CN104093419A

CN104093419A - Method of preparing broad spectrum vaccine for preventing avian colibacillosis

Info

Publication number: CN104093419A
Application number: CN201280061063.7A
Authority: CN
Inventors: 张鑫; 马兴树; 牛志勇; 陈淑芳; 刘志辉
Original assignee: HEBEI KEXING PHARMACEUTICAL CO Ltd
Current assignee: HEBEI KEXING PHARMACEUTICAL Co.,Ltd.
Priority date: 2012-09-24
Filing date: 2012-12-10
Publication date: 2014-10-08
Anticipated expiration: 2032-12-10
Also published as: MY178705A; IN2015DN02393A; CN104093419B; WO2014043838A1

Abstract

The present invention discloses a method of preparing a broad spectrum vaccine for preventing avian colibacillosis, including recombining the tsh gene, which has an adhesive attraction effect, with E.coli BL21 (DE3); the resulting vaccine may preferentially bind to the corresponding receptors on avian body cells, resulting in there being no receptors to bind to the pathogenic E.coli, thus decreasing morbidity rates among avians.

Description

Method of preparing broad spectrum vaccine for preventing avian colibacillosis

Specification

Prevent the preparation method of the wide spectrum vaccine of birds escherichia coli disease

Technical field

The invention belongs to vaccine field for animals, a kind of specifically preparation method for the wide spectrum vaccine for preventing birds colibacillosis.

Background technology

Colibacillosis refers to partly or entirely by fowl enteropathogenic E. Coli（APEC the disease topically or systemically infected caused by), including escherichia coli jWi diseases, escherichia coli granuloma (Hjarre diseases）, gas Nang disease（Chronic respiratory disease is CRD), escherichia coli cellulitis（That is inflammatory process), swollen head sydrome, escherichia coli not inflammation, escherichia coli salpingitis, escherichia coli osteomyelitis/synovitis（That is turkey osteomyelitis syndrome), the blunt ball of bacilus full 0 is scorching and escherichia coli omphalitis/yolk Nang infection.Escherichia coli play intestines problem in the main I of mammal, and in birds, when the highly pathogenic coli-infections of birds Jj Jij make its defence capability be not enough to or completely lose, often typical Secondary cases can be caused topically or systemically to infect.Bacillosis provisions fowl ik t, into serious loss, are the disease and the discarded main cause of ketoboidies most often reported during poultry diease is investigated.There is data to show：43% broiler chicken ketoboidies is relevant with bacilus disease in poultry meat processing.

Bribery technology is mainly pathogenic by using antibiotic ^ ￡ rows;The treatment of ^ bacillus, but with the enhancing of bacterial drug resistance, chicken colibacillosis is also increasingly difficult to, to prevent and treat, while the consumption of antibiotic is increasing, cause aquaculture to come more serious to the influence ^ ^ that environment is brought.It is all to cultivate ^ oxen by changing to foretell traditional vaccine another sunset, or the method passed on different host animals weakens the malicious f lifes of pathogenic microorganisms；Or inactivated them by physicochemical method.But such vaccine is all undesirable.Because the bacterial strain of reduction can ^^ life back mutations and become poisonous, or lose and exempt from ^, ^ Chu of disease can also be caused by inactivating unsuitable vaccine；And many vaccines need freezing, make the defeated upper difficulties of ^, are not suitable for reality.For subunit vaccine, though even it is that it removes harmful composition unrelated with i t protective immunities in pathogen, still retain poison I " raw albumens effectively exempts from ^, composition.Therefore, in the urgent need to developing a kind of wide spectrum vaccine of the more new prevention colibacillosis of performance. The content of the invention

The technical problem to be solved in the present invention, it is to provide a kind of preparation method for the wide spectrum vaccine for preventing birds colibacillosis, the wide spectrum vaccine of obtained prevention birds bacillus is the albumen expressed by non-^^ bacillus virus gene, it is the adhesion receptor that striving property preferentially seizes the thin lunar surface of carcass unexpectedly, so as to terminate the usual channel of pathogenic W bacillus carcass cell, so that Immunizing Birds.This product may be directly applied to the clinical immunization of avian colibacillosis, prevents fowl Infective Escherichia coli and causes a disease, and then improve fanning economics.

