are as follows：
ara rfbB-F1: 5’CCGCTCGAGAGGAGTCATTGTGAAGATACTTATTACTGGCG
GG3’
ara rfbB-F2: 5’CCGCTCGAGAGGAGTCATTATGAAGATACTTATTACTGGCG
GG3’
ara rfbB-F3: 5’CCGCTCGAGGGAAGTCATTATGAAGATACTTATTACTGGCG
GG3’
ara rfbB-F4: 5’CCGCTCGAGGGAAGTCATTGTGAAGATACTTATTACTGGCG
GG3’
ara rfbB-R: 5’CCGGAATTCCTGCAGGTTACTGGCGTCCTTCATAGTTCTG3’
T4: 5’ATGCGGCCGCAGATCTTTTATTATTCTATCC3’
pagL-U: 5’TGCGGATGAAGCTGCCGACC3’
pagL-R: 5’ AGACTATCTTTACTGGCAGG3’
2.rfbBGene PCR expands
Using salmonella typhimurium S100 genomes as template, primer is used respectivelyara rfbB-F1/ ara rfbB-R、ara rfbB-F2/ ara rfbB-R、ara rfbB-F3/ ara rfbB- R andara rfbB-F4/ ara rfbB- R is expanded
Four containing different initiation codons and SD sequencesrfbBGenetic fragment.
Pcr amplification reaction is carried out in 50 μ L system, and reaction system is as follows：Template DNA 1 μ L, 2 × primeSTAR
Max (precious biological Co., Ltd) 25 μ L, the μ L of sense primer 1, sense primer 1 μ L, ddH2O 22μL。
rfbBThe structure of recombinant plasmid
First, plasmid pYA3700 extracting is carried out, by the plasmid pYA3700 extracted and recoveryrfbBGenetic fragment
Use restriction enzymeXhoI、EcoRI carries out double digestion.It will pass throughXhoI、EcoRThe plasmid pYA3700 of I double digestions and fourrfbBGenetic fragment is attached, then connection product is transformed into competence DH5 α with calcium conversion method.LB is dipped with toothpick
(Amp+) single bacterium colony that grows of flat board as template, uses primer respectivelyara rfbB-F1/ ara rfbB-R、ara rfbB-F2/
ara rfbB-R、ara rfbB-F3/ ara rfbB- R andara rfbB-F4/ ara rfbB- R carries out bacterium colony PCR identifications.
PCR primer passes through electrophoresis detection, obtains band of the size for 1200 bp or so.Randomly select a positive colony and carry out matter
Grain extracting, plasmid is then sent to Beijing six directions Hua Da gene and carries out sequencing.Sequencing result and different initiation codons and SD
SequencerfbBGenetic homology shows four recombinant plasmid pYA3700- up to 100%rfbBSuccessfully construct.Plasmid is ordered respectively
Entitled pYA3700-rfbB(1)、pYA3700-rfbB(2)、pYA3700-rfbB(3)、pYA3700-rfbB(4)。
4. recombination suicide vector pYA4278- ΔspagL-TT araC PBAD rfbBStructure and RCR identification
Respectively with plasmid pYA3700-rfbB(1)、pYA3700-rfbB(2)、pYA3700-rfbB(3)、pYA3700-rfbB(4) it is template, with primer T4 and ara rfbB- R expands TTaraC PBAD rfbBFragment.Its theoretical amplification size is
2312 bp.Electrophoresis result band is respectively positioned on 2000-3000 bp or so, is consistent with expected results.
