CN108795832B

CN108795832B - Host bacterium with endogenous L-asparaginase II gene knocked out, preparation method and application thereof

Info

Publication number: CN108795832B
Application number: CN201810376551.6A
Authority: CN
Inventors: 曾杰; 田静; 陈磊; 刘衍伟; 王宏伟
Original assignee: Jiangsu Hengrui Medicine Co Ltd
Current assignee: Jiangsu Hengrui Medicine Co Ltd
Priority date: 2017-04-26
Filing date: 2018-04-25
Publication date: 2021-05-14
Anticipated expiration: 2038-04-25
Also published as: CN108795832A

Abstract

The invention relates to a host bacterium with an endogenous L-asparaginase II gene knocked out, a preparation method and application thereof. Specifically, the invention relates to a method for knocking out an endogenous L-asparaginase II gene of escherichia coli, and a host strain with the gene knocked out is obtained. By means of target vector knockout, the host bacterium genome does not contain genes encoding L-asparaginase II and variants thereof. The host bacteria provided by the invention can be used for recombining and expressing L-asparaginase II and variants thereof from different microorganisms such as Erwinia, Escherichia and the like.

Description

Host bacterium with endogenous L-asparaginase II gene knocked out, preparation method and application thereof

Technical Field

The invention relates to the field of biological pharmacy, in particular to a preparation method of an escherichia coli host strain with an endogenous L-asparaginase II gene knocked out and application of the host strain.

Background

L-asparaginase II is a deaminase which catalyzes the hydrolysis of asparagine to aspartic acid and ammonia. The enzyme can remove extracellular L-asparagine, thereby preventing the growth of cancer cells which rely on L-asparagine for protein synthesis. In clinic, L-asparaginase II is mainly used for treating acute lymphocytic leukemia and lymphoma.

The L-asparaginase II preparations currently on the market are derived from two microorganisms, Escherichia coli (Escherichia coli) and Erwinia chrysosporium (Erwinia chrysanthemium), L-asparaginase II is a tetramer of identical subunits, has a molecular weight of 141kDa, and is free of enzymatic activity of the monomer. The two sources of L-asparaginase II have less cross-allergic reaction, and according to the clinical research of European Union tumor research institute, the curative effects of the two enzymes are close, but 29 percent of leukemia patients have serious allergic reaction to the Escherichia coli source L-asparaginase II, and the satisfactory curative effect can be obtained only by using the L-asparaginase II from the Erwinia chrysanthemi. Therefore, L-asparaginase II from Erwinia can be used as a component of a multi-drug chemotherapy regimen, and is suitable for treating acute lymphocytic leukemia patients with hypersensitivity to L-asparaginase II from Escherichia.

Patent CN101083118B extracted natural L-asparaginase II from Escherichia coli, and the fermentation liquid yield was 10 units/mL. The patent CN 101831417A and the patent CN 1397645A provide a method for extracting natural L-asparaginase II from Erwinia thallus, and the yield of fermentation liquor is 50-80 units/mL. The natural target protein is obtained from the two strains, the yield is low, and the economic benefit is poor.

Through the gene engineering technology, the L-asparaginase II can be expressed in an industrialized and large-scale recombination way. Mojtaba et al (2011 Biharean biologicst.5 (2):96-101) can use BL21(DE3) to express L-asparaginase II of Escherichia coli by recombination, and the yield can reach 130 units/mL, Wujing et al (2000J. Pharmacology.35 (4):268 and 272) can express L-asparaginase II of Escherichia coli AS1.357 by recombination, and the yield can reach 214 units/mL. However, the escherichia coli can express the L-asparaginase II on the background, and the obtained L-asparaginase II product is mixed with the L-asparaginase II expressed on the background of the escherichia coli, so that the product purity is not uniform, and potential immunogenicity safety risks exist. In addition, impurities may also cause the body to become immune to the drug, resulting in treatment failure.

Patent CN 101484181a is to solve this problem, in BL21(DE3) host bacteria, BL21 derived L-asparaginase II is produced using free recombinant expression vector to obtain L-asparaginase II with uniform purity, however, this strategy also has the risk of instability of ansB gene and host bacteria genome. Kirill A. et al (2000 PANS.97(12):6640 and 6645.) in 2000 discovered that the target gene of E.coli was inactivated by replacing or inserting the target gene into the E.coli genome by homologous recombination using a homologous sequence fragment or plasmid with the target gene of the host bacterium. However, the ansB gene (L-asparaginase II gene) contained in the free recombinant expression vector is highly homologous with the ansB gene on the Escherichia coli genome, and homologous recombination is likely to occur, so that the genome structure of the host bacterium is changed, the gene activity is lost, and the L-asparaginase II cannot be expressed continuously and stably.

In order to solve the risk of instability of ansB gene and host bacterium genome, the L-asparaginase II gene (ansB) of Escherichia coli is knocked out by a gene knock-out technology, so that the L-asparaginase II gene cannot express the L-asparaginase II. However, not all bacterial genes can be successfully knocked out, and the technical difficulty of knocking out bacterial genes lies in many factors influencing recombination efficiency, such as different bacterial species, subtypes, knocked-out genes, competent cell states, operation methods and the like, and the recombination efficiency is greatly different (Zhang Xue et al, 2008. J. bioengineering 28(12): 89-93.). In addition, improper selection of targeting sequences for targeting vectors can also result in low recombination efficiency and knockout failure, and proper targeting sequences and targeting vectors are of great importance.