In order to solve the above technical problems, the technical solution used in the present invention is：

A kind of preparation method of the wide spectrum vaccine of prevention birds colibacillosis, it detects sequence according to following step and carried out：

(the structure of 1) Chong Group plasmids

1. using the pathogenic ^ bacillus genes group of fowl as template, expanded using the sensitive element tsh genes of PCR skill ^ temperature；

2. the temperature sensitive haemagglutination element tsh genes after amplification are inserted on expression vector pEASY- E1, build restructuring shield grain carrier, then be transformed into 7/wl-Tl clone's competent cells；

3. the thin ^ i row cultures of competence are cloned to ra/-T1, and extracts plasmid；

(2) expression of gene

Plasmid is transformed into competent cell BL21 (DE3), competent cell BL21 (DE3) is cultivated；(3) preparation of vaccine

Competent cell BL21 (DE3) after culture is diluted to 0D values with distilled water for after 0. 800, the final wide spectrum vaccine that prevention birds colibacillosis is made.

A kind of as the present invention limits, step 1. middle sensitive element tsh genes of PCR amplifications temperature, primer it is as follows：

Sense primer is zxl:5 ,-atgaacagaatttattctcttcgc-3'

Anti-sense primer is zx2:5 ,-gaatgaataacgaatattagcgttt-3'.

As another restriction of the present invention, 1. middle PCR expands the bodies of temperature sensitive haemagglutination element tsh genes to step System is as follows：

96 °C of pre-degeneration 5min;

94 °C of denaturation lmin, 50 °C of annealing 30 ~ 60s, 72 °C of 1 ~ 2min of extension, 30 circulations；

72 °C of extension lOmin;

It is placed in 41：Refrigerator, produces the temperature sensitive haemagglutination element tsh genes after amplification.As the third restriction of the present invention, 2. specific ^ is first as follows for step：

AL PCR is expanded after temperature sensitive haemagglutination element tsh genes, pEASY-El carriers and distilled water 25 °C are placed in after mixing, be incubated 20min, form the restructuring shield grain of PCR primer and pEASY-El vector constructions；

Bl, plus state weight!B in 50 μ Ι competent cells, are flicked mixing, and ice bath 10 ~

15min;

After Cl, 42 °C of heat shock 30s, it is immediately placed on waterborne；

Dl, after be added in the LB fluid nutrient mediums that temperature is room temperature, put shaking table into, 37 °C of lower 200rpm are incubated lh, obtain bacterium solution；

El, take 200 L bacterium solutions to be placed on flat board to carry out bed board, overnight incubation produces the Transl- Ι cells containing recombinant plasmid.It is used as further restriction：

LB Liquid Culture based formulas described in step D1 includes：

Yeast extract 5g, Tryptone lOg, NaCl 5g, remaining is distilled water, is settled to 1L;

Flat board described in step El is that flat board made in culture flesh is placed in LB solid mediums, and 40mg/mL ampicillin sodiums are contained wherein on LB culture mediums.Described LB solid culture based formulas includes：Yeas t extract 5g, Tryptone lOg, NaCl 5g, agar lOg, remaining is distilled water, is settled to 1L. As the third restriction of the present invention, 3. concrete operations are as follows for step：

A2, monoclonal bacterium colony are in 1.5mL LB culture mediums, 37 °C of lower 300rpm cultures 18h;

B2, Tou foster bacterium solution is centrifuged, and centrifugal force is 10000g, and centrifugation time is lmin, and abandoning supernatant leaves bacterial sediment；

C2, into bacterial sediment add 250 Solution I, whirlpool 2min, obtain solution a;

D2, the Solution II for adding into solution a 250 μ, rotating centrifugal pipe are gently mixed, and are incubated 3min, are obtained solution b;

E2,350 Solution III are added into solution b,;^ is overturned several times immediately, until there is floccule precipitation, obtains solution c;

F2, solution c centrifuged into lOmin under 13000g, obtain supernatant and white depositions；

G2, into centrifuge tubes of the 2mL with centrifugal column, power mouth enters 100 equilibrium liquids, 13000g centrifugation 60s, discards efflux；

H2, the careful F2 that draws walk obtained supernatant in centrifuge tube, and 13000g centrifugation lmin discard efflux；

12nd, 500 HB Buffer, OOOg centrifugation 60s are added, are discarded；Dumplings goes out liquid；

J2, μ DNA wash buffer, 13000 g the centrifugation 60s of addition 700, discard efflux；

K2, repeat step J2, discard efflux；

L2,13000g centrifuge 2min, thoroughly remove liquid, obtain the centrifugal column containing DNA；

M2, ^ mouthfuls of the centrifugation containing DNA entered into clean 1.5mL centrifuge tube, add 50 L EB, be incubated at room temperature 60s, 13000g centrifugation 60s, collect DNA, obtain weight grain.

