CN108795832A - A kind of host strain, preparation method and its application of endogenous l-Asparaginase II gene knockouts - Google Patents

Abstract

The present invention relates to a kind of host strain, preparation method and its applications of endogenous l-Asparaginase II gene knockouts.Specifically, the present invention relates to a kind of methods knocking out the endogenous l-Asparaginase II genes of Escherichia coli, and obtain the host strain for knocking out the gene.In the way of targeting vector knockout, gene of the host strain genome without containing coding l-Asparaginase II and its variant.Using host strain provided by the invention, the l-Asparaginase II and its variant in the different microorganisms such as Erwinia, Escherichia source can be recombinantly expressed.

Description

A kind of host strain of endogenous l-Asparaginase II gene knockouts, preparation method and It is applied

Technical field

The present invention relates to field of biological pharmacy, and in particular to a kind of large intestine knocking out endogenous l-Asparaginase II genes The preparation method of bacillus host strain and the application of the host strain.

Background technology

L-Asparaginase II is a kind of deaminase that can be catalyzed asparagine hydrolysis and generate L-aminobutanedioic acid and ammonia.The enzyme energy Extracellular L- asparagines are removed, to prevent the growth of the cancer cell dependent on the progress protein synthesis of L- asparagines. Clinically, l-Asparaginase II is mainly used for treating acute lymphoblastic leukemia and lymthoma.

L-Asparaginase II preparations currently on the market derive from two kinds of microorganisms, i.e. escherichia coli (Escherichia coli) and Erwinia (Erwinia chrysanthemi), l-Asparaginase II are identical subunit The tetramer, molecular weight 141kDa, monomer non-enzymatic activity.The less appearance of l-Asparaginase II in both sources is crossing Quick reaction, according to the clinical research of institute of oncology of European Union, the effect of two kinds of enzymes, is close, but 29% leukaemic to large intestine The l-Asparaginase II of Escherichia has severe allergic reaction, it is necessary to use the l-Asparaginase in Erwinia chrysanthemi source II treatments could obtain satisfactory effect.Therefore, the l-Asparaginase II in Erwinia source can be used as multiple medicine chemotherapy regimen Component, suitable for treating the acute lymphoblastic leukemia for having hypersensitivity to the l-Asparaginase II of Escherichia Patient.

Patent CN101083118B extracts natural l-Asparaginase II from escherichia coli, and fermentation output of fluid is 10 units/mL.Patent CN 101831417A and patent CN 1397645A provide one kind and are extracted naturally from Erwinia body The method of l-Asparaginase II, fermentation output of fluid are 50-80 units/mL.Natural destination protein is obtained from above two strain, Low output, deficiency in economic performance.

By technique for gene engineering, extensive recombinant expression l-Asparaginase II can be industrialized.Mojtaba et al. (2011 Biharean Biologist.5(2):96-101) utilize the L- doors of BL21 (DE3) recombinant expression escherichia coli Winter amidase II, yield can reach 130 units/mL, Wu Jing et al. (2000 Chinese Pharmaceutical Journal .35 (4):268-272.) recombinate The l-Asparaginase II of escherichia coli AS1.357 is expressed, yield can reach 214 units/mL.But Escherichia coli can Background expresses l-Asparaginase II, and the l-Asparaginase II products obtained are mixed with the L- door winters of Escherichia coli background expression Amidase II leads to the inhomogenous of product purity, there is potential immunogenicity security risk.In addition impurity may also lead to human body Drug is formed immune, leads to treatment failure.

In order to solve this problem patent CN 101484181A, in BL21 (DE3) host strain, use free recombination Expression vector produces the l-Asparaginase II in the sources BL21, to obtain the l-Asparaginase II of uniform purity, still, this There is also the risks of ansB genes and host strain genomic instability for kind strategy.Kirill A. in 2000 et al. (2000 PANS.97(12):It 6640-6645.) finds, using the homologous sequence segment or plasmid with host strain target gene, by homologous The mode of recombination makes target gene be replaced or be inserted into genome of E.coli, to make Escherichia coli target gene lose work Property.But on the ansB genes (l-Asparaginase II genes) and genome of E.coli contained in free recombinant expression carrier AnsB gene very high homologies, it is most likely that occur homologous recombination, cause host strain genome structure change and gene activity funeral It loses, cannot continually and steadily express l-Asparaginase II.

In order to solve the risk of above-mentioned ansB genes and host strain genomic instability, we pass through gene knockout skill Art knocks out the l-Asparaginase II genes (ansB) of Escherichia coli itself, is allowed to that the L- door winters of itself cannot be expressed Amidase II.But and any gene of not all bacterium can successfully carry out gene knockout, to the gene knockout of bacterium Technological difficulties are that there are many factor for influencing recombination efficiency, such as bacterium kind, hypotype, the gene being knocked, competent cell State, the differences such as operating method, recombination efficiency widely different (snow etc., 2008 Chinese biological engineering magazine .28 (12):89- 93.).In addition, the target practice sequence selection of targeting vector is improper, it is very low and knock out failure to also result in recombination efficiency, suitably beats Target sequence and targeting vector are most important.

Targeting vector provided by the invention contains sacB genes, will not leave the residual of any exogenous sequences in the genome It stays, gene caused by homologous recombination caused by not interfering with the subsequent genetic manipulation of genome and remaining exogenous sequences possibility Unstability.In a preferred embodiment of the present invention, using targeting vector provided by the invention, for the first time in BL21 (DE3) traceless knockout ansB genes are successfully made in bacterial strain.The host strain provided using this patent, can be to avoid free recombination AnsB genes in expression vector and the ansB genes on host strain genome occur caused by homologous recombination ansB genes and Host strain genomic instability, in addition, the host strain provided using this patent, can recombinantly express Erwinia, angstrom Xi Shi The l-Asparaginase II and its variant of the uniform purity in the different microorganisms such as bacterium source meet clinically multiple medicine chemotherapy regimen group The demand of conjunction.

