CN109247328B - LDH-dsRNA nanocrystallization preparation and preparation method and application thereof - Google Patents

Abstract

The invention discloses an LDH-dsRNA nanocrystallization preparation as well as a preparation method and application thereof. The preparation method of the LDH-dsRNA nano preparation comprises the following steps: extracting genome RNA, designing a primer, performing RT-PCR amplification, synthesizing dsRNA, and combining the dsRNA with layered double hydroxide to obtain the LDH-dsRNA nano preparation. The LDH-dsRNA nanocrystallization preparation has the advantages of long lasting time, environmental friendliness, no phytotoxicity to crops and the like, and can be applied to prevention and treatment of TMV.

Description

LDH-dsRNA nanocrystallization preparation and preparation method and application thereof

Technical Field

The invention relates to the technical field of gene engineering, in particular to an LDH-dsRNA nano preparation and a preparation method and application thereof.

Background

An LDH (layered double hydroxide) material is a natural inorganic layered anionic clay material naturally produced by precipitation in a salt water body or erosion by basalt, and has been widely studied as a drug carrier material, an electrode material, an adsorbing material, etc. because of its stable two-dimensional lamellar structure, strong assemblability, high safety, and good biocompatibility, thermal stability, and mechanical properties.

RNAi (RNA interference) phenomenon generally exists in organisms, is a phenomenon that small interfering RNA (siRNA) mediates to generate gene silencing after transcription, has the characteristics of specificity, high efficiency, transmissibility, competitive effect, position effect and the like, and plays an important role in the aspects of regulating gene expression, resisting virus invasion, preventing amplification of reverse locus elements in genomes and the like. The expression of RNAi technology in plant is the process of transferring pathogenic dsRNA of virus into leaf blade or vein of plant to silence the gene of pathogenic dsRNA and its homologous mRNA and degrade the pathogenic dsRNA. With the continuous research on RNA interference technology and related mechanisms thereof, certain research and application have been carried out on the characteristics of the RNA interference technology, such as high efficiency, specificity and propagability, for preventing and treating plant virus diseases, and a new way for preventing and treating plant viruses is provided by the application of RNAi. At present, the stability and systematicness of resisting viruses by applying dsRNA are not good enough, and how to enhance the stability of the dsRNA makes RNAi an urgent problem to be solved in the field.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide the LDH-dsRNA nanocrystallization preparation which has the advantages of improved stability, environmental friendliness and simple preparation method and can be applied to the prevention and treatment of TMV.

An LDH-dsRNA nanocrystallization preparation which comprises a layered double hydroxide and dsRNA, wherein the dsRNA is adsorbed on the surface of the layered double hydroxide; the target gene of the dsRNA is the TMV coat protein CP gene.

Preferably, the LDH-dsRNA nanocrystallization preparation has a mass ratio of the layered double hydroxide to the dsRNA of 1: 10-100. Further, the mass ratio of the layered double hydroxide to the dsRNA is 1: 10.

As a general technical concept, the invention also provides a preparation method of the LDH-dsRNA nanocrystallization preparation, which comprises the following steps:

s1, taking TMV RNA as a template; designing an amplification primer containing Hind III and Kpn I according to the TMV RNA, and carrying out RT-PCR amplification to obtain an amplification product;

s2, connecting and transforming the amplification product into a competent cell to obtain a recombinant;

s3, designing a primer containing a T7 promoter sequence by taking the recombinant as a template, and carrying out PCR amplification to obtain an amplification product containing a T7 promoter;

s4, taking an amplification product containing the T7 promoter as a template, and carrying out in vitro synthesis of dsRNA;

s5, combining the synthesized dsRNA with layered double hydroxide to obtain the LDH-dsRNA nano preparation.

In the above preparation method, preferably, the amplification primers containing Hind III and Kpn I in the step S1 are the DNA sequence shown in SEQ ID NO.2 and the DNA sequence shown in SEQ ID NO. 3.

In the preparation method, preferably, the step S2 specifically includes: and connecting the amplification product to a pEASY-T1 vector to obtain a connection product, and transforming the connection product into a competent cell to obtain a recombinant.

In the preparation method, preferably, the primer containing the T7 promoter sequence in the step S3 is a DNA sequence shown in SEQ ID NO.4 and a DNA sequence shown in SEQ ID NO. 5.

In the preparation method, preferably, the step S5 specifically includes:

s5-1, dissolving the layered double hydroxide in DEPC (diethyl phthalate) treated water to prepare 0.01 w/v% layered double hydroxide working solution;

s5-2, shaking and mixing the dsRNA and the 0.01 w/v% layered double hydroxide working solution to adsorb the dsRNA on the surface of the layered double hydroxide to obtain the LDH-dsRNA nano preparation.

As a general technical concept, the invention also provides an application of the LDH-dsRNA nano preparation in prevention and treatment of TMV.

In the above application, preferably, the application method is: and when the tobacco leaves are in the 5-leaf stage, spraying the LDH-dsRNA nano preparation on the tobacco leaves.

In the above application, preferably, the concentration of the LDH-dsRNA nano preparation is 1 v/v%.

Compared with the prior art, the invention has the advantages that:

(1) the invention provides an LDH-dsRNA nano preparation, wherein a nano material is a layered double hydroxide; the target gene of the dsRNA is TMV coat protein CP gene; the dsRNA is synthesized in vitro, and the stability of the dsRNA is improved by combining the nano material-layered double hydroxide, so that an LDH-dsRNA nanocrystallization preparation is formed, and the dsRNA can better act on plants.

(2) The invention provides a preparation method of an LDH-dsRNA nano preparation, which has simple process and is environment-friendly.

(3) The invention provides an application of an LDH-dsRNA nano preparation in preventing and treating TMV, wherein the LDH-dsRNA nano preparation has 55.18% and 59.08% of prevention and treatment effects on TMV respectively, and the effect is good.

Drawings

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention.

FIG. 1 is an electrophoretogram of in vitro synthesized dsRNA.

FIG. 2 is a graph of the optimal ratio screening of the binding of layered double hydroxide to dsRNA. In the figure, M: trans2K Plus II DNA Marker; 1: dsRNA; 2: 0.02% of LDH nano-material working solution; 3: the fusion ratio of LDH to dsRNA is 1: 1; 4: the fusion ratio of LDH to dsRNA is 1: 2; 5: the fusion ratio of LDH to dsRNA is 1: 5; 6: the fusion ratio of LDH to dsRNA is 1: 8; 7: the fusion ratio of LDH to dsRNA is 1: 10; 8: the fusion ratio of LDH to dsRNA is 1: 20; 9: the fusion ratio of LDH to dsRNA is 1: 50; 10: the fusion ratio of LDH to dsRNA is 1: 70; 11: the fusion ratio of LDH and dsRNA is 1: 100.

FIG. 3 is a graph of the stability test of the binding of layered double hydroxide to dsRNA at 4 ℃. A: the change in the amount of dsRNA at 4 ℃ for 30d was measured using the amount of dsRNA in the starting solutions of dsRNA and LDH-dsRNA, respectively (100%) as a control. B is agarose gel electrophoresis picture; wherein, M: trans2K Plus II DNA Marker; 1-4: dsRNA stability results at 4 ℃ for 0, 10, 20 and 30 d; 5-8: LDH-dsRNA stability results at 4 ℃ for 0, 10, 20 and 30 d.

FIG. 4 is a graph of the stability test of the binding of layered double hydroxide to dsRNA at 25 ℃. A: the change in the amount of dsRNA at 25 ℃ for 30d was measured using the amount of dsRNA in the starting solutions of dsRNA and LDH-dsRNA, respectively (100%) as a control. B is agarose gel electrophoresis picture; wherein, M: trans2K Plus II DNA Marker; 1-4: dsRNA stability results at 25 ℃ for 0, 10, 20 and 30 d; 5-8: LDH-dsRNA stability results at 25 ℃ for 0, 10, 20 and 30 d.

FIG. 5 is a graph of the stability test of the binding of layered double hydroxide to dsRNA at 37 ℃. A: the change in the amount of dsRNA at 37 ℃ for 30d was measured using the amount of dsRNA in the starting solutions of dsRNA and LDH-dsRNA, respectively (100%) as a control. B is agarose gel electrophoresis picture; wherein, M: trans2K Plus II DNA Marker; 1-4: dsRNA stability results at 37 ℃ for 0, 10, 20 and 30 d; 5-8: LDH-dsRNA stability results at 37 ℃ for 0, 10, 20 and 30 d.