It is used as the further restriction of above-mentioned restriction, the Solution II described in Solution I, step D2 described in described step C2, the Solution III described in step E2, the equilibrium liquid described in step G2, HB Buffer and step J described in step Π²Described in DNA wash buffer be Plasmid Mini Kit I D6943- 01* models OMEGA companies production kit in composition. It is used as the 5th kind of restriction of the present invention, step（2) specific 4 Qiao makees as follows：

A3, take -70 °C of BL21 (DE3) competent cell melted on 50 μ ice baths, add in weight grain, gently shake up, 30min is placed in ice bath, obtain being combined with the BL2UDE3 of weight grain on the thin moon) cell；

B3, will be combined with thin ^ restructuring shield grain 42 °C of water bath conditions of BL21 (DE3) cell under heat shock 45s, then quick and stable is transferred to 2min in ice bath, obtains closing BL21 (DE3) cell for having heavy grain in cell；

The 500 sterile LB culture mediums without antibiotic are added in C3, BL21 (DE3) cell into cell containing weight grain, 37 °C, 200rpm centrifugation culture 2h, the thalline recovered are placed in after mixing；Wherein, the recombinant plasmid with Amp+ resistances is contained in thalline, the purpose of recovery is to allow Amp+ resistant genes to carry out certain quantity expression, if expression quantity is very few or inadequate, the cell is just directly killed by Amp+.

D3, the thalline of absorption different volumes recovery are applied on solid LB media, 37 °C of culture 16h;

The bacterium colony grown on E3, culture medium, enters performing PCR identification.The present invention also has a kind of restriction, step（3) ^^ Qiao make as follows：

The bacterium solution of fermented and cultured is diluted into 0D values with distilled water, and (0D values are detected with ultraviolet specrophotometer for 0. 800）, come with this therefore for immunovac parenteral solution.

As a result of above-mentioned technical scheme, of the invention and existing skill mesh ratio, acquired technological progress is：Expression and the preparation method of vaccine using the structure, gene of recombinant plasmid, this method provide new method for the prevention of Pathogenicity to fowl Escherichia coli, and tool is of great significance.The present invention is by the screening to functional gene in fowl enteropathogenic E. Coli plasmid, by the tsh genetic recombination with adhesive attraction in e. coli bl21 (DE3).The vaccine can do sth. before others have a chance to on carcass cell corresponding acceptor (the i.e. plain acceptor of temperature sensitive haemagglutination）With reference to causing fowl enteropathogenic E. Coli to be combined without acceptor, so as to reduce the morbidity of birds.It is demonstrated experimentally that recombination bacillus coli BL2 DE3) there is good immune effect, therefore, this recombination bacillus coli BL21 (DE3) can be used for the exploitation that the wide ^ of avian escherichia coli gives birth to vaccine. The present invention is applied to the preparation of prevention birds colibacillosis wide spectrum vaccine.

The present invention is described in further detail below in conjunction with Figure of description and specific embodiment.

Brief description of the drawings

Fig. 1 is 1% agarose gel electrophoresis figure of pcr amplification product tsh genes；

Fig. 1 is the ^1- Τ 1 of recombination bacillus coli 7 structure flow chart；

Fig. 3 is the PCR qualification results of restructuring pEASY-El carriers；

Fig. 4 is the PCR qualification results of restructuring e. coli bl21 (DE3)；

Fig. 5 is the prevention birds bacillosis wide spectrum vaccine action site schematic diagram prepared by the present invention.Embodiment

Embodiment

The present embodiment is a kind of preparation method of the wide spectrum vaccine of prevention birds colibacillosis, and it is carried out according to following steps order：

(1) structure (the recombination bacillus coli Γ Γ of recombinant plasmid<3/^1- T1 structure flow, as shown in Figure 1）1. using the pathogenic bacillus gene group of fowl as template, just wide increase is carried out using PCR skill ^ temperature sensitivity J element tsh genes；

Wherein, step 1. middle PCR amplification temperature sensitive haemagglutination element tsh genes, primer it is as follows

Sense primer is zxl:5 ,-atgaacagaatttattctct tcgc-3'

Anti-sense primer is zx2:5 ,-gaatgaataacgaatattagcgttt-3'.