The targeting vector provided by the invention contains the sacB gene, no residue of any exogenous fragment is left on the genome, and gene instability caused by homologous recombination possibly caused by subsequent genetic operation of the genome and the residual exogenous fragment is not influenced. In a preferred embodiment of the invention, the traceless knockout of the ansB gene was successfully carried out for the first time in strain BL21(DE3) using the targeting vector provided by the invention. The host bacterium provided by the patent can avoid the instability of ansB genes and host bacterium genomes caused by homologous recombination between the ansB genes in the free recombinant expression vector and the ansB genes on the host bacterium genomes, and in addition, the host bacterium provided by the patent can be used for recombining and expressing L-asparaginase II and variants thereof with uniform purity from different microorganisms such as Erwinia, Escherichia and the like, so that the requirements of clinical multi-drug chemotherapy scheme combination are met.

Disclosure of Invention

The invention provides a method for knocking out an endogenous L-asparaginase II gene and an escherichia coli (E.coli) host strain with the gene knocked out, wherein the genome of the host strain does not contain a gene for coding the endogenous L-asparaginase II and a variant thereof.

In a preferred embodiment of the present invention, the host bacterium is obtained by knocking out an expression functional box encoding L-asparaginase II in a bacterium by a targeting vector, wherein the targeting vector comprises a targeting sequence of SEQ ID NO. 1 and the sequence is as follows:

GCAATCTGGTGATCACGCCAGACGGCAACGTGATGTATAACGGTAAGCAATATTCCCTGAATGCCGCCCAGCGCGAGCAGGCGAAGGATTATCAGGCTGAACTACGCAGCACGCTGCCGTGGATTGATGAAGGCGCGAAAAGCCGCGTCGAAAAAGCCCGTATTGCGCTGGATAAAATTATCGTTCAGGAGATGGGCGAAAGCAGCAAAATGCGCAGCCGTCTGACCAAACTTGATGCGCAGCTGAAAGAGCAGATGAACCGCATTATCGAAACGCGCAGCGATGGCCTGACGTTTCACTATAAAGCCATTGATCAGGTTCGCGCCGAAGGCCAGCAATTAGTGAATCAGGCAATGGGCGGAATTTTACAGGACAGCATTAATGAAATGGGCGCGAAAGCGGTGCTGAAAAGCGGCGGTAACCCATTACAGAACGTGCTGGGAAGCCTGGGCGGCCTGCAATCCTCAATCCAAACCGAGTGGAAAAAGCAGGAAAAAGATTTCCAGCAGTTTGGCAAAGATGTTTGTAGCCGCGTTGTGACTCTGGAAGATAGCCGCAAAGCCCTGGTCGGGAATTTAAAATAATCCTCTATTTTAAGACGGCATAATACTTTTTTATGCCGTTTAATTCTTCGTCACTTCGCCCCGGTATCGTGCCGGGGCTTATTCACTTCAGACTCACGTCCATTGCCAATTTTTATTACCCTAATGATAATCACCGGAATAAATTATTCCGCGCGAGGGTTTTCGGGTGAAAAAGCAATGGATTGTTGGTACGGCGCTGCTTATGTTGATGACTGGTAATGTCCGGGCAGATGGTGAACCGCCAACTGAAAATATCTTAAAAGATCAATTCAAAAAGCAGTATCACGGCATTCTCAAGCTTGATGCCATCACCTTAAAAAATCTTGATGCTAAGGGTAATCAGGCCACCTGGTCAGCGGAAGGCGATGTCTCTTCCAGTGACGATCTCTATACCTGGGTCGGTCAGTTGGCAGATTACGAGCTGCTCGAACAGACCTGGACGAAAGATAAACCGGTGAAATTCTCGGCGATGTTAACCAGTAAAGGAACGCCCGCGTCTGGCTGGTCGGTGAACTTTTACTCTTTTCAGGCGGCAGCCAGCGATCGTGGGCGGGTGGTTGACGATATCAAAACGAATAATAAATATCTGATCGTGAATAGCGAAGATTTCAATTATCGCTTTAGTCAGCTTGAGTCTGCGTTGAATAACCAG

the invention further provides a method for preparing the host bacterium, wherein the method comprises the steps of knocking out an expression functional frame for coding L-asparaginase II in the bacterium by a gene knockout technology;

the expression functional frame comprises a coding sequence, a promoter sequence and a signal sequence of asparaginase II;

the gene knockout technology is selected from suicide plasmid pCVD mediated gene knockout, CRISPR/Cas9 mediated gene knockout, Red/ET recombination mediated gene knockout, II-type intron insertion mediated gene knockout, Cre-LoxP recombination mediated gene knockout, TALEN gene targeting and RNA interference; preferably suicide plasmid pCVD mediated gene knockout, CRISPR/Cas9 mediated gene knockout.

The suicide plasmid pCVD mediated gene knockout method comprises the following steps:

(1) amplification of targeting sequences and construction of targeting vectors

(2) Construction of Donor bacterium and conjugation experiment

(3) Screening and identification of positive clone bacteria

In a preferred embodiment of the present invention, the targeting vector of the present invention, wherein the targeting vector contains sacB gene, will not leave any exogenous fragment residue on the genome, and will not affect the gene instability caused by the subsequent genetic manipulation of the genome and the homologous recombination that may be caused by the residual exogenous fragment. The targeting vector provided by the invention is used for successfully carrying out traceless knockout on ansB gene in BL21(DE3) strain for the first time, so that the host bacterium provided by the invention is obtained.

