CN106834199A

CN106834199A - Pseudomonas aeruginosa pyoS5 gene knockout mutant strains and construction method and application

Info

Publication number: CN106834199A
Application number: CN201710106794.3A
Authority: CN
Inventors: 齐静; 高阳; 刘玉庆; 杜以军; 李璐璐; 张庆; 胡明; 骆延波; 张印
Original assignee: Institute Animal Science and Veterinary Medicine of Shandong AAS
Current assignee: Institute Animal Science and Veterinary Medicine of Shandong AAS
Priority date: 2017-02-27
Filing date: 2017-02-27
Publication date: 2017-06-13

Abstract

The present invention relates to engineering strain technical field, more particularly to a kind of pseudomonas aeruginosapyoS5Gene knockout mutant strain, it has important application on pseudomonas aeruginosa is prepared in attenuated vaccine.Compared compared with wild strain, arrival exponential phase time and growth rate do not have notable difference, and mutant strain is not transcribedpyoS5The pathogenicity test results of gene, mouse and mink show that the virulence of mutant strain is decreased obviously, and showpyoS5Pathogenic course is take part in, is a kind of important virulence correlation factor, the mutant strain provides important foundation, can be applied to the exploitation of pseudomonas aeruginosa attenuated vaccine for the preparation of attenuated vaccine.

Description

Pseudomonas aeruginosa pyoS5 gene knockout mutant strains and construction method and application

Technical field

The present invention relates to engineering strain technical field, more particularly to a kind of pseudomonas aeruginosa pyoS5 gene knockouts Mutant strain, further relates to construction method and the application of this bacterial strain.

Background technology

Pseudomonas aeruginosa belongs to Gram-negative bacteria, and it is thin in surrounding environment to be that a kind of multi-functional metabolism is prevalent in Strain class.It can parasitize various plants and animal reservoir, cause the opportunistic infections of the mankind.Quantify gene expression dose Principal biological investigative technique as most of Molecular Biology Labs, by measuring the content of RNA in cell, can be true Determine the expression degree of specific gene.Transcript profile sequencing is that, in gene transcription level, research is owned in the tissue at certain time point The expression of transcript, the analysis between individuality according to same area same time point different content, can be with batch quantity analysis shadow The difference expression gene of virulence is rung, polygenes regulated and control network can be equally built according to the differential gene for obtaining.

In biology field, many methods may serve to carry out the quantitative study of target gene.Real time fluorescent quantitative PCR is exactly so as to realize to starting template by the real-time detection to each circulation products fluorescence signal in pcr amplification reaction Quantify and qualitatively analyze.CDNA chip and differential disply are two kinds of skills of the most frequently used high flux screening difference expression gene Art.Whether the result of real-time fluorescence quantitative PCR and high throughput method is compared to each other just can really have expression to this gene Difference is confirmed.

Gene knockout is one kind of gene targeting, similar to the homologous recombination of gene.Refer to exogenous DNA and recipient cell There is homologous recombination in the gene that sequence is same or like in genome, so that instead of identical/similar in recipient cell genome Gene order, is integrated into the genome of recipient cell, makes specific gene function lose, and further research may be to correlation The influence that biological phenomena is caused, and then speculate the biological function of the gene.Suicide plasmid (suicide plasmid) is usually The plasmid of R plasmids, the characteristics of often have host range wide, with engagement metastatic gene.It is a kind of special that its duplication needs Albumen, most of bacteriums do not produce this protein, when host cell is entered, either not reproducible, is eliminated, or it is whole It is incorporated on chromosome, and chromosome is replicated together.Using this feature of suicide plasmid, the gene that technique for gene engineering is built The DNA segment of missing, is cloned into suicide plasmid, using the homologous segment at missing gene two ends, positions the integration position of suicide plasmid Point.The principle that can be recombinated using homology DNA segment, builds accurate gene deletion strains.The knockout of pseudomonas aeruginosa The knock-out bacterial strain that bacterial strain rarely has research, particularly pyoS5 genes yet there are no report.

The content of the invention

In order to the knock-out bacterial strain for solving the problems, such as above pseudomonas aeruginosa in the prior art rarely has research, the application is provided A kind of pseudomonas aeruginosa pyoS5 gene knockout mutant strains.

According to the comparing transcription group data and quantitative fluorescent PCR the result of pseudomonas aeruginosa power toxic bacterial strain, Analysis Relational database, finds out the difference expression gene of conspicuousness.The missing of differential gene is built using the method for gene knockout Strain, that is, build genes of interest target practice fragment, introduces exogenous suicide plasmid, carries out double crossing over homologous recombination, is sieved by round pcr Choosing obtains the clone that pyoS5 genes are replaced by gentamicin resistance gene Gm, to carry out follow-up study differential gene with virulence Correlation.

The invention further relates to the construction method of pseudomonas aeruginosa pyoS5 gene knockout mutant strains.

The invention further relates to the application of pseudomonas aeruginosa pyoS5 gene knockout mutant strains.

What the present invention was obtained through the following steps：

A kind of pseudomonas aeruginosa pyoS5 gene knockout mutant strains, construction method is as follows：

(1) the upstream and downstream homologous recombination arm of pyoS5 genes is expanded from Pseudomonas aeruginosa bacteria genome, while clone To the MCS region of pUC19 plasmids, clone's pUC19- Δs pyoS5 is obtained；

(2) the gentamicin resistance gene Gm for obtaining will be expanded from pJQ200SK plasmids and is cloned into upstream and downstream homology arm Between, obtain pUC19- Δs pyoS5::Gm plasmids；

(3) target practice fragment upstream homology arm-gentamicin resistance gene-downstream homology arm, suicide matter is transferred to through subclone Grain pCVD442, obtains target practice plasmid pCVD442- Δs pyoS5::Gm；

(4)pCVD442-ΔpyoS5::Gm is transferred to E. coli β 2155, obtains donor bacterium β 2155/ pCVD442-ΔpyoS5::Gm, is engaged with recipient bacterium 11092618, and obtain pyoS5 genes by culture, screening is resisted by Gm Property gene substitution the Δ pyoS5 of pseudomonas aeruginosa pyoS5 gene knockout mutant strains 11092618.Construction method technology path is such as Shown in Fig. 1.