The sensitive element tsh gene detailed processes of PCR amplification temperature are as follows：

Activation culture APEC bacterial strains, and extract plasmid, the template reacted using the plasmid of extraction as PCR；Temperature sensitive haemagglutination element tsh genes, 96 °C of pre-degeneration 5min, 94 °C of denaturation lmin will be expanded;

50 annealing 30s (can also be 40s, 50s or 60s under the same conditions), 72 °C of extension lmin (can also be 1. 5min or 2min under the same conditions), 30 circulations； After 72 °C of extension lOmin, 4 °C of refrigerator ^ are placed in, the temperature sensitive haemagglutination element tsh genes after amplification are produced.Wherein, pcr amplification reaction system is as shown in table 1：

The PCR of table 1 expands ^ ^ systems

After amplification terminates, PCR primer is taken to carry out 1% agarose alternating current:：^ is surveyed.Electrophoresis Slow fliud flushings are 1 X TAE, with 120V electrophoresis 30min, are foretold with purple sunset and lift ^！' Μ examines electrophoresis result, sees that Μ is DL8000 Marker in Fig. 1, Fig. 1 (indicating range is 8000,5000,3000,1500,1000,500);Obtained tsh fragment length 4134bp are expanded, are consistent with expected size, as shown in Figure 1.

2. the temperature sensitivity ^ element tsh genes after amplification are inserted on expression vector pEASY- E1, construction of recombinant plasmid vector, then be transformed into rra l-Tl clone's competent cells；

Have mulberry and make as follows：

Al, PCR is expanded after temperature sensitive haemagglutination element tsh genes, pEASY-El carriers and distilled water 25 °C are placed in after mixing, be incubated 20min, form the recombinant plasmid of PCR primer and pEASY- El vector constructions；

Wherein, gained PCR primer cuts purpose band tsh after 1% agarose gel electrophoresis, then reclaims PCR primer with DNA QIAquick Gel Extraction Kits；The PCR fragment of recovery is linked with expression vector EASY-El, 5 μ L links system is as shown in the table： ^Ji thing consumptions

PCR purified product Ι μ

PEASY-El carrier Ι μ Ι ^

ddH20 μ Ι

The μ Ι of cumulative volume 5

Β 1, plus weight Eb is stated in 50 μ Transl- Ι competent cells, flick mixing, 10 ~ 15m of ice bath in;

After Cl, 42 °C of heat shock 30s, it is immediately placed on ice；

Dl, rear addition to temperature is in the LB culture mediums of room temperature, put shaking table into, and 37 °C of lower 200rpm are incubated lh, obtain bacterium solution；

Wherein, the LB Liquid Culture based formulas described in step D1 includes：

Yeas t extract 5g, Tryptone lOg, NaCl 5g, remaining is distilled water, is settled to 1L.El, take 200 μ bacterium solutions to be placed on flat board to carry out bed board, overnight incubation produces the thin moon bags of the Transl- Ι containing recombinant plasmid；

Wherein above-mentioned flat board is that flat board made in culture is placed in LB solid mediums, and 40mg/mL ampicillin sodiums are contained wherein in LB culture mediums.Described LB solid culture based formulas includes：Yeas t extract 5g, Tryptone lOg, NaCl 5g, agar lOg, remaining is distilled water, is settled to 1L.