ΔrfbBΔrffGΔpagL::TT araC PBAD rfbB) regulation and control mutant strain structure
The restructuring suicide plasmid pYA4278- Δs that will be builtpagL-TT araC PBAD rfbBConvert to λpirLarge intestine bar
In bacteria strain, suicide plasmid pYA4278- Δs will be carriedpagL-TT araC PBAD rfbBλpirEscherichia coli and mouse typhus
Salmonella gene-deleted strain S100 (ΔsrfbBΔrffG) engagement transfer is carried out, screen positive bacteria on the LB flat boards of chlorampenicol resistant
Fall, positive bacterium colony is cultivated to propagation in the LB fluid nutrient mediums without chlorampenicol resistant, resistance to sugarcane is screened on 10% sucrose plate
Sugared bacterium colony, and picking single bacterium colony enters performing PCR identification.Using bacterium colony to be checked as template, primer is usedpagL- U andpagL- R enters performing PCR expansion
Increase, electrophoresis result part single bacterium colony amplifies 2311 bp or so band, it is contemplated that result is consistent, and shows to regulate and control gene-deleted strain structure
Success.Regulation and control mutant strain is named as S494, S495, S496, S497 successively.
Embodiment 7
Regulate and control mutant strain S100 (ΔsrfbBΔrffGΔpagL::TT araC PBAD rfbB) LPS, ECA phenotype collection of illustrative plates
1. regulate and control mutant strain S100 (ΔsrfbBΔrffGΔpagL::TT araC PBAD rfbB) LPS phenotype collection of illustrative plates
Salmonella typhimurium wild type S100 and four regulation and control mutant strain S494, S495, S496, S497, respectively containing
Have in 0.1% arabinose or LB liquid medium without 0.1% arabinose and be incubated overnight.Take equal bacterium amount appropriately processed
After carry out SDS-PAGE, silver staining, concrete operations reference implementation example 4.As a result show, arabinose has no effect on S100 LPS tables
Type, four regulation and control strains are under the conditions of existing for arabinose, and in addition to S494 regulates and controls strain, other three regulation and control strains can synthesize and parent
LPS suitable this plant of S100 is horizontal.Under conditions of arabinose is not present, four regulation and control strain bacterium can not synthesize complete LPS, such as
Fig. 5 A.
Regulate and control mutant strain S100 (ΔsrfbBΔrffGΔpagL::TT araC PBAD rfbB) ECA phenotype collection of illustrative plates
Salmonella typhimurium wild type S100 and four regulation and control mutant strains are present or absent in arabinose respectively
It is incubated overnight in LB fluid nutrient mediums, through SDS-PAGE after sample treatment, ECA band detections is carried out with Western-blot, is had
Reference implementation example 4 is made in gymnastics.As a result, four regulation and control strains can synthesize ECA to some extent under the conditions of existing for arabinose,
And under conditions of arabinose is not present, only regulating and controlling strain S496 is not detected by ECA structures, and other regulation and control strains are different degrees of
Ground has synthesized ECA structures.Show that regulate and control strain S494, S495 and S497 all has not rigorous phenomenon when regulating and controlling ECA synthesis,
Only regulating and controlling strain S496 has regulation and control preciseness.Show that regulating and controlling strain S496 is four plants by arabinose while regulates and controls LPS and ECA conjunctions
The bacterial strain optimal into effect.
Claims (6)
1. one plant of attenuated salmonella typhimurium Salmonella typhimurium S496, it is characterised in that the attenuation mouse
The own rfbB genes of salmonella typhi Salmonella typhimurium S496 missings and rffG genes；By pagL genes
The rfbB genes that have changed SD sequences and initiation codon containing arabinose regulating and controlling sequence are replaced with, it is described to contain Arab
The nucleotide sequence of the rfbB genes that have changed SD sequences and initiation codon of sugared regulating and controlling sequence is as shown in SEQ ID No.1；
The Classification And Nomenclature of the attenuated salmonella typhimurium is Salmonella typhimurium S496, is preserved in Chinese Typical Representative
Culture collection, preserving number are CCTCC NO：M 2015562, preservation time is：On September 21st, 2015.