Invention content

The present invention provides a kind of method knocking out endogenous l-Asparaginase II genes, and obtains the large intestine for knocking out the gene Bacillus (bacillus coli, E.coli) host strain, wherein the host strain genome does not contain encoding endogenous L- The gene of winter amidase II and its variant.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the host strain is to pass through The expressive function frame that targeting vector knocks out coding l-Asparaginase II in bacterium obtains, the target practice sequence that the targeting vector includes It is classified as SEQ ID NO:1, sequence is as follows：

GCAATCTGGTGATCACGCCAGACGGCAACGTGATGTATAACGGTAAGCAATATTCCCTGAATGCCGCCC AGCGCGAGCAGGCGAAGGATTATCAGGCTGAACTACGCAGCACGCTGCCGTGGATTGATGAAGGCGCGAAAAGCCGC GTCGAAAAAGCCCGTATTGCGCTGGATAAAATTATCGTTCAGGAGATGGGCGAAAGCAGCAAAATGCGCAGCCGTCT GACCAAACTTGATGCGCAGCTGAAAGAGCAGATGAACCGCATTATCGAAACGCGCAGCGATGGCCTGACGTTTCACT ATAAAGCCATTGATCAGGTTCGCGCCGAAGGCCAGCAATTAGTGAATCAGGCAATGGGCGGAATTTTACAGGACAGC ATTAATGAAATGGGCGCGAAAGCGGTGCTGAAAAGCGGCGGTAACCCATTACAGAACGTGCTGGGAAGCCTGGGCGG CCTGCAATCCTCAATCCAAACCGAGTGGAAAAAGCAGGAAAAAGATTTCCAGCAGTTTGGCAAAGATGTTTGTAGCC GCGTTGTGACTCTGGAAGATAGCCGCAAAGCCCTGGTCGGGAATTTAAAATAATCCTCTATTTTAAGACGGCATAAT ACTTTTTTATGCCGTTTAATTCTTCGTCACTTCGCCCCGGTATCGTGCCGGGGCTTATTCACTTCAGACTCACGTCC ATTGCCAATTTTTATTACCCTAATGATAATCACCGGAATAAATTATTCCGCGCGAGGGTTTTCGGGTGAAAAAGCAA TGGATTGTTGGTACGGCGCTGCTTATGTTGATGACTGGTAATGTCCGGGCAGATGGTGAACCGCCAACTGAAAATAT CTTAAAAGATCAATTCAAAAAGCAGTATCACGGCATTCTCAAGCTTGATGCCATCACCTTAAAAAATCTTGATGCTA AGGGTAATCAGGCCACCTGGTCAGCGGAAGGCGATGTCTCTTCCAGTGACGATCTCTATACCTGGGTCGGTCAGTTG GCAGATTACGAGCTGCTCGAACAGACCTGGACGAAAGATAAACCGGTGAAATTCTCGGCGATGTTAACCAGTAAAGG AACGCCCGCGTCTGGCTGGTCGGTGAACTTTTACTCTTTTCAGGCGGCAGCCAGCGATCGTGGGCGGGTGGTTGACG ATATCAAAACGAATAATAAATATCTGATCGTGAATAGCGAAGATTTCAATTATCGCTTTAGTCAGCTTGAGTCTGCG TTGAATAACCAG

The present invention further provides a kind of methods preparing host strain of the present invention, and wherein the method is to pass through gene Knockout technology knocks out the expressive function frame of coding l-Asparaginase II in bacterium；

The expressive function frame includes the coded sequence, promoter sequence, signal sequence of L-Asparaginasum II；

The gene Knockout is selected from the gene that gene knockout, the CRISPR/Cas9 that suicide plasmid pCVD is mediated are mediated Gene knockout, the Cre-LoxP that gene knockout, the II type Intron insertions that knockout, Red/ET recombinations mediate mediate recombinate mediation Gene knockout, TALEN gene targetings, RNA interference；Gene knockout, the CRISPR/Cas9 of preferably suicide plasmid pCVD mediations are situated between The gene knockout led.

The gene knockout method that the suicide plasmid pCVD is mediated includes the following steps：

(1) structure of the amplification of target practice sequence and targeting vector

(2) structure and mating experiment of donor bacterium

(3) screening and identification of positive colony bacterium

In a preferred embodiment of the present invention, targeting vector of the present invention, wherein the targeting vector Containing sacB genes, the residual of any exogenous sequences will not be left in the genome, do not interfere with the subsequent heredity behaviour of genome Genic instability caused by homologous recombination caused by work and remaining exogenous sequences are possible.Use target practice provided by the invention Carrier is successfully made traceless knockout ansB genes, to obtain host provided by the invention in BL21 (DE3) bacterial strain for the first time Bacterium.