The bacterium colony grown on culture medium, enters performing PCR identification（Primer zxl and T7terminator primer), the wherein terminator primer of Τ 7 are T7 anti-sense primers, primer sequence is bad ' J is：5 ,-TGCTAGTTATTGCTCAGCGG-3 '.After amplification terminates, take PCR primer to carry out 1% agarose and hand over electrophoresis detection.Electrophoresis Slow fliud flushings are 1 X TAE, and with 120V electrophoresis 30min, detection 43 is foretold with purple sunsetSee and examine electrophoresis result, as shown in figure 3, DL8000 Marker in Fig. 3 (indicating range is 8000,5000,3000,1500,1000,500);Obtained fragment length 4221bp is expanded, is consistent with expected size.Commission six directions China ^ because detection is hooked into ^, then identify by sequence, and the sequencing result for the tsh genetic fragments that PCR amplifications are obtained is as follows： gg ggggg gg ggTOgggggggga ccttcacattta tattataaCCcccca ccttactactat gg ggggggg gggggggggggggg ctatcataacaattact acaca cactaa aacaacaat g ctcataaaa t gggggggg ggggggg gg¾ggg attt aactccttcattaaac tcat attaaaatattcc gggggg gggggggg actcctt£t t ct aaca^ccctaacatacctactccta ggggggggg ggggg ggggggg a cacaattca taacatcatcttaattctt ctcacttcct ggggg gg gggggggggt acaatcca tcacacaaataattaa catatcaacctt caacttt g gg gg g ggggggggggggggttccactatactaa caataccact cctacacaaaccacct gggg ggggggggggggcat Ccc ccac tcaaatcaattaaaatcttac g gggggg g ggggggggggggggggatttttttacaatcc caaaat aactct ttccacatc ggggggggggg ttttctct ttcttac tccctttattcta tattca ttctt gggggggggggg gggt ctacac tacact tcaatccatttc g gg gggTOggggggg ttctatca ctataataaat ttacaccatcat acttcccttccaaa gg gg gggggggggg gggggggcca aacaacaaaattct attctctacc aaacatcctaaa gggg ggggggggggtctaca acc tccttttt ttctctt tatctatatata ggg gggggg ggggggggggggggggttcca cttcctacaccc acac aaactaaac ccttt

gggggggggggggc cctt ta ttcatcccccatc taccaacacttt taata gggggggggg gg g taaaccta tttatacata aacataactatacac gg gggggg¾ gggggg ggtatatcaac tataaaccccat ctcaatcttcacatttcatt ggggg ggggg atatcct taacctaaattt atctattc gg ggggggggggggggaaacat aat tcccccc tat tctaaaatattcttt gggggggggggggggc taactcat cc ttattctc taattaa ctatcccac gggggg ggg gggttttccctt tcatatctcaactc ttctaaaatatatt ggggggg gggg ggg ttatctcttatcccccacttccctaa ttac ataaca SBO 3OOBOO

OB §OO§§8§

§00§¾OB§OS

§13§§1§

..9lOO/ZTOZN3/X3d gtcggtttta acgggggaac atcaccgttc acgacactga caacagataa tctggacgcg gttcagtcag catttgtcat gcgtacagac cttaacaagg cagacaaact ggtgataaac aagtcggcaa caggtcatga caacagcatc tgggttaact tcctgaaaaa accttctaac aaggacacgc ttgatattcc actggtcagc gcacctgaag cgacagctga taatctgttc agggcatcaa cacgggttgt gggattcagt gatgtcaccc ccatccttag tgtcagaaaa gaggacggga aaaaagagtg ggtcctcgat ggttaccagg ttgcacgtaa cgacggccag ggtaaggctg ccgccacatt catgcacatc agctataaca acttcatcac tgaagttaac aacctgaaca aacgcatggg cgatttgagg gatattaatg gcgaagccgg tacgtgggtg cgtctgctga acggttccgg ctctgctgat ggcggtttca ctgaccacta taccctgctg cagatggggg ctgaccgtaa gcacgaactg ggaagtatgg acctgtttac cggcgtgatg gccacctaca ctgacacaga tgcgtcagca gacctgtaca gcggtaaaac aaaatcatgg ggtggtggtt tctatgccag tggtctgttc cggtccggcg cttactttga tgtgattgcc aaatatattc acaatgaaaa caaatatgac ctgaactttg ccggagctgg taaacagaac ttccgcagcc attcactgta tgcaggtgca gaagtcggat accgttatca tctgacagat acgacgtttg ttgaacctca ggcggaactg gtctggggaa gactgcaggg ccaaacattt aactggaacg acagtggaat ggatgtctca atgcgtcgta acagcgttaa tcctctggta ggcagaaccg gcgttgtttc cggtaaaacc ttcagtggta aggactggag tctgacagcc cgtgccggcc tgcattatga gttcgatctg acggacagtg ctgacgttca tctgaaggat gcagcgggag aacatcagat taatggcaga aaagacagtc gtatgcttta cggtgtgggg ttaaatgccc ggtttggcga caatacgcgt ctggggctgg aagttgaacg ctctgcattt ggtaaataca acacagatga tgcgataaac gctaatattc gttattcatt ctga