The bacterial strain pyoS5 gene knockout mutant strains of pseudomonas aeruginosa of the present invention 11092618 have following characteristics：It is described prominent Mutant belongs to pseudomonadaceae, pseudomonas, belongs to Gram-negative bacteria；It is obligate aerobic, in club shape or wire, in pairs or There is single flagellum short catenation, one end of thalline, without brood cell；Then in muddy shape growth in liquid medium within；In plain agar 16~18h is grown on culture medium can see the bacterium colony of flat moistening；Can be seen in bacterium colony when being grown on blood agar plate Around have zone of hemolysis, bacterium colony metal luster.

Described pseudomonas aeruginosa pyoS5 gene knockout mutant strains, the expansion of upstream homologous recombination arm described in step (1) Increase primer base sequences and see sequence 1,2 in sequence table, the amplimer base sequence of downstream homologous recombination arm is shown in sequence in sequence table Row 3,4, the amplimer base sequence of gentamicin resistance gene Gm is shown in sequence 5,6 in sequence table.

It is preferred that being connected with Sph I sites between upstream and downstream homologous recombination arm, gentamicin resistance gene Gm is cloned into upstream and downstream Sph I sites between homology arm.

Obtained strains are identified during screening in preferred steps (4), the base sequence of PCR primer is shown in sequence in sequence table 7th, 8,9,10,11 and 12.

Without aobvious before described pseudomonas aeruginosa pyoS5 gene knockout mutant strains, its growth curve and pyoS5 gene knockouts Difference is write, its virulence is less than the original strain before pyoS5 gene knockouts.

Described pseudomonas aeruginosa pyoS5 gene knockout mutant strains answering in pseudomonas aeruginosa attenuated vaccine is prepared With.

Compared with prior art, the invention has the advantages that:(1) present invention uses the principle of homologous recombination, in structure Between be gentamicin resistance gene, both sides for pyoS5 gene upstream and downstream homologous sequences gene knockout carrier pCVD442:: PyoS5, the pCVD442 that will be built::PyoS5 gene knockout plasmid electricity is transformed into the competent cells of E. coli β 2155 In, after being engaged with pseudomonas aeruginosa pathogenic strain 11092618, by In vivo homologous recombination, through PCR electrophoresis, RT-PCR and sequencing Identification, successfully obtains mutant strain, is named as 11092618 Δ pyoS5；(2) phase of the present invention to pyoS5 gene knockout mutant strains Close biological characteristics and it is pathogenic analyzed, specify that pyoS5 genes and the bacterial strain of pseudomonas aeruginosa 11092618 cause a disease Property relation, 11092618 Δ pyoS5 compare compared with wild strain, reach exponential phase time and growth rate without substantially poor It is different；Mutant strain does not transcribe pyoS5 genes；The pathogenicity test results of mouse show the virulence of the Δ pyoS5 of mutant strain 11092618 It is decreased obviously, shows that pyoS5 genes take part in pathogenic course, be a kind of important virulence correlation factor, the mutant strain is weak The preparation of malicious vaccine provides important foundation, can be applied to the exploitation of pseudomonas aeruginosa attenuated vaccine；(3) present invention builds 11092618 Δ pyoS5, are that the mechanism of causing a disease of further research pseudomonas aeruginosa is laid a good foundation, and are more effective prevention and control copper The pneumonia that green pseudomonad causes is diseases related there is provided technical support；(4) present invention success build 11092618 The Δ pyoS5 of pyoS5 gene knockout mutant strains 11092618, mutant strain does not transcribe pyoS5 genes；The mouse of toxic agent amount is attacked in difference In pathogenic experiment, the virulence of mutant strain is remarkably decreased；In the identical pathogenic experiment of the mink for attacking toxic agent amount, the cause of mutant strain Also compared with wild strain reduction, this all illustrates that pyoS5 genes are an important virulence factors of pseudomonas aeruginosa to dead rate, for the bacterium is weak Part basis have been established in the development of malicious vaccine.

Outstanding advantages of the invention：

1st, the bacterial strain pyoS5 gene knockout mutant strains of pseudomonas aeruginosa of the present invention 11092618 do not have through DNA sequencing There is mutation and heredity can be stablized, can be used for the candidate bacterium of pseudomonas aeruginosa Study on Pathogenicity and its attenuated vaccine research and development Strain；

2nd, the bacterial strain pyoS5 genes codified of pseudomonas aeruginosa of the present invention 11092618 produces pyo, its A kind of blue active redox secondary metabolite of generation, can not only freely penetrate biomembrane, interference it is normal from Son transhipment, interrupt cellular respiration chain, excess generation oxygen radical and cause cell death, and easily in charrin disease Pulmonary cystic fibrosis (CF) patient's phlegm in largely restore, the virulence with the bacterium is directly related, can be used for the poison of the follow-up gene Power and its functional study.

Brief description of the drawings

Fig. 1 is gene knock-out bacterial strain construction method Technology Roadmap；

Fig. 2 be bacterium solution PCR identify upstream homology arm and partial resistance gene, 24 bacterium colonies of random picking,

M:DNA molecular amount standard, 1,5,6,7,9,12,13,14,15：825bp；

Fig. 3 be bacterium solution PCR identify downstream homology arm and partial resistance gene, 24 bacterium colonies of random picking,

M:DNA molecular amount standard, 1,5,6,7,9,12,13,14,15：1422bp；

Fig. 4 is that bacterium solution PCR identifications inner side knocks out gene, and upstream and downstream homology arm and partial resistance identified for genes are the positive Bacterium colony,

M:DNA molecular amount standard.P1、P2、P3：Positive control；10,11,12,13,15,16 without amplification；

Fig. 5 is the growth curve of wild strain and knock-out bacterial strain.