2. a kind of construction method of attenuated salmonella typhimurium, it is characterised in that the construction method comprises the following steps：
1) using the methods of homologous recombination of suicide plasmid mediation, by the rfbB genes in salmonella typhimurium bacterial genomes and
RffG gene knockouts, obtain not containing the mutant strain of rfbB genes and rffG genes；
2) the rfbB bases that have changed SD sequences and initiation codon containing arabinose regulating and controlling sequence are obtained using PCR TRAPs
Cause, then with homologous recombination method by the rfbB genes that have changed SD sequences and initiation codon containing arabinose regulating and controlling sequence with
PagL genes in mutant strain obtained by step 1) are replaced；ECA band detections are carried out afterwards, obtain available arabinose simultaneously
Regulate and control the attenuated salmonella typhimurium of bacterium LPS and ECA synthesis, its Classification And Nomenclature is Salmonella typhimurium
S496, is preserved in China typical culture collection center, and preserving number is CCTCC NO：M 2015562, preservation time is：2015
On September 21,.
3. construction method according to claim 2, it is characterised in that the methods of homologous recombination bag of the suicide plasmid mediation
Include following steps：
(1) suicide plasmid pYA4278-rfbB and pYA4278-rffG are built；
(2) suicide plasmid obtained by step (1) is transformed into λ pir Escherichia coli, and engaged naturally with salmonella, made homologous
Fragment imports salmonella gene group, by first time exchange and Cm+ resistance screenings, obtains positive colony；
(3) positive colony is cultivated, spontaneous mutation is brought it about and produces secondary exchange, with the Screening of Media containing sucrose, obtain
To antibiotic sensitive to the clone of sucrose resistance；
(4) screen to obtain the mutant strain without rfbB and rffG genes by PCR.
4. construction method according to claim 3, it is characterised in that the structure of the suicide plasmid pYA4278-rfbB
Method is：
Design primer：
DrfbB-1F:5’CATAGAGCAGCTTTTGCATG 3’
DrfbB-1R:5’GTCCTTCATATTTTCTATTCCATAAGGCGTA 3’
DrfbB-2F:5’GAATAGAAAATATGAAGGACGCCAGTAATG 3’
DrfbB-2R:5’GCGAAATTATTGCCCTTACC 3’
Expanded with primer DrfbB-1F and DrfbB-2R, the upstream and downstream homology arm amplified production merged, then with+A
Reaction kit in fragment ends progress+A processing, and with obtaining pYA4278 digestion products in T4 ligases after Ahd I digestions
In the presence of be attached, and be transformed into λ pir Escherichia coli, obtain recombinant plasmid pYA4278-rfbB；
The suicide plasmid pYA4278-rffG's is configured to：
Design primer：
DrffG-1F:5’CGACGGCAAACCGCACTGGG 3’
DrffG-1R:5’CTGCCGTTTATCAGCGCCAGACTCCTTTGG 3’
DrffG-2F:5’CTGGCGCTGATAAACGGCAGGTTCTTACTC 3’
DrffG-2R:5’GCGTTGCCACGCCTGCAGTG 3’
Expanded with primer DrffG-1F and DrffG-2R, the upstream and downstream homology arm amplified production merged, then with+A
Reaction kit in fragment ends progress+A processing, and with obtaining pYA4278 digestion products in T4 ligases after Ahd I digestions
In the presence of be attached, and be transformed into λ pir Escherichia coli, obtain recombinant plasmid pYA4278-rffG.