The host strain can industrialize the L- door winters in the multiple-microorganism source for recombinantly expressing uniform purity on a large scale Amidase II meets the needs of clinically multiple medicine combination chemotherapeutic regimens.Such as the L- door winters from e. coli bl21 strain Amidase II sequences (SEQ ID NO:2) the l-Asparaginase II sequences (SEQ of Escherichia coli AS1.357 strains, is derived from ID NO:3) l-Asparaginase II sequences (the SEQ ID of Erwinia Erwinia chrysanthemi strains, are derived from NO:4).The l-Asparaginase II for wherein deriving from Erwinia can treat the L- door winter acyls to escherichia coli source Amine enzyme II has the Patients With Acute Lymphoblastic Leukemia of hypersensitivity.The enzyme product obtained using host strain recombinant expression, Other l-Asparaginase II variants without containing detectable amount, while avoiding ansB genes and host strain gene in recombinant bacterium The problem of group unstability.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the host strain is selected from greatly Enterobacteria BL21 (DE3), BLR (DE3), Rosetta (DE3), Origami (DE3), JM109, HSM174 (DE3), AS1.357, DH5α。

The present invention further provides a kind of methods knocking out the endogenous l-Asparaginase II genes of Escherichia coli, wherein using Targeting vector of the present invention knocks out obtained host strain genome without containing coding large intestine in the way of homologous recombination The gene of the endogenous l-Asparaginase II of bacillus and its variant.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the host strain is for weight The l-Asparaginase II and its variant in group expression different microorganisms source；

The recombinant expression mode is selected to be expressed by the recombinant expression carrier for being free on host strain genome, or is passed through It expresses in one section of sequence to host strain genome of site-directed integration, is preferably expressed by recombinant expression carrier；

The microorganism preferably is selected from Erwinia or Escherichia.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the different microorganisms are come The l-Asparaginase II in source and its nucleotide sequence of variant be selected from from microorganism Erwinia chrysanthemi, The L- door winters of Escherichia coli DH5 α, Escherichia coli BL21, Escherichia coli AS1.357 The variant of amidase II nucleotide sequences and the l-Asparaginase II nucleotide sequences in mentioned microorganism source；It is preferred that SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4。

The l-Asparaginase II nucleotide sequences are selected from, but are not limited to the sequence in following table 1, L- asparagines Enzyme II nucleotide sequences can be with (but the sequence being not limited in table 2) the SEQ ID of signal peptide sequence in table 2 NO:5, SEQ ID NO:6 arbitrary combinations.

1 l-Asparaginase II sequences of table

The variant of the l-Asparaginase II nucleotide sequences includes being carried out to the base of the nucleotide sequence The mutation such as replacement, insertion, missing.

Invention further provides the l-Asparaginase using host strain recombinant expression multiple-microorganism source The method of II, the described method comprises the following steps：

(1) nucleotide sequence of method for synthesizing gene synthesis l-Asparaginase II is used

(2) nucleotide sequence of synthesis is connect with carrier, builds recombinant expression carrier

(3) recombinant expression carrier built recombinantly expresses in host strain of the present invention

In a preferred embodiment of the present invention, host strain of the present invention, wherein described be free on host strain The recombinant expression carrier of genome includes the nucleotide sequence for encoding any l-Asparaginase II subunits；The fixed point is whole The one section of sequence closed includes to encode the nucleotide sequence of any l-Asparaginase II subunits.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the recombinant expression carrier For plasmid, it preferably is selected from substrate for induction expression vector, thermal induction expression vector, nutrition limitation inducible expression carrier, constitutive expression Carrier, more preferable substrate for induction expression vector, most preferably pET series.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the expression vector includes Promoter, operon, ribosome bind site, transcription terminator, antibiotic selected marker, replication orgin, checks signal sequence The copy in protein binding area.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the promoter is selected from door The natural promoter of winter amidase II, T7, T7/lac, T5, T5/lac, araBAD, rhaBAD, Tac, lacUV5, Lac, tetA, PhoA, λ PL, Sp6, trp, preferably T7 promoters, T5 promoters.

In a preferred embodiment of the present invention, host strain of the present invention, wherein the signal sequence is selected from Natural signals peptide native, pelB of L-Asparaginasum II, ompA, STII, phoA, ompT, ompC, tolB, torA, torT, DsbA, lamB, MglB, glII, sufI, SfmC, malE, EOX, MmAp, preferred signals sequence are native, pelB.

The signal sequence can arbitrarily be combined with l-Asparaginase II sequences, and signal peptide sequence is selected from, but is not limited to Sequence in following table 2.

2 signal peptide sequence of table

Title code name	L-Asparaginasum II signal peptides and its variant sequence thereof	Sequence number
			NATIVE	MEFFKKTALAALVMGFSGAALA	5
PELB	MKYLLPTAAAGLLLLAAQPAMA	6

The transcription terminator includes T7 terminators, Lambda bacteriophage T0 terminators, rrnB terminators, bacteriophage fd ends Only son etc., preferably T7 terminators, Lambda bacteriophage T0 terminators.

Description of the drawings

Fig. 1 .PCR method sldh genes knock out bacterium BL21 (DE3)/Δ ansB and wild mushroom BL21 (DE3).1,11：Marker (2000,1000,750,500,250,100)；6：Marker (10000,7000,4000,2000,1000,500,250)；2,7： BL21 (DE3) bacterium genome；3,8：Primer free negative control；4,5,9,10：BL21 (DE3)/Δ ansB bacterium genomes.

The growth curve of Fig. 2 clpp gene degerming BL21 (DE3)/Δ ansB and wild mushroom BL21 (DE3).AnsB genes Knockout has no significant effect the growth of bacterial strain.

The background of Fig. 3 .L- L-Asparaginasums II is expressed.1：Marker12(kD：200,116.3,97.4,66.3,55.4, 36.5,31,21.5,14.4,6,3.5)；2：BL21 (DE3) pericentral siphon；3：BL21 (DE3)/Δ ansB pericentral siphons；4：BL21 (DE3) is complete Bacterium；3：BL21 (the DE3)/full bacterium of Δ ansB.

Specific implementation mode

As alleged by the present invention " knockout " include with gene Knockout lack the target polynucleotide all or part of. For example, knocking out can be realized by changing target polynucleotide sequence, the change is by the target polynucleotide sequence The insertion and deletion in the functional domain (for example, DNA binding structural domains) of the target polynucleotide sequence is induced to carry out.Base It is selected from gene knockout, the Red/ET recombinations that gene knockout, the CRISPR/Cas9 that suicide plasmid pCVD is mediated are mediated because knocking out technology Gene knockout, the TALEN of gene knockout, Cre-LoxP recombination mediations that gene knockout, the II type Intron insertions of mediation mediate Gene targeting, RNA interference；The gene knockout system of gene knockout, CRISPR/Cas9 mediations that preferably suicide plasmid pCVD is mediated It unites to knock out target polynucleotide or part thereof.

As alleged by the present invention " endogenous l-Asparaginase II " refers to that e. coli host bacteria bacterial strain autogene group carries , non-present invention purpose expresses l-Asparaginase II genes.

As alleged by the present invention " external source l-Asparaginase II " refers to that non-e. coli host bacteria bacterial strain autogene group is taken Band, it is introduced through manual operation, and to the purpose l-Asparaginase II genes of high efficient expression.

" homologous recombination (homologous recombination) " is to position foreign gene to import recipient cell gene Method in group, because there is the sequence homologous with quiding gene at the seat, by single or double crossing over, new gene segment can be replaced Original genetic fragment (endogenous gene segment) on recipient cell genome is changed, achieve the purpose that modification or knocks out endogenous gene. Locus specificity recombination is the recombination being happened on two DNA chain specific sites, and it is spy that the generation of recombination, which needs one section of homologous sequence, Anisotropic site (also known as attachment point；Attachmentsite, att) and locus specificity protein factor, that is, recombinase participation urge Change.Recombinase is only capable of the recombination between catalysis specific position, thus recombinates with specific and well-conserved.

" expression vector (Expression vectors) " is to increase expression member on the basis of cloning vector basic framework Part (such as promoter, RBS, terminator), the carrier for enabling target gene to express." recombinant expression carrier " is in expression vector Upper recombination has external source or target gene, enables carrier after the recombination that target gene expresses.

It is used to further describe the present invention with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

Embodiment 1：The knockout of ansB genes on BL21 (DE3) genome

1. design of primers

According to ansB genes upstream and downstream sequence design upstream on BL21 (DE3) genome and downstream homologous recombination arm primer, Connection primer, identification primer of the upstream with downstream homologous recombination arm, primer sequence are shown in Table 3.

3 primer sequence of table

2, the structure of the amplification of target practice sequence and targeting vector

Using genome extraction agent box (Genomic DNA Purification Kit, Promega) extracting For the genome of BL21 (DE3) as pcr template, primer is upstream and downstream homologous recombination arm primer (SEQ ID NO:7 to SEQ ID NO:10), using high-fidelity DNA polymerase (PlatinumTaq, Invitrogen) amplification upstream and downstream homologous recombination Arm.Use connection primer (the SEQ ID NO of upstream and downstream homologous recombination arm:11), fusion upstream and downstream homologous recombination arm, Obtain target practice sequence SEQ ID NO:1.

DH5 α λ pir/pCVD442 strains (giving birth to work biology in Shanghai) are inoculated with, pCVD442 (Addgene, 11074) matter is extracted Grain.Target practice sequence and pCVD442 plasmids are subjected to XbaI (Fermentas) digestion processing, purifying of tapping rubber (SV Gel and PCR Clean-Up System,Promega).By the target practice sequence and pCVD442 T4 ligases after above-mentioned digestion (New England Biolabs) is connected.Connection product bacillus coli DH 5 alpha λ pir are transferred to by electrotransformation method (to give birth in Shanghai Work biology).Extract plasmid (Pure Yield^TMPlasmid Midiprep System, Promega) it is targeting vector： pCVD442-ΔansB。

3, the structure and mating experiment of donor bacterium

The targeting vector electrotransformation is entered into 2155 bacterial strains of Escherichia coli β (giving birth to work biology in Shanghai), is as used to engage reality The F+strain β 2155/pCVD442- Δs ansB tested.By recipient bacterium BL21 (DE3) and donor bacterium β 2155/pCVD442- Δs AnsB mixed culture makes to engage.Mixed bacteria liquid is taped against on 0.22 μm of sterilised membrane filter (MILLIPORE) and is cultivated, physiology salt is used Water elution is applied on Amp resistance LB tablets.Multiple clones are selected at random, are detected using Outside primer PCR, if there is double items Band amplification, corresponds to wild type (2.7kb) and deletion type (1.5kb), then judges that this clone may be that a homologous recombination occurs Positive colony, be named as BL21 (DE3)/pCVD442- Δs ansB.

4, the screening and identification of secondary homologous recombination positive colony bacterium

Take an above-mentioned homologous recombination positive colony bacterium solution streak inoculation to LB sucrose plates.Multiple clones are selected at random, PCR detections are carried out using Outside primer.If amplified production is the single bands of 1.5kb, which is that generation is secondary homologous heavy The positive colony of group.

The above-mentioned doubtful positive colony of secondary homologous recombination screened of picking, carries out PCR identifications, and qualification result is shown in Fig. 1.Sun Property clone bacterium be Outside primer amplified production be 1.5kb (deletion type), the mrna length of deletion is 1.2kb, and inner primer is without expansion Increase production object, it is 2.7kb (wild type), the amplified production of inner primer that the amplification of negative clone, which is Outside primer amplified production, For 600bp.Sequencing, sequencing result is sent to turn out to be ansB gene elmination types clone, be named as BL21 Outside primer amplified production (DE3)/ΔansB。

Embodiment 2：The comparison of wild mushroom BL21 (DE3) and clpp gene degerming BL21 (DE3)/Δ ansB growth characteristics

LB culture mediums are prepared, are formulated as 1%Tryptone, 0.5%yeast extract, 1%NaCl.With 0.5% ratio 5mL seed culture mediums are inoculated in, 50mL miniature organisms reactor (Mini Bioreactor, Corning), 37 DEG C, 220rpm is trained It supports to exponential phase, it is parallel to be 3 250mL shaking flasks (Erlenmeyer with the switching of 2% ratio in 50mL LB culture mediums Flask, Corning), it is sampled every 30min or 1h, with UV spectrophotometer measuring OD₆₀₀Value.Using the time as abscissa, OD₆₀₀Value is that ordinate draws growth curve, sees Fig. 2.

Formula 1：

In formula, μ is specific growth rate, unit h^-1, T2-T1 is that microorganism is cultivated from time point T1 to time point T2 The time spent in, unit h, the cell concentration of microorganism when N1 is time point T1, the cell concentration of microorganism when N2 is time point T2.

The data obtained is handled using formula 1, passes through statistics t check analyses, under p=0.05 levels, gene Knock out the average specific growth rate of bacterium BL21 (DE3)/Δ ansB and wild mushroom BL21 (DE3) (Novagen, 69450-4CN) without Significant difference.

Embodiment 3：The l-Asparaginase II sheets of wild mushroom BL21 (DE3) and clpp gene degerming BL21 (DE3)/Δ ansB It expresses at bottom

Seed culture medium is prepared, is formulated as 1%Tryptone, 0.5%yeast extract, 1%NaCl, 0.1%L- Asparagine prepares background and expresses culture medium, is formulated as 1%Tryptone, 0.5%yeast extract, 1%NaCl, 0.6%L-asparagine.Glycerol stock is taken, 5mL seed culture mediums, 50mL miniature organism reactors are inoculated in 0.1% ratio (Mini Bioreactor, Corning), 25 DEG C, 150rpm is cultivated to OD₆₀₀=4 or so (16-18 hours).Turned with 4% ratio It is connected in 30mL backgrounds expression culture medium, 125mL flat-bottom shaker bottles (Erlenmeyer Flask, Corning), 25 DEG C, 150rpm Cultivate 14h.8000rpm centrifuges 5min and collects thalline, and osmometry extracts periplasm protein (with reference to pET handbooks), dense using 10kD The draw (Spin-UF 20, Corning) it is suitably concentrated, SDS-PAGE electrophoretic analysis.As a result see Fig. 3, clpp gene degerming Without 35KD respective straps in the pericentral siphon of BL21 (DE3)/Δ ansB and full bacterium, pericentral siphon and the full bacterium of control bacterium BL21 (DE3) exist 35KD has respective strap, it was demonstrated that endogenous gene knocks out successfully, eliminates background expression.

Embodiment 4：The structure of recombinant strains and expression

1, gene chemical synthesis

Recombinant L-asparaginase II expression cassettes nucleotide sequence is synthesized by Nanjing Jin Sirui biotech firms.Its expression cassette is compiled Code sequence is selected from, but is not limited to signal peptide sequence SEQ ID NO:5,SEQ ID NO:6 and l-Asparaginase II sequences SEQ ID NO:2,SEQ ID NO:3,SEQ ID NO:4 arbitrary combination.Expression cassette 1 is by NATIVE signal peptide sequences in the present embodiment SEQ ID NO:5 and SEQ ID NO:2 combined sequences, expression cassette 2 is by SEQ ID NO:5 and SEQ ID NO:3 combined sequences, table Up to frame 3 by SEQ ID NO:5 and SEQ ID NO:4 combined sequences hold addition Nde I digestions position in above-mentioned expression cassette code area 5 ' Point, 3 ' end addition BamH I restriction enzyme sites.

2, the structure of recombinant strains：pET9a-native-ansB-1/BL21(DE3)/ΔansB,pET9a- native-ansB-2/BL21(DE3)/ΔansB、pET9a-native-ansB-3/BL21(DE3)/ΔansB

Using NdeI and BamHI restriction endonucleases (Fermentas) respectively to recombinating cloned plasmids (pUC57-native-ansB- 1, pUC57-native-ansB-2, pUC57-native-ansB-3) and expression vector pET9a progress double digestions.It is returned using glue Receipts kit (SV Gel and PCR Clean-Up System, Promega) to target gene fragment (native- AnsB-1, native-ansB-2, native-ansB-3) and the progress glue recycling of expression vector pET9a digestion products, it is connected with T4 Enzyme (New England Biolabs) carries out DNA with expression vector recycling segment to target gene fragment and connects.By connection product Escherichia coli DH5a competence is converted, Kan resistance LB plate screening recons are applied to.Picking positive colony sequencing is verified.It adopts Use CaCl₂Method prepares BL21 (DE3)/Δ ansB competent cells, and the correct recombinant expression carrier of sequence verification is transformed into In BL21 (DE3)/Δ ansB, that is, obtain above 3 recombinant strains.

3, the shaking flask induced expression of recombinant strains

The correct positive colony of sequence verification is inoculated into the LB culture mediums that 5ml contains 2% glucose and is cultivated to logarithm Phase.2% ratio is transferred in the LB culture mediums that 50ml contains 0.5% glucose, 37 DEG C of cultures to OD₆₀₀=0.8 or so.Cooling It is adapted to 30 DEG C to OD₆₀₀Final concentration 0.2mM IPTG inductions, 30 DEG C of constant-temperature tables are added in=1.0 or so (about 30min) 220rpm shaken cultivations 4 hours, after expression, 6000rpm, which is centrifuged, takes supernatant for 5 minutes, and Nessler's reagent method detects enzymatic activity, inspection Survey method is shown in embodiment 5.

The active detections of embodiment 5L- L-Asparaginasums II

Using the enzymatic activity of Nessler's reagent method detection l-Asparaginase II, the Enzyme assay result of shaking flask induced expression It is shown in Table 4.

1, the making of standard curve

Drying learn from else's experience to the ammonium sulfate of constant weight, the ammonium sulfate (1.2mmol/ of 5 concentration gradients is prepared in volumetric flask L,1.5mmol/L,2.0mmol/L,2.5mmol/L,3.0mmol/L).This five each 0.15mL of concentration are taken to be added in test tube, Blank tube is 0.15mL water, and water 2.10mL and Nessler's reagent 0.3mL mixings is added into test tube respectively, is stored at room temperature 10 minutes, Light absorption value is measured at 405nm wavelength.Using light absorption value as ordinate, the amount of ammonia is that abscissa makes standard curve in solution.

2, the preparation of sample to be tested

Sample to be tested is suitably diluted with 0.02mol/L tris solutions (pH 7.0), makes every 1mL The middle about l-Asparaginase II containing 3 units.2, test tube is taken, it is each that 0.01mol/L L- asparagine solution 0.60mL are added, It is preheated 5 minutes in 37 DEG C of water-baths.Above-mentioned solution 0.20mL is respectively added, sets in 37 DEG C of water-baths, accurate response 10 minutes adds immediately Enter each 0.20mL of 30% solution of trichloroacetic acid, shakes up.

3, assay method

Reference substance (2.5mmol/L ammonium sulfates), each 0.15mL of sample to be tested is taken to set in test tube, blank 0.15mL 0.02mol/L tris solutions.Every part parallel to do 2 pipes, and respectively plus water 2.0mL and mercury potassium iodide solution (take iodate Mercury 23g, potassium iodide 16g add water to 100mL, are mixed in equal volume with 20% sodium hydroxide solution before use) 0.3mL, mixing.Room Temperature is placed 10 minutes, at 405nm wavelength, is measured light absorption value respectively, is calculated average value, be calculated as follows.

Formula 2：

Potency unit defines：Under these conditions, a l-Asparaginase II unit is equivalent to decomposition L- per minute Winter amide generates the enzyme amount needed for 1 μm of ol ammonia.

The Enzyme assay of 4 l-Asparaginase II recombinant expressions of table

Sample ID	Enzymatic activity (unit/mL)
		pET9a-native-ansB-1/BL21(DE3)/ΔansB	22.2
pET9a-native-ansB-2/BL21(DE3)/ΔansB	25.8
		pET9a-native-ansB-3/BL21(DE3)/ΔansB	27.3
pET9a/BL21(DE3)/ΔansB	0.46
		BL21(DE3)/ΔansB	0.39
LB culture mediums	0.42

The purifying of 6 l-Asparaginase II of embodiment prepares and identification

The seed of l-Asparaginase II is produced after culture and fermentation, thalline were collected by centrifugation.The thalline of harvest is hanged Float on and be homogenized break process in PBS buffer solution, supernatant is collected by centrifugation.The ammonium sulfate of 50% saturation degree is added in supernatant, Centrifugation removal precipitation, the purification of samples of certain purity is obtained using hydrophobic chromatography column and ion exchange column.It will purifying gained AnsB-1, ansB-2, ansB-3 purification of samples carry out LC-MS and SEC-HPLC detections, Testing and appraisal the results are shown in Table 5.

The identification of 5 l-Asparaginase II purification of samples of table

Sample ID	Purity	Theoretical molecular weight	LC-MS	SEC-HPLC
					ansB-1(BL21)	98.3%	34593.90	34593.24	138375.42
ansB-2(AS1.357)	99.8%	34546.83	34546.31	138187.73
					ansB-3(Erwinia)	98.7%	34176.07	34175.92	136703.86

Sequence table

<110>Hengrui Medicine Co., Ltd., Jiangsu Prov.

<120>A kind of host strain, preparation method and its application of endogenous l-Asparaginase II gene knockouts

<130> 2017

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 1236

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

gcaatctggt gatcacgcca gacggcaacg tgatgtataa cggtaagcaa tattccctga 60

atgccgccca gcgcgagcag gcgaaggatt atcaggctga actacgcagc acgctgccgt 120

ggattgatga aggcgcgaaa agccgcgtcg aaaaagcccg tattgcgctg gataaaatta 180

tcgttcagga gatgggcgaa agcagcaaaa tgcgcagccg tctgaccaaa cttgatgcgc 240

agctgaaaga gcagatgaac cgcattatcg aaacgcgcag cgatggcctg acgtttcact 300

ataaagccat tgatcaggtt cgcgccgaag gccagcaatt agtgaatcag gcaatgggcg 360

gaattttaca ggacagcatt aatgaaatgg gcgcgaaagc ggtgctgaaa agcggcggta 420

acccattaca gaacgtgctg ggaagcctgg gcggcctgca atcctcaatc caaaccgagt 480

ggaaaaagca ggaaaaagat ttccagcagt ttggcaaaga tgtttgtagc cgcgttgtga 540

ctctggaaga tagccgcaaa gccctggtcg ggaatttaaa ataatcctct attttaagac 600

ggcataatac ttttttatgc cgtttaattc ttcgtcactt cgccccggta tcgtgccggg 660

gcttattcac ttcagactca cgtccattgc caatttttat taccctaatg ataatcaccg 720

gaataaatta ttccgcgcga gggttttcgg gtgaaaaagc aatggattgt tggtacggcg 780

ctgcttatgt tgatgactgg taatgtccgg gcagatggtg aaccgccaac tgaaaatatc 840

ttaaaagatc aattcaaaaa gcagtatcac ggcattctca agcttgatgc catcacctta 900

aaaaatcttg atgctaaggg taatcaggcc acctggtcag cggaaggcga tgtctcttcc 960

agtgacgatc tctatacctg ggtcggtcag ttggcagatt acgagctgct cgaacagacc 1020

tggacgaaag ataaaccggt gaaattctcg gcgatgttaa ccagtaaagg aacgcccgcg 1080

tctggctggt cggtgaactt ttactctttt caggcggcag ccagcgatcg tgggcgggtg 1140

gttgacgata tcaaaacgaa taataaatat ctgatcgtga atagcgaaga tttcaattat 1200

cgctttagtc agcttgagtc tgcgttgaat aaccag 1236

<210> 2

<211> 326

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 2

Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly

1 5 10 15

Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Ala Gly Lys Val Gly Val

20 25 30

Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val

35 40 45

Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Asp

50 55 60

Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr

65 70 75 80

Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala

85 90 95

Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val

100 105 110

Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn

115 120 125

Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn Arg

130 135 140

Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val

145 150 155 160

Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr

165 170 175

Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr

180 185 190

Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu

195 200 205

Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser

210 215 220

Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly Ile Val

225 230 235 240

Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Thr Val Phe Asp Thr

245 250 255

Leu Ala Thr Ala Ala Lys Asn Gly Thr Ala Val Val Arg Ser Ser Arg

260 265 270

Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys

275 280 285

Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val

290 295 300

Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Gln Gln Ile Gln

305 310 315 320

Gln Ile Phe Asn Gln Tyr

325

<210> 3

<211> 326

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 3

Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly

1 5 10 15

Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Ala Gly Lys Val Gly Val

20 25 30

Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val

35 40 45

Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Val Asn Asp Asn

50 55 60

Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr

65 70 75 80

Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala

85 90 95

Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val

100 105 110

Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn

115 120 125

Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn Arg

130 135 140

Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val

145 150 155 160

Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr

165 170 175

Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr

180 185 190

Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu

195 200 205

Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser

210 215 220

Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly Ile Val

225 230 235 240

Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Ser Val Phe Asp Thr

245 250 255

Leu Ala Thr Ala Ala Lys Asn Gly Thr Ala Val Val Arg Ser Ser Arg

260 265 270

Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys

275 280 285

Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val

290 295 300

Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Gln Gln Ile Gln

305 310 315 320

Gln Ile Phe Asn Gln Tyr

325

<210> 4

<211> 324

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 4

Leu Pro Asn Ile Val Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Ser

1 5 10 15

Ala Ala Ala Asn Thr Gln Thr Thr Gly Tyr Lys Ala Gly Ala Leu Gly

20 25 30

Val Glu Thr Leu Ile Gln Ala Val Pro Glu Leu Lys Thr Leu Ala Asn

35 40 45

Ile Lys Gly Glu Gln Val Ala Ser Ile Gly Ser Glu Asn Met Thr Ser

50 55 60

Asp Val Leu Leu Thr Leu Ser Lys Arg Val Asn Glu Leu Leu Ala Arg

65 70 75 80

Ser Asp Val Asp Gly Val Val Ile Thr His Gly Thr Asp Thr Leu Asp

85 90 95

Glu Ser Pro Tyr Phe Leu Asn Leu Thr Val Lys Ser Asp Lys Pro Val

100 105 110

Val Phe Val Ala Ala Met Arg Pro Ala Thr Ala Ile Ser Ala Asp Gly

115 120 125

Pro Met Asn Leu Tyr Gly Ala Val Lys Val Ala Ala Asp Lys Asn Ser

130 135 140

Arg Gly Arg Gly Val Leu Val Val Leu Asn Asp Arg Ile Gly Ser Ala

145 150 155 160

Arg Phe Ile Ser Lys Thr Asn Ala Ser Thr Leu Asp Thr Phe Lys Ala

165 170 175

Pro Glu Glu Gly Tyr Leu Gly Val Ile Ile Gly Asp Lys Ile Tyr Tyr

180 185 190

Gln Thr Arg Leu Asp Lys Val His Thr Thr Arg Ser Val Phe Asp Val

195 200 205

Thr Asn Val Asp Lys Leu Pro Ala Val Asp Ile Ile Tyr Gly Tyr Gln

210 215 220

Asp Asp Pro Glu Tyr Met Tyr Asp Ala Ser Ile Lys His Gly Val Lys

225 230 235 240

Gly Ile Val Tyr Ala Gly Met Gly Ala Gly Ser Val Ser Lys Arg Gly

245 250 255

Asp Ala Gly Ile Arg Lys Ala Glu Ser Lys Gly Ile Val Val Val Arg

260 265 270

Ser Ser Arg Thr Gly Ser Gly Ile Val Pro Pro Asp Ala Gly Gln Pro

275 280 285

Gly Leu Val Ala Asp Ser Leu Ser Pro Ala Lys Ser Arg Ile Leu Leu

290 295 300

Met Leu Ala Leu Thr Lys Thr Thr Asn Pro Ala Val Ile Gln Asp Tyr

305 310 315 320

Phe His Ala Tyr

<210> 5

<211> 22

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 5

Met Glu Phe Phe Lys Lys Thr Ala Leu Ala Ala Leu Val Met Gly Phe

1 5 10 15

Ser Gly Ala Ala Leu Ala

20

<210> 6

<211> 22

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 6

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala

1 5 10 15

Ala Gln Pro Ala Met Ala

20

<210> 7

<211> 30

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

atatctagag caatctggtg atcacgccag 30

<210> 8

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

cgaagaatta aacggcataa aaaagtatta tgc 33

<210> 9

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

tcacttcgcc ccggtatcgt gc 22

<210> 10

<211> 38

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

atatctagac tggttattca acgcagactc aagctgac 38

<210> 11

<211> 55

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

gcataatact tttttatgcc gtttaattct tcgtcacttc gccccggtat cgtgc 55

<210> 12

<211> 28

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

gcactttcag tgacggcaat gaccgctc 28

<210> 13

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 13

ccgcgaacgc ctcgctatcg ttctg 25

<210> 14

<211> 28

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 14

catgaacgat gatgtctggc tgacactg 28

<210> 15

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 15

ccagcgctaa cgatgccatc atagc 25

Claims (14)

1. a kind of Escherichia coli of endogenous l-Asparaginase II gene knockouts, it is characterised in that the genome of E.coli is not Gene containing encoding endogenous l-Asparaginase II and its variant.

2. Escherichia coli according to claim 1, it is characterised in that the Escherichia coli are selected from e. coli bl21 (DE3), BLR (DE3), Rosetta (DE3), Origami (DE3), JM109, HSM174 (DE3), AS1.357 and DH5 α bacterial strains； It is preferred that e. coli bl21 (DE3).

3. the Escherichia coli of endogenous l-Asparaginase II gene knockouts according to claim 1, it is characterised in that the volume The gene of the endogenous l-Asparaginase II of code and its variant is knocked, and the technology of the knockout is selected from the gene that suicide plasmid mediates It knocks out, the gene knockout that the gene knockout that CRISPR/Cas9 is mediated, Red/ET recombination mediate, II type Intron insertions mediate Gene knockout, TALEN gene targetings, the RNA that gene knockout, Cre-LoxP recombinations mediate are interfered；It is preferred that it is plasmid-mediated to commit suiside The gene knockout that gene knockout or CRISPR/Cas9 are mediated.

4. the Escherichia coli of endogenous l-Asparaginase II gene knockouts according to claim 3, it is characterised in that described big Enterobacteria is the expressive function frame that endogenous l-Asparaginase II genes in bacterium are knocked out by targeting vector, is preferably knocked out endogenous Coded sequence, promoter sequence or the signal sequence of l-Asparaginase II gene expression functional blocks.

5. the Escherichia coli of endogenous l-Asparaginase II gene knockouts according to claim 1, it is characterised in that described to beat Targeting vector includes such as SEQ ID NO:Target practice sequence shown in 1 or with SEQ ID NO:The 1 target practice sequence with 90% similitude, It is preferred that the target practice sequence with 95% similitude, most preferably the target practice sequence with 99% similitude.

6. a kind of Escherichia coli of recombinant expression foreign gene, it is characterised in that utilize the endogenous L- winter described in claim 1-5 The Escherichia coli of amidase II gene knockouts further include the polynucleotides of expression alien gene product；

The polynucleotides are selected from is expressed by the recombinant expression carrier for being free on the genome of E.coli, or by fixed Point, which is integrated on the genome of E.coli, expresses, and is preferably expressed by the recombinant expression carrier.

7. recombinantly expressing the Escherichia coli of foreign gene according to claim 6, wherein the foreign gene is external source L- Winter amidase II and its variant, the external source l-Asparaginase II and its variant are preferred from Erwinia (Erwinia) Or Escherichia (Escherichia).

8. recombinantly expressing the Escherichia coli of foreign gene according to claim 7, it is characterised in that the L- winters of external source Amidase II and its variant be selected from from microorganism Erwinia chrysanthemi, Escherichia coli DH5 α, The l-Asparaginase II and its variant of Escherichia coli BL21, Escherichia coli AS1.357；It preferably is selected from Such as SEQ ID NO:2,SEQ ID NO:3 or SEQ ID NO:L-Asparaginase II shown in 4.

9. the Escherichia coli of endogenous l-Asparaginase II gene knockouts according to claim 8, it is characterised in that described heavy Group expression vector is pET9a, and signal peptide is selected from such as SEQ ID NO：5 or 6 signal peptide sequence.

10. the targeting vector for knocking out the endogenous l-Asparaginase II genes of Escherichia coli, it is characterised in that the target practice carries Body includes such as SEQ ID NO:Target practice sequence shown in 1 or with SEQ ID NO:The 1 target practice sequence with 90% similitude, preferably Target practice sequence with 95% similitude, most preferably the target practice sequence with 99% similitude.

11. according to claim 10 for knocking out the endogenous l-Asparaginase II gene targeting carriers of Escherichia coli, feature exists It is operably connected to suicide plasmid pCVD442 in the target practice sequence.

12. the primer sets for obtaining target practice sequence as claimed in claim 10, which is characterized in that the primer sets sequence is such as Shown in following table：

13. a kind of method knocking out the endogenous l-Asparaginase II genes of Escherichia coli, it is characterised in that the technology of the knockout The clpp gene of gene knockout, Red/ET recombination mediations that gene knockout, the CRISPR/Cas9 mediated selected from suicide plasmid is mediated It removes, gene knockout, TALEN gene targetings, the RNA that the gene knockout that II type Intron insertions mediate, Cre-LoxP recombination mediate Interference；It is preferred that the gene knockout that commit suiside plasmid-mediated gene knockout or CRISPR/Cas9 are mediated.

14. according to the method for knocking out the endogenous l-Asparaginase II genes of Escherichia coli described in claim 13, wherein the right to use Profit requires the targeting vector described in 10-11, knocks out e. coli bl21 (DE3) endogenous l-Asparaginase II genes.