Specific embodiment

Material：

Pfu DNA polymerase (Thermo Fisher Products, Chinese Shanghai)；EcoR I、BamH I、Hind The restriction enzymes such as III (Thermo Fisher Products, Chinese Shanghai)；Plasmid pJQ200SK, pUC19, pCVD442； Plasmid extraction kit Plasmid Mini Kit I (OMEGA Products, the U.S.)；Axy Prep DNA Gel Extraction Kit (love pursue progress biotech company's product, Hangzhou China)；Bacterial strain DH5 α λ pir, β 2155；P. aeruginosa The clinical pathogenic separation strains 11092618 (preservation of this laboratory) of bacterium；Yeast extract, tryptone (Oxoid Products, English State)；LB fluid nutrient mediums：Yeast extract 0.5g, tryptone 1.0g, NaCl 1.0g are weighed, 100mL deionized waters are dissolved in In, autoclaving；LB solid mediums：1.5g agar powders, HCS is added to go out in per 100mL LB liquid mediums Bacterium；Sucrose (Chemical Reagent Co., Ltd., Sinopharm Group, Chinese Shanghai)；Gel imaging instrument (BIO-RAD, the U.S.)；Electroporation apparatus (BTX, the U.S.)；PCR instrument (Eppendorf, Germany).

The structure of the glm gene target practice fragment of embodiment 1

(1) design of primers

PyoS5 genes and upstream and downstream sequence are shown in sequence 13 in sequence table.Set according to pseudomonas aeruginosa gene group DNA sequence dna Meter PCR primer, base sequence is as follows：

Glm gene target practice primer pyoS5-1F/1R, pyoS5-2F/2R：

pyoS5-1F:Sequence in 5'-ATATCTAGAGAGCTCAGCATGGCGAATGGCCTGCCACTGTGT-3'(sequence tables Row 1)

pyoS5-1R:Sequence in 5'-CATGCATGCTTAGACTTCTCCATTGGTGAGTGTGGTACAGAA-3'(sequence tables Row 2)

(restriction enzyme site of Xba I-Sac I and Sph I being added in primer sequence, expand upstream homology arm 675bp)

pyoS5-2F:Sequence in 5'-CATGCATGCAACCAAGCAAGGCCTCGTTAAATCCTACGAG-3'(sequence tables 3)

pyoS5-2R:In 5'-GCGAAGCTTGAGCTCCGACCACGATGGGCGACTCCAGCGTGCTGA-3'(sequence tables Sequence 4)

(restriction enzyme site of Sac I-Hind III and Sph I is added in primer sequence, downstream homology arm is expanded 1274bp) primer pyoS5-1F/1R, pyoS5-2F/2R is used to build linear target practice fragment.

(2) PCR amplifications：With plasmid pJQ200SK as template, performing PCR is entered with primer Sph I-Gm-F/R, amplification contains celebrating The glm gene target practice fragment of big mycin resistant gene；

Sph I-Gm-F:Sequence 5 in 5'-ATAGCATGCAGAAATGCCTCGACTTC-3'(sequence tables)

Sph I-Gm-R:Sequence 6 in 5'-ATAGCATGCTTGAGACAATTTACCGAACAAC-3'(sequence tables)

(amplification gentamicin resistance gene 907bp)

Upstream homology arm, gentamicin resistance, three fragments of downstream homology arm are connected together and are cloned into pUC19 carriers On, obtain pUC19- Δs pyoS5::Gm plasmids, target practice fragment builds and finishes, and sequence is shown in sequence 14 in sequence table.

The target practice fragment of embodiment 2 is transferred to suicide plasmid pCVD442 through subclone again, obtains target practice plasmid and (or practices shooting and carry Body) pCVD442- Δs pyoS5::Gm

Streak inoculation DH5 α λ pir/pCVD442 strains are to LB/Amp flat boards, 30 DEG C of overnight incubations.Choose monoclonal and enter 3mL In LB/Amp nutrient solutions, 30 DEG C of overnight incubations.Extracted according to kit specification (OMEGA Plasmid Mini Kit I) PCVD442 plasmids.

Digestion with restriction enzyme reacts：PCVD442 plasmids and pUC19- Δs pyoS5::After Gm plasmids are through Sac I digestions, Take carrier and cloned sequence is attached and electricity is converted, obtain target practice plasmid (or targeting vector) pCVD442- Δs pyoS5:: Gm。

On Double flat board, 15 clones are selected at random, chosen respectively into 20 μ L LB culture mediums, take 1 μ L bacterium solution performing PCRs Detection.Sample send sequencing company to be sequenced, and as a result compares analysis, it is determined that can continue to test without base mutation.

The β 2155/pCVD442- Δs pyoS5 of embodiment 3::Gm donors bacterium enters with the recipient bacterium of pseudomonas aeruginosa 11092618 Row mating experiment

The preparation and electricity conversion of the Electroporation-competent cells of the bacterial strains of β 2155：

The strains of β 2155, streak inoculation LB flat boards (are free of antibiotic, the diaminopimelic acids of DAP containing 0.5mM), 30 DEG C of cultures Overnight.Choose monoclonal inoculation 2mL LB (without antibiotic), 30 DEG C of overnight incubations.Overnight bacterium adds 30mL LB to draw 0.5mL (250mL shaking flasks), 37 DEG C of cultures to OD₆₀₀Reach 0.5.Shaking flask is taken out, ice bath 15min is put.In the 40mL round bottom centrifuge tubes of precooling In pour into 30mL bacterium solutions, in 4 DEG C, 1000g centrifugation 15min precipitums, abandon supernatant.Bacterial precipitation is with 30mL ice-cold tri-distilled water Suspend；In 4 DEG C, 1000g centrifugation 15min precipitums, liquid is abandoned.Tri-distilled water repeats to wash twice.Bacterial precipitation is ice-cold with 10mL 10% glycerine (tri-distilled water preparation) suspend, in 4 DEG C, 1000g centrifugation 15min precipitums, abandon liquid, it is careful to retain precipitation. Bacterial precipitation is fully suspended with 50 μ L10% glycerine (tri-distilled water preparation), and being transferred to the 0.5mL centrifuge tubes of a precooling, be can With the Electroporation-competent cells for using.Take 5 μ L targeting vectors connection product (pCVD442- Δs pyoS5::Gm, isopropanol precipitating After be dissolved in deionized water) add the competent cells of 50 μ L β 2155, gently mix, 1min is placed on ice, be transferred to precooling 2mm electricity revolving cup (Eppendorf), dries rapidly electric revolving cup appearance moisture, and being put into electrode carries out electroporated (electric conversion instrument：BTX ECM399；Voltage=2500V)；Immediately to 1mL LB are added in electric revolving cup after electric shock, piping and druming suspends, and is all transferred to new nothing Bacterium 1.5mL centrifuge tubes, 37 DEG C, 220rpm culture recoveries 1h.Take 200 μ L transformed bacterias paving LB flat boards (the μ g/mL containing gentamicin 25, 0.5mM DAP), put 37 DEG C of incubator cultures to β 2155/pCVD442- Δs pyoS5::Gm monoclonals are formed.