The host bacterium can be used for industrially and massively recombining and expressing L-asparaginase II with uniform purity and multiple microorganism sources, and meets the requirements of clinical combination of multi-drug chemotherapy schemes. For example, the sequence of L-asparaginase II from Escherichia coli BL21 (SEQ ID NO:2), the sequence of L-asparaginase II from Escherichia coli AS1.357 (SEQ ID NO:3), and the sequence of L-asparaginase II from Erwinia chrysanthemi (SEQ ID NO: 4). Wherein the L-asparaginase II from the erwinia bacterium can treat acute lymphoblastic leukemia patients with hypersensitivity to L-asparaginase II from Escherichia coli. The enzyme product obtained by using the host bacterium for recombinant expression does not contain other L-asparaginase II variants with detectable quantity, and simultaneously avoids the problem of instability of ansB genes and host bacterium genomes in recombinant bacteria.

In a preferred embodiment of the invention, the host bacterium according to the invention, wherein the host bacterium is selected from the group consisting of E.coli BL21(DE3), BLR (DE3), Rosetta (DE3), Origami (DE3), JM109, HSM174(DE3), AS1.357, DH5 α.

The invention further provides a method for knocking out the endogenous L-asparaginase II gene of escherichia coli, wherein the obtained host bacterium genome is knocked out in a homologous recombination mode by using the targeting vector disclosed by the invention and does not contain a gene for coding the endogenous L-asparaginase II gene of the escherichia coli and a variant thereof.

In a preferred embodiment of the present invention, the host bacterium of the present invention, wherein the host bacterium is used for recombinant expression of L-asparaginase II enzyme and variants thereof from different microorganisms;

the recombinant expression mode is selected from expression by a recombinant expression vector dissociating from a host bacterium genome, or expression by site-specific integration of a sequence on the host bacterium genome, preferably expression by the recombinant expression vector;

the microorganism is preferably selected from Erwinia or Escherichia.

In a preferred embodiment of the present invention, the host bacterium according to the present invention, wherein the nucleotide sequence of the different microorganism-derived L-asparaginase II enzyme and variants thereof is selected from the group consisting of the nucleotide sequence of the L-asparaginase II enzyme derived from the microorganisms Erwinia chrysanthemi, Escherichia coli DH5 α, Escherichia coli BL21, Escherichia coli AS1.357, and variants of the aforementioned microorganism-derived L-asparaginase II nucleotide sequence; preferred are SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4.

The nucleotide sequence of the L-asparaginase II is selected from, but not limited to, the sequences in the following Table 1, and the nucleotide sequence of the L-asparaginase II can be combined with any of the signal peptide sequences in the Table 2 (but not limited to the sequences in the Table 2) SEQ ID NO:5 and SEQ ID NO: 6.

TABLE 1L-asparaginase II sequence

The variant of the L-asparaginase II nucleotide sequence comprises mutations such as substitution, insertion, deletion and the like of the base of the nucleotide sequence.

The invention further provides a method for expressing L-asparaginase II from various microorganisms by using the host bacteria, which comprises the following steps:

(1) synthesis of nucleotide sequence of L-asparaginase II by gene synthesis method

(2) Connecting the synthesized nucleotide sequence with a vector to construct a recombinant expression vector

(3) The constructed recombinant expression vector is recombined and expressed in the host bacterium of the invention

In a preferred embodiment of the present invention, the host bacterium according to the present invention, wherein the recombinant expression vector episomal from the genome of the host bacterium comprises a nucleotide sequence encoding any L-asparaginase II subunit; the site-specific integration sequence comprises a nucleotide sequence encoding any L-asparaginase II subunit.

In a preferred embodiment of the present invention, the host bacterium of the present invention, wherein the recombinant expression vector is a plasmid, preferably selected from the group consisting of a substrate inducible expression vector, a heat inducible expression vector, a nutrient limitation inducible expression vector, a constitutive expression vector, more preferably a substrate inducible expression vector, and most preferably the pET series.

In a preferred embodiment of the invention, the host bacterium according to the invention, wherein the expression vector comprises a promoter, a signal sequence, an operator, a ribosome binding site, a transcription terminator, an antibiotic selection marker, an origin of replication, a copy of a repressor binding region.

In a preferred embodiment of the invention, the host bacterium according to the invention, wherein the promoter is selected from the group consisting of the native promoter of asparaginase II, T7, T7/Lac, T5, T5/Lac, araBAD, rhaBAD, Tac, lacUV5, Lac, tetA, phoA, lambda PL, Sp6, trp, preferably the T7 promoter, the T5 promoter.

In a preferred embodiment of the invention, the host bacterium according to the invention, wherein the signal sequence is selected from the group consisting of the native signal peptides native, pelB, ompA, STII, phoA, ompT, ompC, tolB, torA, torT, dsbA, lamB, MglB, glII, sufI, SfmC, malE, EOX, MmAP of asparaginase II, preferably the signal sequences native, pelB.

The signal sequence may be in any combination with the L-asparaginase II sequence, and the signal peptide sequence is selected from, but not limited to, the sequences in Table 2 below.

TABLE 2 Signal peptide sequences

Name code	Asparaginase II signal peptides and variant sequences thereof	Serial number
			NATIVE	MEFFKKTALAALVMGFSGAALA
	5
		PELB	MKYLLPTAAAGLLLLAAQPAMA		6

The transcription terminator includes a T7 terminator, a Lambda phage T0 terminator, an rrnB terminator, a phage fd terminator and the like, and is preferably a T7 terminator, a Lambda phage T0 terminator.

Drawings

FIG. 1 shows the PCR method for identifying gene knock-out bacterium BL21(DE3)/Δ ansB and wild strain BL21(DE 3). 1,11: marker (2000, 1000, 750, 500, 250, 100); 6: marker (10000, 7000,4000, 2000, 1000, 500, 250); 2,7: BL21(DE3) bacterial genome; 3,8: no primer negative control; 4,5,9,10: BL21(DE3)/Δ ansB bacterium genome.

FIG. 2 shows the growth curves of gene knock-out bacterium BL21(DE3)/Δ ansB and wild strain BL21(DE 3). Knockout of the ansB gene had no significant effect on the growth of the strain.

FIG. 3 background expression of L-asparaginase II. 1: marker12 (kD: 200, 116.3, 97.4, 66.3, 55.4, 36.5, 31, 21.5, 14.4, 6, 3.5); 2: BL21(DE3) periplasm; 3: BL21(DE3)/Δ ansB periplasm; 4: BL21(DE3) whole strain; 3: BL21(DE3)/Δ ansB whole strain.

Detailed Description

As used herein, "knockout" includes deletion of all or a portion of the target polynucleotide using gene knockout techniques. For example, a knockout can be achieved by altering a target polynucleotide sequence by inducing an insertion or deletion in a functional domain (e.g., a DNA binding domain) of the target polynucleotide sequence in the target polynucleotide sequence. The gene knockout technology is selected from suicide plasmid pCVD mediated gene knockout, CRISPR/Cas9 mediated gene knockout, Red/ET recombination mediated gene knockout, II-type intron insertion mediated gene knockout, Cre-LoxP recombination mediated gene knockout, TALEN gene targeting and RNA interference; preferably a suicide plasmid, pCVD mediated gene knockout, CRISPR/Cas9 mediated gene knockout system to knock out the target polynucleotide or portion thereof.

As used herein, "endogenous L-asparaginase II" refers to the expressed L-asparaginase II gene, not the object of the invention, carried by the genome of the E.coli host strain itself.

As used herein, the term "exogenous L-asparaginase II" refers to a desired L-asparaginase II gene which is carried by the genome of a non-E.coli host strain, introduced by artificial manipulation, and expressed efficiently.

"homologous recombination" is a method for introducing an exogenous gene into the genome of a recipient cell in a targeted manner, because at this locus there is a sequence homologous to the introduced gene, and by single or double crossover, the new gene fragment can replace the original gene fragment (endogenous gene fragment) in the genome of the recipient cell, with the aim of modifying or knocking out the endogenous gene. Site-specific recombination is recombination that occurs at specific sites on two DNA strands, and requires a homologous sequence, i.e., a specific site (also called attachment site), and a site-specific protein factor, i.e., recombinase, to participate in catalysis. The recombinase can only catalyze recombination between specific sites, so that the recombination has specificity and high conservation.

"Expression vectors" are vectors in which Expression elements (e.g., promoter, RBS, terminator, etc.) are added to the basic backbone of a cloning vector to allow Expression of a target gene. The "recombinant expression vector" is a recombinant vector in which a foreign gene or a target gene is recombined on an expression vector to enable the target gene to be expressed.

The present invention will be further described with reference to the following examples, which are not intended to limit the scope of the present invention.

Example 1: knock-out of ansB Gene on BL21(DE3) genome

1. Primer design

Upstream and downstream homologous recombination arm primers, connecting primers of the upstream and downstream homologous recombination arms and identifying primers are designed according to upstream and downstream sequences of ansB genes on a BL21(DE3) genome, and the sequences of the primers are shown in Table 3.

TABLE 3 primer sequences

2. Amplification of targeting sequences and construction of targeting vectors

Using a genome extraction kit (

Genomic DNA Purification Kit, Promega) extracted the genome of BL21(DE3) as a PCR template, the primers were upstream and downstream homologous recombination arm primers (SEQ ID NO:7 to SEQ ID NO:10), and the upstream and downstream homologous recombination arms were amplified using high fidelity DNA polymerase (platinum Taq, Invitrogen). The targeting sequence SEQ ID NO:1 is obtained by fusing the upstream and downstream homologous recombination arms using a connecting primer (SEQ ID NO:11) of the upstream and downstream homologous recombination arms.

The strain DH5 alpha lambda pir/pCVD442 (Shanghai bio-organism) is inoculated, and the pCVD442(Addgene, 11074) plasmid is extracted. XbaI (Fermentas) digestion of the targeting sequence and pCVD442 plasmid, tapping and purification (

SV Gel and PCR Clean-Up System, Promega). The above-cut targeting sequence was ligated to pCVD442 using T4 ligase (New England Biolabs). The ligation product was transformed into E.coli DH 5. alpha. lamda. pir (Shanghai organism) by the electrotransformation method. Extracted plasmid (Pure Yield)^TMPlasmid midi prep System, Promega) is the targeting vector: pCVD 442-. DELTA.ansB.

3. Construction of Donor bacterium and conjugation experiment

The targeting vector is electrically transformed into Escherichia coli beta 2155 strain (Shanghai bio-organism), namely a donor strain beta 2155/pCVD 442-delta ansB for conjugation experiment. The recipient bacterium BL21(DE3) was mixed with the donor bacterium β 2155/pCVD 442-. DELTA.ansB and cultured to effect conjugation. The mixed bacterial liquid was applied to a 0.22 μm sterile filter (MILLIPORE) and cultured, eluted with physiological saline, and spread on Amp-resistant LB plates. A plurality of clones were randomly selected and tested by PCR using the outer primers, and if there was double-band amplification corresponding to the wild type (2.7kb) and the deleted type (1.5kb), it was judged that this clone was a positive clone in which one homologous recombination occurred, and was designated BL21(DE3)/pCVD442- Δ ansB.

4. Screening and identification of secondary homologous recombination positive clone bacteria

And taking the primary homologous recombinant positive clone bacterial liquid, and streaking and inoculating the primary homologous recombinant positive clone bacterial liquid to an LB sucrose plate. Multiple clones were randomly picked and tested by PCR using the outer primers. If the amplified product is a single band of 1.5kb, the clone is a positive clone in which the second homologous recombination occurs.

And (3) selecting the screened secondary homologous recombination suspected positive clone, and performing PCR identification, wherein the identification result is shown in figure 1. The positive clone bacterium is that the amplification product of the outer primer is 1.5kb (deletion type), the length of the deleted gene is 1.2kb, the inner primer has no amplification product, the amplification result of the negative clone is that the amplification product of the outer primer is 2.7kb (wild type), and the amplification product of the inner primer is 600 bp. The amplification products of the outer primers were sequenced, and the sequencing result confirmed to be an ansB gene deletion type clone, which was named BL21(DE3)/Δ ansB.

Example 2: comparison of growth characteristics of wild bacterium BL21(DE3) and Gene knock-out bacterium BL21(DE3)/Δ ansB

An LB culture medium is prepared, and the formula comprises 1% of Tryptone, 0.5% of yeast extract and 1% of NaCl. Inoculating 0.5% of the extract into 5mL seed culture medium, culturing in 50mL micro Bioreactor (Mini Bioreactor, Corning), culturing at 37 deg.C and 220rpm to logarithmic phase, transferring to 50mL LB culture medium at 2% ratio, performing 3 250mL shake flasks (Erlenmeyer flash, Corning) in parallel, sampling every 30min or 1h, and separating with ultravioletDetection of OD by Photometer₆₀₀The value is obtained. Using time as abscissa, OD₆₀₀Values are plotted as the ordinate against the growth curve, see FIG. 2.

Equation 1:

in the formula, μ is the specific growth rate in h^-1T2-T1 is the time taken by the microorganism to grow from time T1 to time T2 in h, N1 is the cell mass of the microorganism at time T1, and N2 is the cell mass of the microorganism at time T2.

The data obtained were processed using equation 1 and the mean specific growth rates of gene knock-out bacteria BL21(DE3)/Δ ansB were not significantly different from that of wild-type bacteria BL21(DE3) (Novagen, 69450-4CN) at p ═ 0.05 levels as analyzed by statistical t-test.

Example 3: background expression of L-asparaginase II of wild bacteria BL21(DE3) and gene knock-out bacteria BL21(DE 3)/delta ansB

Preparing a seed culture medium with a formula of 1% of Tryptone, 0.5% of yeast extract, 1% of NaCl and 0.1% of L-asparagine, and preparing a background expression culture medium with a formula of 1% of Tryptone, 0.5% of yeast extract, 1% of NaCl and 0.6% of L-asparagine. Glycerol strain was inoculated into 5mL of seed medium at a ratio of 0.1%, and cultured in a 50mL micro Bioreactor (Corning) at 25 ℃ and 150rpm to OD ₆₀₀4 left or right (16-18 hours). Transfer to 30mL background expression medium at 4% ratio, 125mL flat bottom Flask (Erlenmeyer flash, Corning), 25 ℃, 150rpm culture for 14 h. Centrifuging at 8000rpm for 5min to collect thallus, extracting periplasmic protein by osmotic pressure method (see pET manual), and concentrating with 10kD concentration tube (Spin-

UF 20, Corning) was appropriately concentrated and analyzed by SDS-PAGE. The results are shown in FIG. 3, the periplasm and the whole bacteria of gene knock-out bacterium BL21(DE 3)/delta ansB have no corresponding band of 35KD, the periplasm and the whole bacteria of contrast bacterium BL21(DE3) have corresponding bands of 35KD, the success of endogenous gene knock-out is proved, and the elimination is eliminatedBackground expression was obtained.

Example 4: construction and expression of recombinant expression strains

1. Gene synthesis

The nucleotide sequence of the recombinant L-asparaginase II expression cassette was synthesized by Nanjing Kinsley Biochemical company. The expression cassette coding sequence is selected from any combination of but not limited to a signal peptide sequence SEQ ID NO. 5, SEQ ID NO. 6 and an L-asparaginase II sequence SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4. In this example, the expression cassette 1 comprises a combination of NATIVE signal peptide sequences SEQ ID NO. 5 and SEQ ID NO. 2, the expression cassette 2 comprises a combination of SEQ ID NO. 5 and SEQ ID NO. 3, the expression cassette 3 comprises a combination of SEQ ID NO. 5 and SEQ ID NO. 4, an Nde I cleavage site is added to the 5 'end of the coding region of the expression cassette, and a BamH I cleavage site is added to the 3' end.

2. Construction of recombinant expression strains: pET9a-native-ansB-1/BL21(DE3)/Δ ansB, pET9a-native-ansB-2/BL21(DE3)/Δ ansB, pET9a-native-ansB-3/BL21(DE3)/Δ ansB

Recombinant cloning plasmids (pUC57-native-ansB-1, pUC57-native-ansB-2 and pUC57-native-ansB-3) and expression vector pET9a were digested simultaneously with NdeI and BamHI endonucleases (Fermentas), respectively. Kit for recovery using gelatin (

SV Gel and PCR Clean-Up System, Promega) Gel-recovered the target gene fragments (native-ansB-1, native-ansB-2, and native-ansB-3) and the product of pET9a enzyme digestion, and connected the target gene fragments and the recovered fragment of the expression vector with T4 ligase (New England Biolabs). The ligation products were transformed into E.coli DH5a competent cells and plated on Kan-resistant LB plates to select recombinants. And (5) selecting positive clones for sequencing verification. Using CaCl₂BL21(DE 3)/delta ansB competent cells are prepared, and the recombinant expression vector with correct sequencing verification is transformed into BL21(DE 3)/delta ansB, so that the 3 recombinant expression strains are obtained.

3. Shake flask induced expression of recombinant expression strains

Positive clones with correct sequencing verification were inoculated into 5ml LB medium containing 2% glucose and culturedTo log phase. Inoculating 2% of the extract into 50ml LB medium containing 0.5% glucose, and culturing at 37 deg.C to OD₆₀₀About 0.8. Cooling to 30 deg.C to adjust to OD₆₀₀After induction with 0.2mM IPTG at a final concentration of about 1.0 (about 30min), shaking and culturing at 30 ℃ in a constant temperature shaker at 220rpm for 4 hours, and after the expression is finished, centrifuging at 6000rpm for 5 minutes to take supernatant, and detecting the enzyme activity by the Neisseria reagent method, the detection method is shown in example 5.

EXAMPLE 5 detection of L-asparaginase II Activity

The enzymatic activity of the L-asparaginase II is detected by adopting a Neisseria reagent method, and the detection result of the enzymatic activity of the shake flask induction expression is shown in a table 4.

1. Preparation of Standard Curve

Ammonium sulfate dried to constant weight was taken and 5 concentration-gradient ammonium sulfate solutions (1.2mmol/L, 1.5mmol/L, 2.0mmol/L, 2.5mmol/L, 3.0mmol/L) were prepared in a volumetric flask. The five concentrations are respectively taken and added into a test tube with the concentration of 0.15mL, a blank tube with the concentration of 0.15mL is added with water with the concentration of 2.10mL and Neisseria reagent with the concentration of 0.3mL, the mixture is evenly mixed, the mixture is kept stand for 10 minutes at room temperature, and the absorbance is measured at the wavelength of 405 nm. And (4) making a standard curve by taking the light absorption value as an ordinate and the ammonia amount in the solution as an abscissa.

2. Preparation of samples to be tested

The sample to be tested was diluted appropriately with 0.02mol/L tris solution (pH 7.0) so that about 3 units of L-asparaginase II were contained per 1 mL. 2 test tubes were taken, 0.60mL of 0.01mol/L L-asparagine solution was added to each test tube, and the test tubes were preheated in a water bath at 37 ℃ for 5 minutes. Adding 0.20mL of the solution into the reaction kettle, placing the reaction kettle in a water bath at 37 ℃, accurately reacting for 10 minutes, immediately adding 0.20mL of 30% trichloroacetic acid solution into the reaction kettle, and shaking up.

3. Measurement method

Taking 0.15mL of each of the reference substance (2.5mmol/L ammonium sulfate solution) and the sample to be detected, and placing the reference substance and the sample to be detected in a test tube, wherein the blank is 0.15mL of 0.02mol/L tris solution. 2 tubes of each portion were made in parallel, 2.0mL of each portion was added with water and 0.3mL of mercuric potassium iodide solution (23 g of mercuric iodide and 16g of potassium iodide were taken, water was added to 100mL and the mixture was mixed with 20% sodium hydroxide solution in equal volume before use), and the mixture was mixed well. After leaving at room temperature for 10 minutes, absorbance values at a wavelength of 405nm were measured, respectively, and the average value was calculated according to the following formula.

Equation 2:

definition of titer unit: under the above conditions, one unit of L-asparaginase II corresponds to the amount of enzyme required to decompose L-asparagine per minute to give 1. mu. mol of ammonia.

TABLE 4 detection of the enzyme Activity of recombinant expression of L-asparaginase II

Sample name	Enzyme Activity (Unit/mL)
		pET9a-native-ansB-1/BL21(DE3)/ΔansB	22.2
pET9a-native-ansB-2/BL21(DE3)/ΔansB	25.8
		pET9a-native-ansB-3/BL21(DE3)/ΔansB	27.3
pET9a/BL21(DE3)/ΔansB	0.46
		BL21(DE3)/ΔansB	0.39
LB Medium	0.42

EXAMPLE 6 purification preparation and characterization of L-asparaginase II

The seeds for producing the L-asparaginase II are cultured and fermented, and then the thalli are collected centrifugally. The harvested cells were suspended in PBS buffer, homogenized and disrupted, centrifuged to collect the supernatant. Adding 50% saturated ammonium sulfate into the supernatant, centrifuging to remove precipitate, and purifying with hydrophobic chromatography column and ion exchange chromatography column to obtain purified sample with certain purity. And (3) performing LC-MS and SEC-HPLC detection on purified ansB-1, ansB-2 and ansB-3 samples obtained by purification, wherein the detection and identification results are shown in Table 5.

TABLE 5 identification of L-asparaginase II purified samples

Sample name	Purity of	Theoretical molecular weight	LC-MS	SEC-HPLC
					ansB-1(BL21)	98.3％	34593.90	34593.24	138375.42
ansB-2(AS1.357)	99.8％	34546.83	34546.31	138187.73
					ansB-3(Erwinia)	98.7％	34176.07	34175.92	136703.86

Sequence listing

<110> Hengrui pharmaceutical Co., Ltd of Jiangsu

<120> host bacterium with endogenous L-asparaginase II gene knocked out, preparation method and application thereof

<130> 2017

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 1236

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcaatctggt gatcacgcca gacggcaacg tgatgtataa cggtaagcaa tattccctga 60

atgccgccca gcgcgagcag gcgaaggatt atcaggctga actacgcagc acgctgccgt 120

ggattgatga aggcgcgaaa agccgcgtcg aaaaagcccg tattgcgctg gataaaatta 180

tcgttcagga gatgggcgaa agcagcaaaa tgcgcagccg tctgaccaaa cttgatgcgc 240

agctgaaaga gcagatgaac cgcattatcg aaacgcgcag cgatggcctg acgtttcact 300

ataaagccat tgatcaggtt cgcgccgaag gccagcaatt agtgaatcag gcaatgggcg 360

gaattttaca ggacagcatt aatgaaatgg gcgcgaaagc ggtgctgaaa agcggcggta 420

acccattaca gaacgtgctg ggaagcctgg gcggcctgca atcctcaatc caaaccgagt 480

ggaaaaagca ggaaaaagat ttccagcagt ttggcaaaga tgtttgtagc cgcgttgtga 540

ctctggaaga tagccgcaaa gccctggtcg ggaatttaaa ataatcctct attttaagac 600

ggcataatac ttttttatgc cgtttaattc ttcgtcactt cgccccggta tcgtgccggg 660

gcttattcac ttcagactca cgtccattgc caatttttat taccctaatg ataatcaccg 720

gaataaatta ttccgcgcga gggttttcgg gtgaaaaagc aatggattgt tggtacggcg 780

ctgcttatgt tgatgactgg taatgtccgg gcagatggtg aaccgccaac tgaaaatatc 840

ttaaaagatc aattcaaaaa gcagtatcac ggcattctca agcttgatgc catcacctta 900

aaaaatcttg atgctaaggg taatcaggcc acctggtcag cggaaggcga tgtctcttcc 960

agtgacgatc tctatacctg ggtcggtcag ttggcagatt acgagctgct cgaacagacc 1020

tggacgaaag ataaaccggt gaaattctcg gcgatgttaa ccagtaaagg aacgcccgcg 1080

tctggctggt cggtgaactt ttactctttt caggcggcag ccagcgatcg tgggcgggtg 1140

gttgacgata tcaaaacgaa taataaatat ctgatcgtga atagcgaaga tttcaattat 1200

cgctttagtc agcttgagtc tgcgttgaat aaccag 1236

<210> 2

<211> 326

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly

1 5 10 15

Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Ala Gly Lys Val Gly Val

20 25 30

Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val

35 40 45

Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Asp

50 55 60

Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr

65 70 75 80

Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala

85 90 95

Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val

100 105 110

Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn

115 120 125

Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn Arg

130 135 140

Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val

145 150 155 160

Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr

165 170 175

Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr

180 185 190

Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu

195 200 205

Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser

210 215 220

Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly Ile Val

225 230 235 240

Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Thr Val Phe Asp Thr

245 250 255

Leu Ala Thr Ala Ala Lys Asn Gly Thr Ala Val Val Arg Ser Ser Arg

260 265 270

Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys

275 280 285

Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val

290 295 300

Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Gln Gln Ile Gln

305 310 315 320

Gln Ile Phe Asn Gln Tyr

325

<210> 3

<211> 326

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly

1 5 10 15

Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Ala Gly Lys Val Gly Val

20 25 30

Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val

35 40 45

Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Val Asn Asp Asn

50 55 60

Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr

65 70 75 80

Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala

85 90 95

Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val

100 105 110

Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn

115 120 125

Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn Arg

130 135 140

Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val

145 150 155 160

Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr

165 170 175

Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr

180 185 190

Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu

195 200 205

Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser

210 215 220

Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly Ile Val

225 230 235 240

Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Ser Val Phe Asp Thr

245 250 255

Leu Ala Thr Ala Ala Lys Asn Gly Thr Ala Val Val Arg Ser Ser Arg

260 265 270

Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys

275 280 285

Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val

290 295 300

Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Gln Gln Ile Gln

305 310 315 320

Gln Ile Phe Asn Gln Tyr

325

<210> 4

<211> 324

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Leu Pro Asn Ile Val Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Ser

1 5 10 15

Ala Ala Ala Asn Thr Gln Thr Thr Gly Tyr Lys Ala Gly Ala Leu Gly

20 25 30

Val Glu Thr Leu Ile Gln Ala Val Pro Glu Leu Lys Thr Leu Ala Asn

35 40 45

Ile Lys Gly Glu Gln Val Ala Ser Ile Gly Ser Glu Asn Met Thr Ser

50 55 60

Asp Val Leu Leu Thr Leu Ser Lys Arg Val Asn Glu Leu Leu Ala Arg

65 70 75 80

Ser Asp Val Asp Gly Val Val Ile Thr His Gly Thr Asp Thr Leu Asp

85 90 95

Glu Ser Pro Tyr Phe Leu Asn Leu Thr Val Lys Ser Asp Lys Pro Val

100 105 110

Val Phe Val Ala Ala Met Arg Pro Ala Thr Ala Ile Ser Ala Asp Gly

115 120 125

Pro Met Asn Leu Tyr Gly Ala Val Lys Val Ala Ala Asp Lys Asn Ser

130 135 140

Arg Gly Arg Gly Val Leu Val Val Leu Asn Asp Arg Ile Gly Ser Ala

145 150 155 160

Arg Phe Ile Ser Lys Thr Asn Ala Ser Thr Leu Asp Thr Phe Lys Ala

165 170 175

Pro Glu Glu Gly Tyr Leu Gly Val Ile Ile Gly Asp Lys Ile Tyr Tyr

180 185 190

Gln Thr Arg Leu Asp Lys Val His Thr Thr Arg Ser Val Phe Asp Val

195 200 205

Thr Asn Val Asp Lys Leu Pro Ala Val Asp Ile Ile Tyr Gly Tyr Gln

210 215 220

Asp Asp Pro Glu Tyr Met Tyr Asp Ala Ser Ile Lys His Gly Val Lys

225 230 235 240

Gly Ile Val Tyr Ala Gly Met Gly Ala Gly Ser Val Ser Lys Arg Gly

245 250 255

Asp Ala Gly Ile Arg Lys Ala Glu Ser Lys Gly Ile Val Val Val Arg

260 265 270

Ser Ser Arg Thr Gly Ser Gly Ile Val Pro Pro Asp Ala Gly Gln Pro

275 280 285

Gly Leu Val Ala Asp Ser Leu Ser Pro Ala Lys Ser Arg Ile Leu Leu

290 295 300

Met Leu Ala Leu Thr Lys Thr Thr Asn Pro Ala Val Ile Gln Asp Tyr

305 310 315 320

Phe His Ala Tyr

<210> 5

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Glu Phe Phe Lys Lys Thr Ala Leu Ala Ala Leu Val Met Gly Phe

1 5 10 15

Ser Gly Ala Ala Leu Ala

20

<210> 6

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala

1 5 10 15

Ala Gln Pro Ala Met Ala

20

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atatctagag caatctggtg atcacgccag 30

<210> 8

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgaagaatta aacggcataa aaaagtatta tgc 33

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcacttcgcc ccggtatcgt gc 22

<210> 10

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atatctagac tggttattca acgcagactc aagctgac 38

<210> 11

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcataatact tttttatgcc gtttaattct tcgtcacttc gccccggtat cgtgc 55

<210> 12

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcactttcag tgacggcaat gaccgctc 28

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccgcgaacgc ctcgctatcg ttctg 25

<210> 14

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

catgaacgat gatgtctggc tgacactg 28

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ccagcgctaa cgatgccatc atagc 25

Claims

1. An escherichia coli for recombinant expression of an exogenous gene is characterized in that an escherichia coli genome does not contain a gene for coding an endogenous L-asparaginase II, the gene for coding the endogenous L-asparaginase II is knocked out by a suicide plasmid-mediated gene knockout technology, the escherichia coli is obtained by knocking out an expression functional frame of the endogenous L-asparaginase II gene in bacteria by a targeting vector, and the targeting vector comprises a targeting sequence shown as SEQ ID NO. 1;

the escherichia coli further comprises a polynucleotide expressing an exogenous gene product; the polynucleotide is expressed by a recombinant expression vector dissociating from the genome of the Escherichia coli, or is expressed by site-specific integration on the genome of the Escherichia coli; the exogenous gene is exogenous L-asparaginase II, and the exogenous L-asparaginase II is selected from L-asparaginase II with a sequence shown as SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.

2. Coli according to claim 1, characterized in that it is selected from the strains escherichia coli BL21(DE3), BLR (DE3), Rosetta (DE3), Origami (DE3), JM109, HSM174(DE3), AS1.357 and DH5 a.

3. Coli according to claim 1, characterized in that said e.coli is e.coli BL21(DE 3).

4. The E.coli of claim 1 wherein the recombinant expression vector is pET9a and the signal peptide is a peptide selected from the group consisting of SEQ ID NO:5 or 6.

5. The E.coli strain of claim 1, wherein the targeting sequence is operably linked to a suicide plasmid pCVD 442.

6. The E.coli according to claim 1, wherein said targeting vector is obtained by the following primer set, the sequences of which are shown in the following table:

。