5. construction method according to claim 2, it is characterised in that the specific method in step 2) is：
1) following primer is designed：
ara rfbB-F3:5’CCGCTCGAGGGAAGTCATTATGAAGATACTTATTACTGGCGGG 3’
ara rfbB-R:5’CCGGAATTCCTGCAGGTTACTGGCGTCCTTCATAGTTCTG 3’
After the rfbB genetic fragments amplified and plasmid pYA3700 enzyme Xho I, EcoR I double digestions, it is attached, turns
Change, rfbB genetic fragments are connected to sequence TTaraC PBADAfterwards, recombinant plasmid pYA3700-rfbB is obtained；
2) using plasmid pYA3700-rfbB as template, TT araC P are expanded with primer T4 and ara rfbB-RBADRfbB fragments, institute
It is with primer：
T4:ATGCGGCCGCAGATCTTTTATTATTCTATCC
ara rfbB-R:CCGGAATTCCTGCAGGTTACTGGCGTCCTTCATAGTTCTG
The TT araC P that will be amplifiedBADRfbB fragments and plasmid pYA4278- Δs pagL restriction enzyme Not I, sbf
After I double digestions, it is attached, converts；Obtain recombinating suicide plasmid pYA4278- Δ pagL-TT araC PBADrfbB；
3) restructuring suicide plasmid pYA4278- Δ pagL-TT araC P will be transferred toBADRfbB λ pir Escherichia coli are not with containing
The mutant strain of rfbB genes and rffG genes engages naturally, homologous fragment is imported salmonella gene group, and by homologous
Restructuring, by first time exchange and Cm+Resistance screening, positive colony is obtained, then cultivates positive colony, brought it about spontaneous prominent
Become and produce secondary exchange, with the Screening of Media containing sucrose, obtain to antibiotic sensitive and to the clone of sucrose resistance, finally
PCR method screens to obtain attenuated salmonella typhimurium mutant strain.
6. the attenuated salmonella typhimurium Salmonella typhimurium S496 described in claim 1 are preparing vaccine
On application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510638456.5A CN105132350B (en) | 2015-09-30 | 2015-09-30 | The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510638456.5A CN105132350B (en) | 2015-09-30 | 2015-09-30 | The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105132350A CN105132350A (en) | 2015-12-09 |
| CN105132350B true CN105132350B (en) | 2018-03-16 |
Family
ID=54717924
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510638456.5A Expired - Fee Related CN105132350B (en) | 2015-09-30 | 2015-09-30 | The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105132350B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399213A (en) * | 2016-08-09 | 2017-02-15 | 江苏省农业科学院 | Antibiotic lysobacter spp gene knockout system as well as construction method and application thereof |
| CN107723269B (en) * | 2017-08-24 | 2021-07-09 | 四川农业大学 | Construction method of recombinant salmonella typhimurium bivalent vaccine strain, obtained strain and application |
| CN109402155A (en) * | 2018-11-12 | 2019-03-01 | 川北医学院 | A kind of dual control delay cracking performance plasmid and its construction method and application |
| CN110747155A (en) * | 2019-11-12 | 2020-02-04 | 湖南大学 | Attenuated recombinant engineering bacterium, preparation method and application thereof, and tumor targeted drug |
| CN112618706B (en) * | 2020-11-21 | 2021-09-14 | 青岛博霖生物科技有限公司 | Triple vaccine for salmonella, riemerella anatipestifer and escherichia coli disease |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1315871A (en) * | 1998-07-24 | 2001-10-03 | 梅根保健股份有限公司 | Live attenuated i(salmonella) vaccines to control avian pathogens |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7541043B2 (en) * | 2002-01-16 | 2009-06-02 | The United States Of America As Represented By The Department Of Health And Human Services | Vaccine for protection against Shigella sonnei disease |
-
2015
- 2015-09-30 CN CN201510638456.5A patent/CN105132350B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1315871A (en) * | 1998-07-24 | 2001-10-03 | 梅根保健股份有限公司 | Live attenuated i(salmonella) vaccines to control avian pathogens |
Non-Patent Citations (4)
| Title |
|---|