Detailed Description

The invention is further described below with reference to the drawings and specific preferred embodiments of the description, without thereby limiting the scope of protection of the invention.

Examples

The materials and equipment used in the following examples are commercially available.

Example 1:

the invention relates to a preparation method of a layered double hydroxide-TMV dsRNA combined LDH-dsRNA nanocrystallization preparation, which comprises the following steps:

(1) extraction of tobacco mosaic virus RNA: after collecting the infected TMV leaves, the RNA is extracted by adopting a Trizol method. The specific operation is as follows:

1.1, putting 0.1g of weighed fresh plant diseased leaves into a sterilized mortar, pouring a proper amount of liquid nitrogen into the mortar, quickly grinding the leaves frozen by the liquid nitrogen into more uniform powder or liquid, and quickly transferring the ground powder or liquid into a 1.5mL RNase-free centrifuge tube.

1.2, quickly sucking 1mL of Trizol, adding the Trizol into a centrifuge tube, fully mixing the Trizol and the centrifuge tube, and placing the centrifuge tube at room temperature for 5 min.

1.3, placing the centrifugal tube at 4 ℃, 12000rpm, and centrifuging for 10 min.

1.4, sucking the centrifuged supernatant, placing the supernatant in a new 1.5mL RNase-free centrifuge tube, adding 200 mu L of chloroform, violently shaking the centrifuge tube for 1min, and then placing the centrifuge tube for 3min at normal temperature.

1.5, centrifugation at 12000rpm for 10min at 4 ℃.

1.6, sucking the centrifuged supernatant, placing the supernatant in a new 1.5mL RNase-free centrifuge tube, adding 600 mu L of isopropanol into the centrifuge tube, and placing the centrifuge tube in a-20 ℃ environment for 30 min.

1.7, centrifuge at 12000rpm for 10min at 4 ℃ and discard the supernatant.

1.8, 1mL of 70% ethanol solution (now prepared) is aspirated and added to the centrifuge tube, the precipitate is suspended by pipetting with a pipette, centrifuged at 5000rpm for 3min at 4 ℃, and the supernatant is discarded.

1.9, repeating the step 1.8 once, centrifuging at 5000rpm at 4 ℃ for 30s, and sucking the residual 70% ethanol solution by using a pipette.

1.10, opening the cover and naturally drying the precipitate, adding 30 mu L of RNase-free Water into a centrifuge tube, sucking and uniformly stirring by a liquid transfer gun to fully dissolve the precipitate to obtain the RNA.

(2) RT-PCR reaction

2.1, designing a TMV CP gene specific primer containing Hind III and Kpn I according to the sequence information, wherein the sequence of the primer is as follows:

F：CCAAGCTTTCAAGTTGCRGGACCAGAGGT(SEQ ID NO.2)；

R：CGGGGTACCATGTCTTACAGTATCACTACTCCATCT(SEQ ID NO.3)。

the underlined sections are the introduced cleavage sites.

2.2, carrying out RT-PCR amplification on the TMV genome by using the primers to obtain an amplification product of the complete TMV CP gene.

The cDNA synthesis is carried out according to the reverse transcription instruction of Beijing all-type gold biotechnology limited company, and the specific steps are as follows: TMV RNA 8. mu.L; random Primer 1. mu.L; 2 × TS Reaction Mix 10 μ L; enzyme Mix 1 μ L; the total volume was 20. mu.L. Flicking, mixing, centrifuging for a short time, incubating at 25 deg.C for 10min, and incubating at 42 deg.C for 30 min; the enzyme was inactivated at 85 ℃ for 5 min. Thus obtaining the TMVcDNA.

The specific amplification system of RT-PCR is as follows: 10 × PCR buffer 2 μ L; dNTPs (2.5mM) 1.6. mu.L; 1. mu.L each of the forward/reverse primers (10. mu.M); 0.3. mu.L of DNA polymerase; 1 mu L of cDNA; ddH₂O is complemented to 20 mu L; the total volume was 20. mu.L.

The amplification procedure was pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 45s, renaturation at 60 ℃ for 30s, extension at 72 ℃ for 60s, 35 cycles, and final extension at 72 ℃ for 10 min.

The amplified product was detected by 1.0% agarose gel electrophoresis, which showed a single band at 500bp, consistent with the expected sequence size.

(3) Obtaining a TMV CP gene containing recombinant, which comprises the following steps:

3.1, purifying and recovering the PCR amplified fragment.

3.2, connecting the purified and recovered target fragment to pEASY-T1 Zero Cloning Vector by the following specific system: 4. mu.L of the target fragment, 1. mu.L of pEASY-T1 Zero Cloning Vector; and (3) flicking, uniformly mixing, centrifuging for a short time, reacting by using a PCR instrument, connecting for 5min at 25 ℃, and turning to ice after the reaction is finished to obtain a connecting product.

Adding the obtained 5 mu L of the ligation product into the just thawed competent cells, and carrying out ice bath for 30 min; heating in 42 deg.C water bath for 30s, and rapidly placing on ice for 2 min; adding 300 μ L of SOC culture medium preheated at 37 deg.C in advance, and incubating at 37 deg.C and 200rpm for 1 h; then spread on LB solid culture plates containing ampicillin resistance, and placed in a 37 ℃ incubator overnight for culture.

Taking a flat plate which is cultured overnight at 37 ℃ and contains the recon, selecting a monoclonal colony for colony PCR screening, selecting a positive colony for overnight culture at 37 ℃ and 200rpm, extracting plasmids from the cultured bacterial liquid, and carrying out enzyme digestion and sequencing verification to obtain the recon containing the TMV CP gene.

The TMV CP gene sequence (SEQ ID NO.1) is:

CGGGGTACCATGTCTTACAGTATCACTACTCCATCTCAGTTCGTGTTCTTGTCATCAGCGTGGGCCGACCCAATAGAGTTAATTAATTTATGTACTAATGCCTTAGGAAATCAGTTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGGCAATTCAGTGAGGTGTGGAAACCTTCACCACAAGTAACTGTCAGGTTCCCTGACAGTGACTTTAAGGTGTACAGGTACAATGCGGTATTAGACCCGCTAGTCACAGCACTGTTAGGTGCATTTGACACTAGAAATAGAATAATAGAAGTTGAAAATCAGGCGAACCCCACGACTGCCGAAACGTTAGACGCTACCCGTAGAGTAGACGACGCAACGGTGGCCATAAGGAGCGCTATAAATAATTTAGTAGTAGAATTGATCAGAGGAACCGGATCTTATAATCGGAGCTCTTTCGGGAGCTCTTCTGGTTTGGTTTGGACCTCTGGTCCCGCAACTTGAAAGCTTGG。

(4) the method comprises the following steps of obtaining a TMV CP gene template containing a T7 promoter:

4.1, designing a TMV CP gene specific primer containing a T7 promoter according to the sequence information, wherein the primer sequence is as follows:

F：TAATACGACTCACTATAGGGAGATCAAGTTGCRGGACCAGAGGT(SEQ ID NO.4)；

R：TAATACGACTCACTATAGGGAGAATGTCTTACAGTATCACT(SEQ ID NO.5)。

the introduced T7 promoter sequence is underlined.

And 4.2, carrying out PCR amplification on the TMV CP gene by using the primers to obtain a complete TMV CP gene amplification product containing the T7 promoter sequence.

The specific PCR amplification system is as follows: 10 × PCR buffer 2 μ L; dNTPs (2.5mM) 1.6. mu.L; 1. mu.L each of the forward/reverse primers (10. mu.M); 0.3. mu.L of DNA polymerase; 1 mu L of recombinant plasmid containing TMV CP gene; ddH₂O is complemented to 20 mu L; the total volume was 20. mu.L.

The amplification procedure was pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 45s, renaturation at 61 ℃ for 30s, extension at 72 ℃ for 60s, 35 cycles, and final extension at 72 ℃ for 10 min.

The amplified product is detected by 1.0% agarose gel electrophoresis, and a single band is shown at about 500bp and is consistent with the expected sequence size.

And 4.3, purifying and recovering the amplification product obtained in the step 4.2 by tapping to obtain the TMV CP gene template containing the T7 promoter.

(5) In vitro Synthesis of dsRNA, reference

The RNAi Kit instructions were written to perform in vitro synthesis of dsRNA. The method comprises the following specific steps:

5.1, formation of dsRNA: preparing a transcription system: template 1-2. mu.g containing the T7 promoter, 10 XT 7 Reaction Buffer 2. mu.L, ATP Solution 2. mu.L, CTP 2. mu.L, GTP 2. mu.L, UTP 2. mu.L, T7 Enzyme Mix 2. mu.L, nucleic-free Water make-up to 20. mu.L. The total volume was 20. mu.L. Flick, mixing uniformly, carrying out short-time centrifugation, and transferring to PCR for incubation: incubating at 37 deg.C for 4h, incubating at 75 deg.C for 5min, and cooling to room temperature; i.e., forming dsRNA.

5.2 RNase digestion to remove DNA and ssRNA: RNase digestion reaction system: 20. mu.L of dsRNA obtained in 5.1 above, 21. mu.L of nucleic-free Water, 5. mu.L of 10 Xdigestion Buffer, 2. mu.L of DNase I, 2. mu.L of RNase were incubated at 37 ℃ for 1 hour.

5.3, purifying the dsRNA. The method comprises the following specific steps: preparing dsRNA Binding mix: 50 mu L of digested dsRNA, 50 mu L of 10 multiplied Binding Buffer, 150 mu L of nucleic-free Water and 250 mu L of absolute ethyl alcohol are gently sucked and beaten by a pipette and mixed evenly; adding 80 μ L (preheated at 95 deg.C) eluate, centrifuging at 15000rpm for 2min, adding 80 μ L (preheated at 95 deg.C) eluate, centrifuging at 15000rpm for 2 min; the product after elution is the purified dsRNA.

Electrophoretic detection in vitro synthesis of dsRNA is shown in FIG. 1. In fig. 1, M: trans2K Plus II DNA Marker; 1: dsRNA was synthesized in vitro. As can be seen from fig. 1: an electrophoretic band of about 500bp consistent with the expected size indicates that the dsRNA has been successfully synthesized in vitro.

(6) Binding of layered double hydroxide to dsRNA.

6.1, preparation of 0.01% layered double hydroxide working solution: the layered double hydroxide is dissolved in DEPC treated water according to the proportion of 0.01 percent (w: v), namely 0.01 percent of layered double hydroxide working solution.

6.2 and 0.02 percent of layered double hydroxide working solution are prepared: the layered double hydroxide is dissolved in NaAc buffer solution according to the proportion of 0.02 percent (w: v), and the 0.02 percent layered double hydroxide working solution is obtained.

6.3 binding of layered double hydroxide to dsRNA: 1 μ g of dsRNA was aspirated into 9 clean centrifuge tubes, and 1, 2, 5, 8, 10, 20, 50, 70 and 100 μ L of 0.01% layered double hydroxide working solution was added to the centrifuge tubes in sequence. And (3) rotating the centrifugal tube to a high-speed vortex oscillator to oscillate for 2min, standing for 20min, and adsorbing dsRNA on the surface of the LDH to form stable LDH-dsRNA nano particles. Detecting the LDH-dsRNA nanoparticles by agarose gel electrophoresis, and selecting the optimal fusion proportion according to the electrophoresis result.

FIG. 2 is the screening electrophoresis diagram of the optimal fusion ratio of dsRNA and layered double hydroxide. Lane 1 is dsRNA, Lane 2 is 0.02% layered double hydroxide working solution, Lane 3-11 are LDH-dsRNA nanocrystallization agents with different fusion ratios of 1. mu.g dsRNA and 0.01% layered double hydroxide working solution of 1, 2, 5, 8, 10, 20, 50, 70 and 100. mu.L, respectively. As can be seen from FIG. 2, lane 7 shows the optimal fusion ratio of dsRNA to layered double hydroxide, and no extra dsRNA is precipitated after the layered double hydroxide is fused with dsRNA, i.e., the optimal fusion ratio is found when the volume-mass ratio of layered double hydroxide to dsRNA is 10 μ L: 1 μ g.

Example 2:

the determination of stability of the LDH-dsRNA nanocrystallization preparation of example 1, the determination method thereof comprises the following steps:

(1) respectively taking 5 mu L of the LDH-dsRNA nanocrystallization preparation of the example 1 and dsRNA synthesized in vitro, and placing the 5 mu L of the LDH-dsRNA nanocrystallization preparation and the dsRNA in RNase-free PCR tubes, wherein 45 tubes are respectively; the RNase-free PCR tube was sealed with Parafilm sealing film to avoid evaporation of the liquid, and centrifuged briefly.

(2) Evenly dividing the 45 tubes into three parts, sequentially placing the three parts on a PCR plate, and respectively placing the three parts at 4 ℃, 25 ℃ and 37 ℃ for 30 days;

(3) performing agarose gel electrophoresis detection every 2d, uniformly mixing 3 μ L loading buffer, 3 μ L ethidium bromide fluorescent dye and 3 μ L sample, respectively spotting into spot sample wells, performing electrophoresis at 130V for 25min, and observing and storing the electrophoresis image (see FIG. 3B, FIG. 4B and FIG. 5B);

(4) at the same time, the amount of dsRNA was measured by a NanoDrop 2000c instrument, data was recorded, and the test was repeated twice.

(5) The dsRNA synthesized in vitro was used as a control to determine the change in dsRNA content in the nanomaterial-RNAi formulation to obtain its adsorption stability, and the results are shown in fig. 3A, fig. 4A, and fig. 5A.

As can be seen from fig. 3A, 4A, and 5A: in the stability determination tests at 4, 25 and 37 ℃, the amount of dsRNA is respectively reduced by 80.01%, 59.56% and 59.76% compared with the initial value, and the degradation is obvious; the amount of dsRNA in the LDH-dsRNA is increased by 54.30%, 58.4% and 66.42% respectively compared with the initial value; the electrophoresis results of fig. 3B, 4B and 5B show that: the degradation rate of dsRNA at 4 ℃ is slightly higher than that of dsRNA stored at 25 ℃ and 37 ℃; the degradation amount of the LDH-dsRNA nano preparation is small, the combination of the nano material and the dsRNA is stable, and no obvious strip is separated out within 30 days at 4, 25 and 37 ℃. In the figure, different lower case letters of a, b, c and d indicate that the difference of the 0.05 level is significant.

Example 3:

an application of the LDH-dsRNA nano preparation of example 1 in TMV prevention and treatment is as follows:

a prevention and treatment test of an LDH-dsRNA nano preparation on tobacco mosaic virus is researched by adopting a half-leaf method, and 4 groups of treatments are designed in total, (1) clear water is used as a blank control for treatment, and 1 v/v% dsRNA is treated; (2) clear water is used as blank control for treatment, and 1 v/v% LDH-dsRNA nano preparation is used for treatment; (3) treating with clear water as blank control and 0.1% moroxydine hydrochloride; (4) clear water is used as blank control treatment and LDH nano material treatment; 10 plants were treated per group and the experiment was repeated 3 times.

The main veins are taken as intervals, the left part of the leaf is taken as a control group, the right part of the leaf is taken as a treatment group, and the number of the scorched spots of the preventing and treating effect is the average value of the total number of the scorched spots of each group (10 strains) of the heart leaf tobacco in three times of experiments.

Prevention test: culturing heart-leaf tobacco in a greenhouse to a 5-leaf stage, taking main veins as intervals, covering the part without drug application by using a hard plastic plate, spraying a contrast treatment medicament on the left part of each leaf, spraying a biological or chemical treatment medicament on the right part of each leaf, inoculating the TMV (tobacco mosaic Virus) dry spot host heart-leaf tobacco by adopting a friction inoculation method after 1d of the interval, observing the disease condition of plants after 2d of virus inoculation, taking pictures, counting the number of disease spots of 3 test leaves, calculating the prevention effect, and counting data.

And (3) treatment test: inoculating 5-leaf stage heart-leaf tobacco by adopting a friction inoculation method, carrying out pesticide spraying treatment at an interval of 6 hours after virus inoculation, covering the part without pesticide application by using a hard plastic plate at an interval of main veins, spraying a contrast treatment medicament on the left part of the leaf, spraying a biological or chemical treatment medicament on the right part of the leaf, observing the disease condition after 2 days, taking a picture, counting the number of disease spots of the leaf for 3 times, calculating the treatment effect, counting the data, and recording the data in table 1.

Table 1: results of the prevention and treatment effects of LDH-dsRNA nanocrystallization preparation on TMV

From the results of table 1, it can be seen that: the prevention effect of dsRNA, LDH-dsRNA preparation, 0.1% moroxydine hydrochloride and LDH preparation on TMV was 60.12%, 55.18%, 3.27% and 0.87%, respectively; the therapeutic effect was 65.01%, 59.08%, 4.47% and 1.47%, respectively. The results show that the LDH-dsRNA preparation has certain effect on the prevention and treatment of TMV.

The foregoing is merely a preferred embodiment of the invention and is not intended to limit the invention in any manner. Although the present invention has been described with reference to the preferred embodiments, it is not intended to be limited thereto. Those skilled in the art can make many possible variations and modifications to the disclosed embodiments, or equivalent modifications, without departing from the spirit and scope of the invention, using the methods and techniques disclosed above. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention are still within the scope of the protection of the technical solution of the present invention.

Sequence listing

<110> plant protection institute of Hunan province

<120> LDH-dsRNA nano preparation and preparation method and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 497

<212> DNA

<213> Tobacco mosaic Virus (Tobacco mosaic virus)

<400> 1

cggggtacca tgtcttacag tatcactact ccatctcagt tcgtgttctt gtcatcagcg 60

tgggccgacc caatagagtt aattaattta tgtactaatg ccttaggaaa tcagtttcaa 120

acacaacaag ctcgaactgt cgttcaaagg caattcagtg aggtgtggaa accttcacca 180

caagtaactg tcaggttccc tgacagtgac tttaaggtgt acaggtacaa tgcggtatta 240

gacccgctag tcacagcact gttaggtgca tttgacacta gaaatagaat aatagaagtt 300

gaaaatcagg cgaaccccac gactgccgaa acgttagacg ctacccgtag agtagacgac 360

gcaacggtgg ccataaggag cgctataaat aatttagtag tagaattgat cagaggaacc 420

ggatcttata atcggagctc tttcgggagc tcttctggtt tggtttggac ctctggtccc 480

gcaacttgaa agcttgg 497

<210> 2

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccaagctttc aagttgcrgg accagaggt 29

<210> 3

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggggtacca tgtcttacag tatcactact ccatct 36

<210> 4

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taatacgact cactataggg agatcaagtt gcrggaccag aggt 44

<210> 5

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taatacgact cactataggg agaatgtctt acagtatcac t 41

Claims (1)

1. Use of an LDH-dsRNA nanoformulation for the prevention and treatment of TMV, wherein the LDH-dsRNA nanoformulation comprises a layered double hydroxide and dsRNA adsorbed on the surface of the layered double hydroxide; the target gene of the dsRNA is TMV coat protein CP gene; the DNA sequence of the TMV coat protein CP gene is shown in SEQ ID NO. 1; the mass ratio of the layered double hydroxide to the dsRNA is 1: 10-100;

the preparation method comprises the following steps:

s1, designing an amplification primer containing Hind III and Kpn I according to TMV RNA by taking TMV RNA as a template, and carrying out RT-PCR amplification to obtain an amplification product; the amplification primers containing Hind III and Kpn I are a DNA sequence shown in SEQ ID NO.2 and a DNA sequence shown in SEQ ID NO. 3;

s2, connecting the amplification product to a pEASY-T1 vector to obtain a connection product, and transforming the connection product into a competent cell to obtain a recombinant;

s3, designing a primer containing a T7 promoter sequence by taking the recon as a template, and carrying out PCR amplification to obtain an amplification product containing a T7 promoter; the primer containing the T7 promoter sequence is a DNA sequence shown in SEQ ID NO.4 and a DNA sequence shown in SEQ ID NO. 5;

s4, taking the amplification product containing the T7 promoter as a template, and carrying out in vitro synthesis of dsRNA;

s5, dissolving the layered double hydroxide in DEPC (diethyl phthalate) treated water to prepare 0.01 w/v% of layered double hydroxide working solution; oscillating and mixing the synthesized dsRNA with the 0.01 w/v% layered double hydroxide working solution to adsorb the dsRNA on the surface of the layered double hydroxide to obtain an LDH-dsRNA nano preparation;

the application method comprises the following steps: when the tobacco leaves are in the 5-leaf stage, the LDH-dsRNA nano preparation is sprayed on the tobacco leaves; the concentration of the LDH-dsRNA nanocrystallization agent is 1 v/v%.

Images