3. Transl--Tl clone's competent cells are cultivated, and extracts plasmid；

Have ^ f first as follows：

A2, monoclonal bacterium colony are in 1.5mL LB culture mediums, and 37 °C of lower 300rpm centrifuge 18 h; B2, take centrifugation bacterium solution to carry out centrifugation ability Qiao to make, centrifugal force is 10000 g, and centrifugation time is 1 min, and abandoning supernatant flows down bacterial sediment；

C2, Solution I, the whirlpool 2min for adding into bacterial sediment 250 μ, obtain solution a;

D2, the Solution II for adding into solution a 250, rotating centrifugal pipe gently mixes, and is incubated 3min, obtains solution b;

E2, add into solution b 350 Solution III, ^ and overturn several times immediately, until there is floccule precipitation, obtain solution c;

F2, solution c centrifuged into 10min under 13000g, obtain supernatant and white depositions；

H2, the careful F2 that draws walk obtained supernatant in centrifuge tube, and 13000 g centrifugation lmin discard efflux；

12nd, 500 L HB Buffer, 13000 g centrifugation 60s are added, efflux is discarded；

Π, L DNA wash buffer, 13000 g the centrifugation 60s of addition 700, discard efflux；

K2, repeat step J2, discard efflux；

L2,13000g centrifuge 2min, thoroughly remove liquid, obtain the centrifugal column containing DNA；Wherein step G2-L2 is operated when operating in the centrifuge tube with centrifugal column, the DNA containing plasmid in centrifugal column when H2-L2 is operated;

M2, ^ mouthful of the centrifugation containing shield grain DNA entered into clean L 5mL centrifuge tube, power mouth enters 50 y L EB and carries out ^, is incubated at room temperature 60s, 13000g centrifugation 60s, collection DNA, obtains heavy grain.

Wherein, described in described step C2 Solution II, the DNA wash buffer described in equilibrium liquid, the HB Buffer described in step 12 and step J2 described in Solut ion III, step G2 described in step E2 described in Solution I, step Sudden D2 is the composition in the kit of Plasmid Mini Ki t I D6943-01* models.

(2) expression of gene Plasmid is transformed into competent cell BL21 (DE3), competent cell BL21 (DE3) is cultivated；Have ^ # and make as follows：

A3, take⁵The BL2 DE3 melted on 0 L ice baths) competent cell, add in weight grain, gently shake up, 30min is placed in ice bath, obtain being combined with weight ^ on cell membrane：BL21 (DE3) cell of grain；

B3, will on the thin moon knot contain the weight BL2UDE3 of ^) heat shock 45s under 42 °C of water ^ ^ oxen of cell, then quick and stable be transferred to 2min in ice bath, obtaining conjunction in cell has BL21 (DE3) cell of recombinant plasmid；

C3, closed into cell and have the sterile LB culture mediums without antibiotic of 500 y L are added in heavy EL^ BL21 (DE3) cell, 37 °C are placed in after mixing, 200rpm cultivates 2h, the thalline recovered；Wherein, containing in thalline has Amp⁺The recombinant plasmid of resistance, the purpose of recovery is to allow Amp+ resistant genes to carry out certain quantity expression, and such as bright expression quantity is very few or inadequate, and the cell is just directly killed by Amp+.

The bacterium colony grown on E3, ^ culture medium, enters performing PCR identification,（Primer is with zxl and T7 terminator primer) wherein T7 terminator pr imer are T7 anti-sense primers, primer sequence is：5 ,-TGCTAGTTATTGCTCAGCGG-3 ', 1% agarose gel electrophoresis is used, electrophoresis result is as shown in Figure 4.

(3) preparation of vaccine

Competent cell BL21 (DE3) after culture is diluted to 0D values 0. 800 with distilled water, 0D values are detected with ultraviolet specrophotometer, the final wide spectrum vaccine that prevention birds colibacillosis is made；

Prevention birds colibacillosis wide spectrum vaccine action site prepared by the present invention by the wide spectrum vaccine of prevention birds colibacillosis obtained above as shown in figure 5, carry out animal experiment：

It is 0 close age in days of 90 body weight to choose reality ^^ things（What as firm H an ancient type of spoons went out）The blue brown chick in sea, stochastic averagina is divided into 3 groups, 7 is raised in advance, " ^ is examined for progress.

1st, blank control group：ImL physiological saline is subcutaneously injected, pneumoretroperitoneum injects ImL APEC bacterium solutions within 10 days；

2nd, avian colibacillosis wide spectrum vaccine test group（APEC bacterium solutions are not inoculated with)：ImL avian colibacillosis wide spectrum vaccines are subcutaneously injected； 3rd, avian colibacillosis wide spectrum vaccine+APEC bacterium solution test groups：ImL avian colibacillosis wide spectrum vaccines are subcutaneously injected, empty injection ImL APEC bacterium solutions after 10 days.

As a result it is all dead for 1 group of 30 pheasant；2 and 3 groups of chick are normal, no death, table institute specific as follows

It is above-mentioned " bright：This vaccine has immune ^ ^ ability, can effectively prevent birds:The propagation of bacillosis, 4 official birds no longer catch.

Claims

Claims

1st, a kind of preparation method of the wide spectrum vaccine of prevention birds colibacillosis, it is characterised in that it is carried out according to following steps order：

(1) structure of recombinant plasmid

1. it is pathogenic with fowl;^ bacillus genes group is template, is expanded using PCR skill trees temperature sensitivity J＆^ element tsh genes；

2. the temperature sensitive haemagglutination element tsh genes after amplification are inserted on expression vector pEASY- E1, construction of recombinant plasmid vector, then be transformed into 7 1-T1 clone's competent cells；

3. the thin ＆ rows culture of competence is cloned to ra/-T1, and extracts plasmid；

(2) expression of gene

Plasmid is transformed into competent cell BL21 (DE3), competent cell BL21 (DE3) is cultivated；(3) preparation of vaccine

By the competent cell BL21 Φ Ε 3 after culture) steam 7 with double]<0D values are released for after 0.800, the final wide language vaccine that prevention birds colibacillosis is made.

2nd, the preparation method of the wide spectrum vaccine of prevention birds U bacillosises according to claim 1, it is characterised in that step 1. middle PCR amplification temperature sensitivity J element t sh genes, primer it is as follows

Sense primer is zxl:5 ,-atgaacagaatttattctcttcgc-3'

Anti-sense primer is zx2:5 ,-gaatgaataacgaatattagcgttt- 3,.

3rd, the preparation method of the wide spectrum vaccine of the prevention birds colibacillosis according to claim 1 or 1,1. middle PCR amplifications temperature sensitive haemagglutination element tsh gene processes are as follows in step by its special ^：

Activation culture APEC bacterial strains, and extract plasmid, the template reacted using the plasmid of extraction as PCR；Will amplification temperature sensitivity>Plain tsh genes, 96 °C of pre-degenerations 5min, 94 °C of denaturation lmin;

50 °C of annealing 30 ~ 60s, 72 °C of ^ l ~ 2min, 30 circulations；

After 72 °C of extension lOmin, 4 °C of refrigerators are placed in, the temperature sensitive haemagglutination element tsh genes after amplification are produced. 4th, the preparation method of the wide spectrum vaccine of prevention birds colibacillosis according to claim 1, it is characterised in that the tool ^ of step 2. is carried out according to following steps order：

Al, PCR is expanded after temperature sensitive haemagglutination element tsh genes, pEASY- E1 carriers and distilled water 25 °C are placed in after mixing, be incubated 20min, form the restructuring shield grain of PCR primer and pEASY-El vector constructions；

Bl, exacerbation M " grains flick mixing, 10 ~ 15min of ice bath in 50 Transl- Ι competent cells;After Cl, 42 °C of heat shock 30s, it is immediately placed on ice；

Dl, after be added to the LB liquid that temperature is room temperature and support in base, put shaking table into, 37 °C of lower 200rpm are incubated lh, obtain bacterium solution；

El, take 200 μ bacterium solutions to be placed on flat board to carry out bed board, overnight incubation produces the Transl-Tl cells containing recombinant plasmid.

5th, the preparation method of the wide spectrum vaccine of prevention birds colibacillosis according to claim 4, it is characterised in that：Flat board described in step E1 is to support base with the solid ^^ of LB to be placed in flat board made in training ^, and 40mg/mL ampicillin sodiums are contained wherein in LB culture mediums.

The solid ^ of described LB!■, which supports based formulas, to be included：

Yeast extract 5g, Tryptone lOg, NaCl 5g, agar l Og, remaining is distilled water, is settled to 1L.

6th, the preparation method of the wide spectrum vaccine of prevention birds bacillosis according to claim 4, it is characterised in that the LB Liquid Culture based formulas described in step D1 includes：

Yeas t extract 5g, Tryptone lOg, NaCl 5g, remaining is distilled water, is settled to 1L;

7th, the preparation method of the wide spectrum vaccine of prevention birds colibacillosis according to claim 1, it is characterised in that the specific peace of step 3. is carried out according to following steps order：

A2, monoclonal bacterium colony are in 1. 5mL LB culture mediums, 37 °C of lower 300rpm cultures 18h;

B2, W " foster bacterium solution carries out centrifugation and grasps ashamed, and centrifugal force is 10000g, and centrifugation time is lmin, and abandoning supernatant leaves bacterial sediment； C2, into bacterial sediment add 250 Solution I, whirlpool 2min, obtain solution a;

D2, the Solution II for adding into solution a 250 y L, rotating centrifugal pipe are gently mixed, and are incubated 3min, are obtained solution b;

E2, add 350 Solution III into solution b, mixing is overturned several times immediately, until there is floccule precipitation, obtains solution c;

F2, solution c centrifuged into 10min under 13000g, obtain supernatant and white depositions；

G2, to 2mL with centrifugal column centrifuge tube in, add 100 equilibrium liquids, 13000g centrifugation 60s, discard efflux；

H2, the careful F2 that draws walk obtained supernatant in centrifugal column, and 13000g centrifugation lmin discard efflux；

12nd, 500 μ ν HB Buffer, 13000g centrifugation 60s are added, efflux is discarded；

J2,700 μ of addition!DNA wash buffer, 13000 g centrifugation 60s, discard efflux；

K2, repeat step J2, discard efflux；

L2,13000g centrifuge 2min, thoroughly remove liquid, obtain the centrifugal column containing DNA；

M2, ^ mouthfuls of the centrifugation containing DNA entered into the centrifuge tube of 1. clean 5mL, add 50 μ Ε Β, be incubated at room temperature 60s, 13000g centrifugation 60s, collect DNA, obtain weight ^ib.

8th, the preparation method of the wide spectrum vaccine of prevention birds colibacillosis according to claim 7, it is characterised in that：The DNA wash buffer described in the Solution II described in Solution I, step D2, the Solution III described in step E2, the equilibrium liquid described in step G2, the HB Buffer described in step 12 and step J2 described in described step C2 are the composition in the kit of the OMEGA companies production of Plasmid Mini Kit I D6943-01* models.

9th, the preparation method of the wide spectrum vaccine of prevention birds bacillosis according to claim 1, its special tool in step (2) is first as follows：

A3, take the BL2 DE3 melted on 50 μ ice baths) competent cell, add in weight grain, gently shake up, 30min is placed in ice bath, obtain being combined with BL21 (DE3) cell of recombinant plasmid on the thin moon； B3, the BL21 of recombinant plasmid (DE3) cells heat shock 45s under 42 °C of water bath conditions will be combined with thin ^, then BL21 (DE3) cell for being transferred to 2min in ice bath, obtaining containing weight grain in cell of quick and stable；

The sterile LB culture mediums without antibiotic of 500 L are added in C3, BL21 (DE3) cell into cell containing weight grain, 37 °C, 200rpm culture 2h, the thalline recovered are placed in after mixing；

D3, the thalline of absorption different volumes recovery are applied on solid LB media, 37 °C of culture 16h;

The bacterium colony grown on E3, culture medium, enters performing PCR identification.

10th, the preparation method of the wide language vaccine of prevention birds W bacillosises according to claim 1, it is characterised in that the concrete operations of step (3) are as follows：

It is 0. 800 by dilute Dry to the 0D values of the bacterium solution distilled water of fermented and cultured, is come with this as immunovac parenteral solution.