11092618,37 DEG C of culture to monoclonals of streak inoculation recipient bacterium pseudomonas aeruginosa are formed on LB flat boards.

β 2155/pCVD442- Δs pyoS5 is chosen on flat board respectively::Gm monoclonals enter the 3mL LB (μ containing ampicillin 50 G/mL, gentamicin 25 μ g/mL, 0.5mM DAP)；Choose 11092618 monoclonals and enter 3mL LB, 37 DEG C, 220rpm overnight incubations.

Respectively by donor bacterium β 2155/pCVD442- Δs pyoS5::Gm (only adding 0.5mM DAP in LB liquid) and recipient bacterium 11092618 monoclonal incubated overnight bacterium solution is according to 1:100 ratio is transferred to new LB fluid nutrient mediums (300mL shaking flasks), 37 DEG C are cultivated to OD₆₀₀Reach 0.8-1.0.

Take 500 μ L donor bacterium β 2155/pCVD442- Δs pyoS5::Gm bacterium solutions are mixed with the bacterium solution of 500 μ L recipient bacteriums 11092618 The LB flat boards of gentamicin, 30 DEG C of culture 24h are coated with after conjunction.During this by single exchange at side arm on genome A recombinant clone of whole target practice plasmid is inserted, selecting 21 is cloned into 12% sucrose at random on gentamicin resistance flat board Fluid nutrient medium shakes bacterium 12h, passes on secondary.By second pass for bacterium solution streak inoculation gentamicin (25 μ g/mL) resistant panel There is secondary restructuring in 30 DEG C of culture 24h, sucrose induction.

Embodiment 4 carries out the knockout pyoS5 genes of pseudomonas aeruginosa 11092618 and dashes forward by PCR and DNA sequencing technology The screening of mutant and identification

It is as follows that PCR amplification identifications knock out pyoS5 gene mutations strain primer sequence：

pyoS5-Gm-ST-F：Sequence 7 in 5'-AGCATGGCGAATGGCCTGCCACTGTGT-3'(sequence tables)

pyoS5-Gm-ST-R：Sequence 8 in 5'-GTTACCACCGCTGCGTTCGGTCAAGGTTCT-3'(sequence tables)

(amplification pyoS5 upstream region of gene homology arm and a part of 825bp of gentamicin resistance)

pyoS5-Gm-XT-F：Sequence 9 in 5'-GATCTACGTGCAAGCAGATTACGGTGACGA-3'(sequence tables) pyoS5-Gm-XT-R：Sequence 10 in 5'-CGACCACGATGGGCGACTCCAGCGTGCTGA-3'(sequence tables)

(amplification pyoS5 upstream region of gene homology arm and a part of 1422bp of gentamicin resistance)

pyoS5-inF：Sequence 11 in 5'-CAAGATGGAATCTGATCTTGAAGG-3'(sequence tables)

pyoS5-inR：Sequence 12 in 5'-CATCCTTGTGTTTTTCAAACGAATTG-3'(sequence tables)

(amplification pyoS5 Gene Partials DNA sequence dna 800bp)

Primer pyoS5-Gm-ST-F/R is across upstream homology arm and a part for gentamicin resistance, pyoS5-Gm- for identification XT-F/R is located at the inner side of genes of interest pyoS5 across downstream homology arm and a part for gentamicin resistance, pyoS5-inF/R Can be used to identify the knockout situation of genes of interest.

It is random to select two pipe bacterium solutions each one of gentamicin resistance flat board of line.Each plank selects 24 clones at random, Choose respectively into 20 μ L LB culture mediums, take in 1 μ L bacterium solution row pyoS5-Gm-ST-F/R, pyoS5-Gm-XT-F/R and pyoS5 genes The three pairs of checking primer PCR detections of side primer, carry out primary dcreening operation, see Fig. 2,3.

In order to ensure to knock out strain stabilization heredity, gentamicin (25 μ g/mL) resistant panel of continuously ruling three times, each flat board 8 monoclonals are chosen, equally with the three pairs of checkings of pyoS5-Gm-ST-F/R, pyoS5-Gm-XT-F/R and pyoS5 gene inner primer Primer PCR detects (such as Fig. 4), determines the strain of 46 plants of knockouts, and will verify that accurate bacterial strain send Hua Da to be sequenced, final to determine to stablize The knockout strain of heredity, is named as 11092618 Δ pyoS5.By knock-out bacterial strain be stored in -80 DEG C it is standby.

The growth characteristics test experience of embodiment 5

Under same culture conditions, take -80 DEG C and preserve bacterial strain 11092618,11092618 Δ pyoS5 inoculation LB liquid 3mL (15mL centrifuge tubes) 37 DEG C of shaking table 12h；Bacterium solution line LB flat boards, 37 DEG C of incubator culture 14h；Single bacterium colony inoculation LB liquid is chosen respectively 37 DEG C of shaking table 220rpm 12h of 3mL (15mL centrifuge tubes)；Bacterium solution is inoculated with 37 DEG C of LB liquid 100mL (300mL conical flasks) respectively Shaking table 220rpm, determines OD according to following point in time sampling respectively₆₀₀, preceding 3.75h 15min sampling once, then every 30min is sampled once, does growth curve finally sampling every 2h once.With incubation time as abscissa, OD₆₀₀It is vertical seat to be worth Mark, draws mutant strain and wild strain growth curve (such as Fig. 5), as a result finds that the growth rate of mutant strain is no with wild strain notable Sex differernce, has pointed out pyoS5 genes little with the growth characteristics relation of bacterial strain.

The pathogenic experiment of the mouse of embodiment 6

4 week old female BAl BIcs/c mouse 91, are randomly divided into 13 groups, every group 7, the every difference intraperitoneal injection of 1-6 groups 10^11.0, 10^10.0, 10^9.0, 10^8.0, 10^7.0With 10^6.011092618 bacterial strains of CFU are in 0.1mL PBS, 7-12 groups, every difference abdomen Chamber injection 10^11.0, 10^10.0, 10^9.0, 10^8.0, 10^7.0With 10^6.0The 11092618 Δ pyoS5 bacterial strains of CFU are in 0.85% physiology salt Water, the 13rd group of every 0.85% physiological saline of injection is compareed.The method of wherein intraperitoneal injection is as follows：Baoding mouse makes outside of belly court On, a low tail is high, takes the side of ventrimeson, makes syringe pin hole upwards, and needle point pastes stomach wall with subcutaneous less than 20 ° of directions piercings Syringe needle is slightly advanced to mouse head direction, then abdominal cavity is pierced into 45 ° of directions, pumpback is confirmed without slow after piercing blood vessel or enteron aisle Release liquid.Observe and record and attack 1 week clinical symptoms of interior mouse after poison, record death condition, and dead mouse is dissected, weight It is new to separate pathogenic bacteria.

According to the death condition of mouse under various dose, median lethal dose is calculated using Reed-Muench methods, wherein wild Bacterial strain 11092618 is 1.58 × 10 to the minimum lethal dose of BABL/c mouse⁶CFU, 11092618 Δ of knock-out bacterial strain pyoS5 pairs The minimum lethal dose of BABL/c mouse is 4.35 × 10⁷CFU.Two plants of bacterium are larger to the minimum lethal dose difference of BALB/c mouse, Wild-type strain virulence is apparently higher than pyoS5 gene knock-out bacterial strains.

The toxicity test result of the wild strain of table 1. and knock-out bacterial strain to BALB/c mouse

It is different with knock-out bacterial strain to wild strain to attack dead mouse under toxic agent amount and dissect, observation internal organs change, and Sterile sampling renewed vaccination hexadecane trimethyl ammonium bromide agar medium (NAC is distinguished from the heart, liver, spleen, lung, 5 internal organs of kidney Flat board), and through the separation situation again of PCR detection pathogenic strains, can be separated to and original inoculating strain form and physics and chemistry spy Property identical bacterium, explanation is that artificial infection causes.And by LD₅₀Comparing, the virulence of knock-out bacterial strain is more aobvious than wild strain Write and decline.The mutant strain can be applied to the exploitation of pseudomonas aeruginosa attenuated vaccine.

The pathogenic experiment of the mink of embodiment 7

7 monthly age minks 30, are equally divided into 3 groups, and every group 10,1 group is wild strain group, every mink injection 11092618,4 × 10^7.0CFU bacterium solutions 1mL；2 groups is knock-out bacterial strain group, every mink injection 11092618 Δ pyoS5,4 × 10^7.0CFU bacterium solutions 1mL.Result of the test show it is identical attack under toxic agent amount, knock out bacterium group The dead quantity less than wild mushroom group, further Demonstrate the virulence reduction of pseudomonas aeruginosa 11092618 after pyoS5 gene knockouts.

Above-described embodiment is not limited for the present invention preferably implementation method, but embodiments of the present invention by embodiment System, other it is any without departing from Spirit Essence of the invention and the change, modification made under principle, combine, substitute, simplify and should be Equivalence replacement mode, is included within protection scope of the present invention.

<110>Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricul

<120>Pseudomonas aeruginosa pyoS5 gene knockout mutant strains and construction method and application

<160> 14

<210> 1

<211> 42

<212> DNA

<213>Artificial sequence

<400> 1

ATATCTAGAG AGCTCAGCAT GGCGAATGGC CTGCCACTGT GT 42

<210> 2

<211> 42

<212> DNA

<213>Artificial sequence

<400> 2

CATGCATGCT TAGACTTCTC CATTGGTGAG TGTGGTACAG AA 42

<210> 3

<211> 40

<212> DNA

<213>Artificial sequence

<400> 3

CATGCATGCA ACCAAGCAAG GCCTCGTTAA ATCCTACGAG 40

<210> 4

<211> 45

<212> DNA

<213>Artificial sequence

<400> 4

GCGAAGCTTG AGCTCCGACC ACGATGGGCG ACTCCAGCGT GCTGA 45

<210> 5

<211>

<212> DNA

<213>Artificial sequence

<400> 5

ATAGCATGCA GAAATGCCTC GACTTC 26

<210> 6

<211> 31

<212> DNA

<213>Artificial sequence

<400> 6

ATAGCATGCT TGAGACAATT TACCGAACAA C 31

<210> 7

<211> 27

<212> DNA

<213>Artificial sequence

<400>7

AGCATGGCGA ATGGCCTGCC ACTGTGT 27

<210> 8

<211> 30

<212> DNA

<213>Artificial sequence

<400> 8

GTTACCACCG CTGCGTTCGG TCAAGGTTCT 30

<210> 9

<211> 30

<212> DNA

<213>Artificial sequence

<400>9

GATCTACGTG CAAGCAGATT ACGGTGACGA 30

<210> 10

<211> 30

<212> DNA

<213>Artificial sequence

<400>10

CGACCACGAT GGGCGACTCC AGCGTGCTGA 30

<210> 11

<211> 24

<212> DNA

<213>Artificial sequence

<400>11

CAAGATGGAA TCTGATCTTG AAGG 24

<210> 12

<211> 26

<212> DNA

<213>Artificial sequence

<400>12

CATCCTTGTG TTTTTCAAAC GAATTG 26

<210> 13

<211> 5038

<212> DNA

<213>Pseudomonas aeruginosa（Pseudomonas aeruginosa）

<400>13

gatggacctg ttgagcgagc tcgacgcaga ggacaaggtg atcctgttct gcgagttcaa 60

gccgaccgtg gctgcgctga aggaactctg cgagcaggcc ggacacggct gcgtcacgct 120

ggtgggcaat gactcgctca ccaagcggca gaaggcgata gttccaatcg cgcaggatcc 180

cgactgccga gtgttcatct gcactacggc ggccgcaggg acgggcaaca acctcactgc 240

ggcgaactac gtgtttttcc tcggcctgcc ctggactccc ggtcagcagg aacaagccga 300

agaccgcgcg taccgaaacg gccagctccg catggtcgtg gtgaaaatcc cactggtcga 360

ggccacgatc gacgagcaac tgtggcaact gctcaacgcg aaacgccagg ttgcccagga 420

cctcatcgag cccgagcagg tcgacggaaa ccgcgcgctt ttagccgcaa gcctaactgg 480

ataaaaaagc cctgatcctc cgccgagtat ttcctgctga agcatggcga atggcctgcc 540

actgtgtgcc tatcatcaaa gggggcctca atgaccaggc agttgaccac tctcacgctg 600

tgcctgctgc tcgccagctg cacgacccac aaggccgagc cggccaggcc agccttcgac 660

agcagccgca atccagacct gctctctccg gacctgtacc aaaacggtgt acatccgaga 720

aatagcccca gtgcaccatg ggtgctgtgc tagatcctaa tgggccccaa ctggatggtc 780

agcacgtttt aatggcttag gtcttcgacg tgtatctccc gtttaacatg gaacgcacaa 840

aactgtctct tcgcttgcta tccctatctt cacccttgaa tggtgttgcg gatcaagtag 900

ctgaattttg cagagagcat cacataccca gcgtgaatct tgagcgcatg aactcgttat 960

tagagataca tgactcttag ggaatatccc gtgggctcag ccaatcccat tcctgaatat 1020

cgagtttaag caaccgtgct tattaccact atatcacagc gcattgacgt gccttcttag 1080

tgcattgccc acacattgaa gccatggggt tcaatttcta gagctgaatc ggcactgttt 1140

ctgtaccaca ctcaccaatg gagaagtcta aatgtccaat gacaacgaag tacctggttc 1200

catggttatt gtcgcacaag gtccagacga tcaatacgca tacgaggttc cccctatcga 1260

tagcgcggcc gttgccggga atatgtttgg cgacttgatt caaagagaca tatatctaca 1320

gaaaaacatt tattatccag tccgatccat tgttgaacaa ggaacaaaag aaaagaagga 1380

gatcaacaag aaagtatctg atcaagtcga tggcttgcta aagcagatca ctcaaggaaa 1440

aagggaggcc acaaggcaag agcgagtcga tgtcatgtcg gcagtcctgc acaagatgga 1500

atctgatctt gaaggataca aaaagacctt taccaaaggc ccattcattg actacgaaaa 1560

gcagtcaagc ctctccatct atgaggcctg ggtcaagatc tgggagaaga actcttggga 1620

agaaagaaag aagtaccctt ttcagcagct tgttagagat gaactggagc gggcggttgc 1680

ctactacaaa caagattcac tctctgaagc ggtaaaagtg ctaagacagg agctcaacaa 1740

gcaaaaagcg ctaaaggaaa aagaggacct ctctcaactg gagcgggact acaaaaccag 1800

aaaggcgaat ctcgagatga aagtacaatc cgagcttgat caagcgggaa gtgctttgcc 1860

tccattggtc agtccaacgc cagagcaatg gcttgaacgt gccacaagac tggttacgca 1920

agcaattgct gataaaaagc agctgcagac cacaaacaat actcttatca agaatgcccc 1980

aacccctcta gaaaagcaga aagccatcta caatggtgag ctacttgtgg atgagatagc 2040

cagtctacag acccgcttag ataagctgaa cgccgaaacg acacgacgca ggacagaagc 2100

agaacgcaag gcggccgagg aacaagcgtt gcaagatgct gttaaattta ctgccgactt 2160

ttataaggaa gtaactgaga aatttggcgc acgaacatca gagatggcgc accaactggc 2220

cgaaggcgcc agggggaaaa atatcaggag ttcggcggaa gcaatcaatt cgtttgaaaa 2280

acacaaggat gcgttaaata aaaaacttag ccttaaagat aggcaagcca ttgccaaagc 2340

ctttgattct ctagacaagc agatgatggc gaagagcctt gagaaattta gcaaaggctt 2400

tggagttgta ggcaaagcta ttgacgccgc cagcctgtac caagagttca agatatctac 2460

ggaaaccggg gactggaaac cattctttgt aaaagttgaa acactagctg ctggtgcggc 2520

cgccagttgg cttgtgggta ttgcatttgc cacggcaacg gccactccta taggcatcct 2580

ggggttcgca ctggtaatgg cagttaccgg ggcgatgatt gacgaaggcc ttctagaaaa 2640

agcaaacaac cttgtaatgt ccatttaaaa ccaagcaagg cctcgttaaa tcctacgagg 2700

cctttccgta tttatagaat aaaaaaatca tccccaaggg aattgaaaac aaataacaag 2760

ccaaataaaa gactgcatac aatcctgttt ttgcaggggt ttcggagaaa aaacctgtga 2820

cccagaactc tttttccgta tattttaaag cgaagtcttc aacaagcctt accgagaaag 2880

gaaacaggat agtactgaat ccagccacta ccaaggggtt aactgatgcc aggcttggaa 2940

atacggagcc tttccaagcg actaaaacaa agaagaaagc tccccagaaa aatttagccc 3000

aatagtattt aaagctcaat tagcaccccg tactgtctga cctgagttca acaaagcatt 3060

ctaaaacgat tagaacttct attttatcca tttctaacaa cgattcccac ctggctcgct 3120

ttaggcgtaa catgaaaaac cttcatcgct cctaatccgt ttcccttacg cctgcctcgc 3180

tcaccctctg cctagtcatc gagaaatccc ctcccctgtt gccgagtatt tcctgctgat 3240

gcgtggcgga tggcctgcca ctgtgtgccc catcatcaaa gggggcctca atgaccaggc 3300

agttgaccac tctcacgctg tgcctgctgc tcgccagctg cacgacccac aaggctgagc 3360

cggccaggcc agccttcgac agcagccgca atccagacct gctttctccg gacctgtatc 3420

caaacggtgt gcagccggag aaagagcccg tagtgcgcta tgggcgctac accctggtca 3480

gcacccagcc tgatgccggt caacgcgacc tgatggccca gatcatcgac gtaaccatcc 3540

cgtcgagcat gaacccgagc gtcaaggacg ccatgcagta cgtgatgagc cgctcgggtt 3600

actcgctgtg cccggcagac gccggtcatg tgaacatcct ctacacccgg ccgctgccgg 3660

cagctcagta caagctcggc ccgatgaccc tgcgcaacac cctccaggtc ctctccggcc 3720

cagcctggca ggttaaggtc gacgaggtcg cgcggcaggt ctgcttcgtg ctgcgcccgg 3780

gctatcaact tcccccggcg ccgaggccga aaccggtcca gcaactgtat gcgaagcccg 3840

ctgccccaac tccgccggcg gtagcgcaac cctcctccac ggagaaagtc agcacgctgg 3900

agtcgcccat cgtggtcgcc tcggtgccga caccggcgcc gatcacaacc agccacgctc 3960

cggccaagaa gcctgaatcc accactgtgc tccccccagc cgcaccggcc aaggatggcc 4020

acccctcttc tcctcccgcg gcttcggcac cgaccaagcc tgcggcctcc gccgtgaagt 4080

ccacgccgcc cactccaccc accgtggctt ccgccccacc ggtcaaggtg ctcacgccgc 4140

cggaaccgag ccggccgctg gcacaggcct ggtcagccga gacgggatca accctgcgcg 4200

acaccttgga agcttgggca aagcgcgcac gctggaccgt ccgctgggag ccgcaggatc 4260

tcaactatcc gatcgaggct ccactgacct tccacggctc cttcgaggac gcggtatccg 4320

agctgttccc cctgtatgac gctgccgaac ggcccttcct ggtgaacgcc agccgcccgc 4380

agtccctgat catcatcaag gagcgcaaga actgatgcgt gcccccctga agaacctctt 4440

ggcttgcctc ctgatccccg cgctggccag ttgctcggtc acgcgggtga acgagtcggc 4500

ggatcgtgtc gaagctacgg cagattccgc gtctacgatc gcagcgcagg tgcgcaacac 4560

ccgaccggat cggcgcgata cggtggtgtt ctccgacaaa ccctgggtca gcacgaaacc 4620

cctaagcgtt tcgcacacct tgtccagtga ctgcatcgtg acgtggcgcc ctgcaggcgc 4680

agcgtcgctg caggaggccg cccaggaagt catcaaccaa tgccacatgg cggtcagtat 4740

cacgcccgac gcgctgaacc cggccgcctt cgccgtgcaa cctcagcagc gcgcgagcaa 4800

cgccccgccg cccatccaag gcggccagga catggccacc atgctgtttc ctgcctccgt 4860

cgccaacggc atgtcgctcg gtgccggcgg cagcatgggg tcgagcttcg ggtcctacgg 4920

tccgcggtct ctgtacaaca tcaaatggaa cggcaaagtc agcgggttcc tcgatctcat 4980

cgccgcccga gccggcgtgt cctggcgcta caacccaacc gagaaaaggg tcgagttc 5038

<210> 14

<211>2790

<212> DNA

<213>Artificial sequence

<400>14

agcatggcga atggcctgcc actgtgtgcc tatcatcaaa gggggcctca atgaccaggc 60

agttgaccac tctcacgctg tgcctgctgc tcgccagctg cacgacccac aaggccgagc 120

cggccaggcc agccttcgac agcagccgca atccagacct gctctctccg gacctgtacc 180

aaaacggtgt acatccgaga aatagcccca gtgcaccatg ggtgctgtgc tagatcctaa 240

tgggccccaa ctggatggtc agcacgtttt aatggcttag gtcttcgacg tgtatctccc 300

gtttaacatg gaacgcacaa aactgtctct tcgcttgcta tccctatctt cacccttgaa 360

tggtgttgcg gatcaagtag ctgaattttg cagagagcat cacataccca gcgtgaatct 420

tgagcgcatg aactcgttat tagagataca tgactcttag ggaatatccc gtgggctcag 480

ccaatcccat tcctgaatat cgagtttaag caaccgtgct tattaccact atatcacagc 540

gcattgacgt gccttcttag tgcattgccc acacattgaa gccatggggt tcaatttcta 600

gagctgaatc ggcactgttt ctgtaccaca ctcaccaatg gagaagtcta aagaaatgcc 660

tcgacttcgc tgctgcccaa ggttgccggg tgacgcacac cgtggaaacg gatgaaggca 720

cgaacccagt tgacataagc ctgttcggtt cgtaaactgt aatgcaagta gcgtatgcgc 780

tcacgcaact ggtccagaac cttgaccgaa cgcagcggtg gtaacggcgc agtggcggtt 840

ttcatggctt gttatgactg tttttttgta cagtctatgc ctcgggcatc caagcagcaa 900

gcgcgttacg ccgtgggtcg atgtttgatg ttatggagca gcaacgatgt tacgcagcag 960

caacgatgtt acgcagcagg gcagtcgccc taaaacaaag ttaggtggct caagtatggg 1020

catcattcgc acatgtaggc tcggccctga ccaagtcaaa tccatgcggg ctgctcttga 1080

tcttttcggt cgtgagttcg gagacgtagc cacctactcc caacatcagc cggactccga 1140

ttacctcggg aacttgctcc gtagtaagac attcatcgcg cttgctgcct tcgaccaaga 1200

agcggttgtt ggcgctctcg cggcttacgt tctgcccagg tttgagcagc cgcgtagtga 1260

gatctatatc tatgatctcg cagtctccgg cgagcaccgg aggcagggca ttgccaccgc 1320

gctcatcaat ctcctcaagc atgaggccaa cgcgcttggt gcttatgtga tctacgtgca 1380

agcagattac ggtgacgatc ccgcagtggc tctctataca aagttgggca tacgggaaga 1440

agtgatgcac tttgatatcg acccaagtac cgccacctaa caattcgttc aagccgagat 1500

cggcttcccg gccgcggagt tgttcggtaa attgtcacaa aaccaagcaa ggcctcgtta 1560

aatcctacga ggcctttccg tatttataga ataaaaaaat catccccaag ggaattgaaa 1620

acaaataaca agccaaataa aagactgcat acaatcctgt ttttgcaggg gtttcggaga 1680

aaaaacctgt gacccagaac tctttttccg tatattttaa agcgaagtct tcaacaagcc 1740

ttaccgagaa aggaaacagg atagtactga atccagccac taccaagggg ttaactgatg 1800

ccaggcttgg aaatacggag cctttccaag cgactaaaac aaagaagaaa gctccccaga 1860

aaaatttagc ccaatagtat ttaaagctca attagcaccc cgtactgtct gacctgagtt 1920

caacaaagca ttctaaaacg attagaactt ctattttatc catttctaac aacgattccc 1980

acctggctcg ctttaggcgt aacatgaaaa accttcatcg ctcctaatcc gtttccctta 2040

cgcctgcctc gctcaccctc tgcctagtca tcgagaaatc ccctcccctg ttgccgagta 2100

tttcctgctg atgcgtggcg gatggcctgc cactgtgtgc cccatcatca aagggggcct 2160

caatgaccag gcagttgacc actctcacgc tgtgcctgct gctcgccagc tgcacgaccc 2220

acaaggctga gccggccagg ccagccttcg acagcagccg caatccagac ctgctttctc 2280

cggacctgta tccaaacggt gtgcagccgg agaaagagcc cgtagtgcgc tatgggcgct 2340

acaccctggt cagcacccag cctgatgccg gtcaacgcga cctgatggcc cagatcatcg 2400

acgtaaccat cccgtcgagc atgaacccga gcgtcaagga cgccatgcag tacgtgatga 2460

gccgctcggg ttactcgctg tgcccggcag acgccggtca tgtgaacatc ctctacaccc 2520

ggccgctgcc ggcagctcag tacaagctcg gcccgatgac cctgcgcaac accctccagg 2580

tcctctccgg cccagcctgg caggttaagg tcgacgaggt cgcgcggcag gtctgcttcg 2640

tgctgcgccc gggctatcaa cttcccccgg cgccgaggcc gaaaccggtc cagcaactgt 2700

atgcgaagcc cgctgcccca actccgccgg cggtagcgca accctcctcc acggagaaag 2760

tcagcacgct ggagtcgccc atcgtggtcg 2790

Claims

1. a kind of pseudomonas aeruginosa pyoS5 gene knockout mutant strains, it is characterised in that construction method is as follows：

（1）The upstream and downstream homologous recombination arm of pyoS5 genes is expanded from Pseudomonas aeruginosa bacteria genome, while being cloned into The MCS region of pUC19 plasmids, obtains clone's pUC19- Δs pyoS5；

（2）To be expanded from pJQ200SK plasmids between the gentamicin resistance gene Gm for obtaining is cloned into upstream and downstream homology arm, obtained Obtain pUC19- Δs pyoS5::Gm plasmids；

（3）Target practice fragment upstream homology arm-gentamicin resistance gene-downstream homology arm, suicide plasmid is transferred to through subclone PCVD442, obtains target practice plasmid pCVD442- Δs pyoS5::Gm；

（4）pCVD442-ΔpyoS5::Gm is transferred to E. coli β 2155, obtains the pCVD442- of donor bacterium β 2155/ ΔpyoS5::Gm, is combined with recipient bacterium, and the verdigris that pyoS5 genes are replaced by Gm resistant genes is obtained by culture, screening Pseudomonad pyoS5 gene knockout mutant strains.

2. pseudomonas aeruginosa pyoS5 gene knockout mutant strains according to claim 1, it is characterised in that step（1）In The amplimer base sequence of the upstream homologous recombination arm is as follows：

pyoS5-1F:5'-ATATCTAGAGAGCTCAGCATGGCGAATGGCCTGCCACTGTGT-3',pyoS5-1R: 5'- CATGCATGCTTAGACTTCTCCATTGGTGAGTGTGGTACAGAA -3',

The amplimer base sequence of downstream homologous recombination arm is as follows：

pyoS5-2F: 5'-CATGCATGCAACCAAGCAAGGCCTCGTTAAATCCTACGAG -3',

pyoS5-2R: 5'-GCGAAGCTTGAGCTCCGACCACGATGGGCGACTCCAGCGTGCTGA -3',

The amplimer base sequence of gentamicin resistance gene Gm is as follows：

Sph I -Gm-F: 5'-ATAGCATGCAGAAATGCCTCGACTTC-3',

Sph I -Gm-R: 5'-ATAGCATGCTTGAGACAATTTACCGAACAAC-3'。

3. pseudomonas aeruginosa pyoS5 gene knockout mutant strains according to claim 1, it is characterised in that upstream and downstream is homologous It is connected with Sph I sites between restructuring arm, gentamicin resistance gene Gm is cloned into the Sph I sites between upstream and downstream homology arm.

4. pseudomonas aeruginosa pyoS5 gene knockout mutant strains according to claim 1, it is characterised in that step（4）In Obtained strains are identified during screening, the base sequence of PCR primer is as follows：

pyoS5-Gm-ST-F：5'-AGCATGGCGAATGGCCTGCCACTGTGT-3',

pyoS5-Gm-ST-R：5'-GTTACCACCGCTGCGTTCGGTCAAGGTTCT-3',

pyoS5-Gm-XT-F：5'-GATCTACGTGCAAGCAGATTACGGTGACGA-3',

pyoS5-Gm-XT-R：5'-CGACCACGATGGGCGACTCCAGCGTGCTGA-3',

pyoS5-inF：5'-CAAGATGGAATCTGATCTTGAAGG-3',

pyoS5-inR：5'-CATCCTTGTGTTTTTCAAACGAATTG-3'.

5. pseudomonas aeruginosa pyoS5 gene knockout mutant strains according to claim 1, it is characterised in that its growth curve With before pyoS5 gene knockouts without significant difference.

6. pseudomonas aeruginosa pyoS5 gene knockout mutant strains according to claim 1, it is characterised in that its virulence is less than Original strain before pyoS5 gene knockouts.

7. the pseudomonas aeruginosa pyoS5 gene knockout mutant strains described in a kind of claim 1-6 are preparing P. aeruginosa Application in bacterium attenuated vaccine.