| Genetic Analysis of the dTDP-Rhamnose Biosynthesis Region of the Escherichia coli VW187 (O7:K1) rfb Gene Cluster: Identification of Functional Homologs of rfbB and rfbA in the rff Cluster and Correct Location of the rffE Gene;CRISTINA L. MAROLDA 等;《JOURNAL OF BACTERIOLOGY》;19951031;第117卷(第19期);第5539-5546页 * |
| Regulated delayed synthesis of lipopolysaccharide and enterobacterial common antigen of Salmonella Typhimurium enhances immunogenicity and cross-protective efficacy against heterologous Salmonella challenge;Chun Huang 等;《Vaccine》;20160805;第34卷(第36期);第4285-4292页 * |
| 肠杆菌共同抗原对鼠伤寒沙门氏菌生物特性和毒力影响研究;黄春 等;《第三届水禽疫病防控研讨会论文集》;20150801;第110页 * |
| 鼠伤寒沙门氏菌ｒｍｌＣ 基因突变株的构建及生物特性研究;黄春 等;《第三届水禽疫病防控研讨会论文集》;20150801;第109页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105132350A (en) | 2015-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105132350B (en) | The construction method and its obtained strains of a kind of attenuated salmonella typhimurium and application | |
| Ahern et al. | Characterization of novel virulent broad-host-range phages of Xylella fastidiosa and Xanthomonas | |
| US10041135B2 (en) | Phage insensitive Streptococcus thermophilus | |
| Gaudin et al. | Extracellular membrane vesicles harbouring viral genomes | |
| US7689366B2 (en) | Integrated system for high throughput capture of genetic diversity | |
| CN107129999A (en) | Using surely turn CRISPR/Cas9 systems to viral genome carry out target editor method | |
| Luo et al. | Genome, integration, and transduction of a novel temperate phage of Helicobacter pylori | |
| CN109666654A (en) | New bacteriophage, its composition and their preparation method and application | |
| Lou et al. | Detection and Molecular Characterization of a 16SrII‐A* Phytoplasma in Grapefruit (C itrus paradisi) with Huanglongbing‐like Symptoms in C hina | |
| Li et al. | A versatile genetic toolbox for Prevotella copri enables studying polysaccharide utilization systems | |
| CN102796756A (en) | Carrier capable of showing and expressing heterologous gene on surface of lactococcus lactis, and preparation method and application of carrier | |
| Roset et al. | Molecular cloning and characterization of cgt, the Brucella abortus cyclic β-1, 2-glucan transporter gene, and its role in virulence | |
| CN106967608A (en) | Weak poisonous insect mutant strain of Infection of Toxoplasma Gondii of one plant of GRA17 gene delection and preparation method thereof | |
| Lemay et al. | Targeted genome editing of virulent phages using CRISPR-Cas9 | |
| Basta et al. | Novel archaeal plasmid pAH1 and its interactions with the lipothrixvirus AFV1 | |
| CN109266593A (en) | Based on Ngpiwi protein mediated eggs crack detection gene knock-out bacterial strain and its construction method and application | |
| Porter et al. | Multiple phase-variable mechanisms, including capsular polysaccharides, modify bacteriophage susceptibility in Bacteroides thetaiotaomicron | |
| CN107653230A (en) | A kind of II type pseudoabies poison strain and its application | |
| CN106190943A (en) | A kind of dual-gene disappearance Salmonella enteritidis, its construction method and the vaccine containing this dual-gene disappearance Salmonella enteritidis | |
| CN110591994A (en) | Vibrio harveyi homologous recombination gene knockout method based on sodium hydroxide stimulation | |
| CN102732510A (en) | Method for simultaneously removing bacillus anthracis virulence megaplasmids pXO1 and pXO2 | |
| CN107723269A (en) | Recombinate construction method and gained strain and the application of Salmonella typhimurtum bivalent vaccine strain | |
| CN104560854B (en) | Lack phoP eggs crack detection attenuated strain and its construction method and application | |
| CN100395328C (en) | Plasmid-free clone of E. coli strain DSM 6601 | |
| Panigrahy et al. | Development of a metagenomic DNA extraction procedure and PCR detection of human enteric bacteria in vegetable salad tissues |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180316 Termination date: 20200930 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |