RU2813283C2 - Recombinant strain based on escherichia coli, a method of its construction and use - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: following is proposed: a nucleotide for the enzymatic production of L-threonine, containing a nucleotide sequence formed as a result of a mutation consisting of the replacement of guanine (G) with adenine (A) at the 82nd base of the coding sequence of the wild-type kdtA gene, presented in SEQ ID NO: 1. Also the following is proposed: a recombinant protein for the enzymatic production of L-threonine, encoded by the specified nucleotide, a vector containing the specified nucleotide, a recombinant bacterium containing the specified nucleotide, their use for the enzymatic production of L-threonine, as well as a method of constructing the specified recombinant bacterium.

EFFECT: invention ensures the production of L-threonine in high concentration.

10 cl, 6 tbl, 3 ex

Description

This application claims priority based on Chinese Patent Application No. 2019109262958 filed with the National Intellectual Property Office of China on September 27, 2019, and Chinese Patent Application No. 2019108046792 filed on August 28, 2019, and Chinese Patent Application No. 2019108046881 filed on 28 August 2019, each of which is incorporated herein by reference in its entirety.

TECHNICAL FIELD

The present invention relates to the technical field of genetic engineering and microorganisms, and in particular to a recombinant strain with a modified kdtA gene, a method for its construction and its use.

BACKGROUND OF THE ART

L-threonine is one of the eight essential amino acids, and is an amino acid that humans and animals cannot synthesize on their own. L-threonine is able to improve grain digestibility, regulate in vivo metabolic balance and promote the growth and development of organisms, and therefore it is widely used in the feed, medical and food industries.

At present, L-threonine can be produced mainly by chemical synthesis method, protein hydrolysis method and microbiological fermentation method, and the microbiological fermentation method has the advantages of low production cost, high production intensity and little environmental pollution, so This method is the most widely used among methods for the industrial production of L-threonine. To produce L-threonine by microbiological fermentation, various bacteria, such as mutants obtained by induction of Escherichia coli (E. coli), Corynebacterium and wild-type Serratia, can be used as producer strains. Specific examples include mutants resistant to amino acid analogues or various auxtrophes such as methionine, threonine and isoleucine. However, in traditional mutation breeding, the strain grows slowly and produces more by-products due to random mutations, so it is not easy to obtain a high-yielding strain. Therefore, the construction of recombinant E. coli by metabolic engineering is an effective way to obtain L-threonine. Currently, overexpression or attenuation of genes for key enzymes in the amino acid synthesis pathway and the competition pathway mediated by expression plasmids is the main means of genetic modification of E. coli. There is still a need to develop a more economical method for producing L-threonine with high throughput.

E. coli as a host for exogenous gene expression has advantages such as pure genetic background, simple technical operation and cultivation conditions, and economical large-scale fermentation, and therefore it is receiving increasing attention from genetic engineering experts. The genomic DNA of E. coli is a circular molecule in the nucleoid, and there may also be a variety of circular plasmid DNAs. The nucleoid in E. coli cells has a single DNA molecule that is approximately 4,700,000 base pairs in length and also contains 4,400 genes distributed within the DNA molecule, with each gene having an average length of approximately 1,000 base pairs. Among the E. coli strains commonly used in molecular biology, the most frequently used strains in DNA recombination experiments, with some exceptions, are E. Coli strain K12 and its derivatives.

BRIEF DESCRIPTION OF THE INVENTION

According to the present invention, a recombinant strain based on the Escherichia coli K12 strain or a derivative strain thereof, a method for its recombinant construction and its use for fermentation production of amino acids are proposed. The present invention mainly relates to the wild-type kdtA gene (ORF sequence represented by sequence 73556-74833, GenBank accession number CP032667.1), wild-type spoT gene (ORF sequence represented by sequence 3815907-3818015, GenBank accession number AP009048.1 ), the wild-type yebN gene (the ORF sequence is represented by sequence 1907402-1907968, GenBank accession number AP009048.1) of E. coli strain K12 and its derivatives (such as MG1655 and W3110), and in the present invention it is found that the mutant gene , obtained by subjecting the gene to site-directed mutagenesis, and the recombinant strain containing the gene can be used to produce L-threonine, and compared with the wild-type non-mutant strain, the resulting strain significantly increases the productivity of L-threonine and has good stability, as well as has a lower production cost as an L-threonine producing strain.

Based on the above data, the present invention provides the following three technical solutions:

According to the first technical solution, a nucleotide sequence is proposed containing a sequence formed due to a mutation in ^{the 82nd} base of the coding sequence of the wild type kdtA gene presented in SEQ ID NO: 1.

According to the present invention, a mutation is a change in a base/nucleotide at a site, and the mutation method may be at least one selected from the following methods: mutagenesis, PCR site-directed mutagenesis and/or homologous recombination, etc.

In accordance with the present invention, the mutation is that guanine (G) is replaced by adenine (A) at the ^82nd base in SEQ ID NO: 1; in particular, the mutant nucleotide sequence is shown in SEQ ID NO: 2.

The present invention also provides a recombinant protein encoded by the above nucleotide sequence.

The recombinant protein disclosed herein contains the amino acid sequence of SEQ ID NO: 4.

The present invention also provides a recombinant vector containing the above nucleotide sequence or recombinant protein. The recombinant vector disclosed herein is constructed by introducing the above nucleotide sequence into a plasmid; in one embodiment, the plasmid is a pKOV plasmid. In particular, the nucleotide sequence and plasmid can be digested with an endonuclease to form complementary overhangs, which are ligated to construct a recombinant vector.

The present invention also provides a recombinant strain that contains a coding nucleotide sequence of the akdtA gene containing a point mutation occurring in the coding sequence. The recombinant strain disclosed herein contains the above nucleotide sequence.

In one embodiment of the present invention, the recombinant strain contains the nucleotide sequence set forth in SEQ ID NO: 2. In one embodiment of the present invention, the recombinant strain contains the amino acid sequence set forth in SEQ ID NO: 4. The recombinant strain disclosed herein is constructed by introducing the above recombinant vector into the host strain; The host strain is not specifically defined, but may be selected from L-threonine-producing strains known in the art that contain the kdtA gene, for example Escherichia coli. In one embodiment of the present invention, the host strain is E. coli strain K12 (W3110) or E. coli strain CGMCC 7.232. The recombinant strain disclosed herein uses the pKOV plasmid as a vector.

The recombinant strain of the present invention may or may not additionally contain other modifications.

The present invention also provides a method for constructing a recombinant strain, which comprises the following step:

modifying the nucleotide sequence of the wild-type kdtA gene coding region shown in SEQ ID NO: 1 to allow a mutation to occur at the ^82nd base of the sequence to produce a recombinant L-threonine-producing strain containing a mutant kdtA coding gene. According to the construction method of the present invention, modification includes the use of at least one of the following methods: mutagenesis, site-directed mutagenesis and/or homologous recombination, and the like. According to the construction method of the present invention, the mutation is that guanine (G) is replaced by adenine (A) at the ^82nd base of SEQ ID NO: 1; in particular, the mutant nucleotide sequence is shown in SEQ ID NO: 2.

In addition, the construction method includes the following steps:

(1) modifying the nucleotide sequence of the wild-type kdtA gene open reading frame region shown in SEQ ID NO: 1 to allow mutation to occur at the ^82nd base of the sequence to obtain a mutant nucleotide sequence of the kdtA gene open reading frame region;

(2) ligating the mutant nucleotide sequence to the plasmid to construct a recombinant vector; And

(3) introducing a recombinant vector into a host strain to obtain a recombinant L-threonine-producing strain having a point mutation. According to the construction method of the present invention, step (1) includes: constructing a coding region of the kdtA gene containing a point mutation, particularly including synthesizing two pairs of primers for amplifying fragments of the coding region of the kdtA gene in accordance with the coding sequence of the kdtA gene, and introducing a point mutation mutations into the coding region of the wild-type kdtA gene (SEQ ID NO: 1) using PCR site-directed mutagenesis techniques to obtain the nucleotide sequence (SEQ ID NO: 2) of the coding region of the kdtA gene containing a point mutation, where the nucleotide sequence is designated kdtA ^{( G82A).}

In one embodiment of the present invention, in step (1), the primers are:

P1: 5' CGGGATCCACAGTGAACCCGCCAACA 3' (SEQ ID NO: 5);

P2: 5' TGCGCGGACTGTAAGACTC 3' (SEQ ID NO: 6);

P3: 5' GAGTCTTACGTCCGCGCA 3' (SEQ ID NO: 7); And

P4: 5' AAGGAAAAAAGCGGCCGCTTTCCCCGCACCTTTTATTG 3' (SEQ ID NO: 8).

In one embodiment of the present invention, step (1) includes: using primers P1/P2 and P3/P4 for PCR amplification using E. coli K12 as a template to obtain two isolated DNA fragments (kdtA Up and kdtA Down) having length 927 bp. and 695 p.o. and containing coding regions of the kdtA gene; separating and purifying the two DNA fragments using agarose gel electrophoresis, and then performing PCR with overlapping primers using P1 and P4 as primers and the two DNA fragments as templates to obtain kdtA ^G82A -Up-Down.

In one embodiment of the present invention, the nucleotide sequence of kdtA ^G82A -Up-Down is 1622 bp in length.

In one embodiment of the present invention, PCR amplification is performed as follows: denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and elongation at 72°C for 30 seconds (30 cycles). In one embodiment of the present invention, PCR amplification with overlapping primers is performed as follows: denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and elongation at 72°C for 60 seconds (30 cycles).

According to the construction method according to the present invention, the step

(2) includes: construction of a recombinant vector, specifically comprising separation and purification of the kdtA ^(G82A) -Up-Down fragment using agarose gel electrophoresis, then digestion of the purified fragment and the pKOV plasmid using BamHI/NotI, and separation and purification cleaved kdtA ^(G82A) -Up-Down fragment and cleaved pKOV plasmid using agarose gel electrophoresis followed by ligation to obtain the recombinant vector pKOY-kdtA ^(G82A) .

According to the construction method according to the present invention, the step

(3) includes: constructing a recombinant strain, particularly comprising transforming the recombinant vector pKOV-kdtA ^(G82A) into a host strain to obtain a recombinant strain.

In one embodiment of the present invention, the transformation in step (3) is an electrical transformation process; for example, in step (3), the recombinant vector is introduced into the host strain.

According to the construction method of the present invention, the method further includes the step of screening a recombinant strain; for example, screening is carried out using a culture medium containing chlorine amphetamine.

The present invention also provides a recombinant strain obtained using the above construction method.

The present invention also provides the use of a recombinant strain to produce L-threonine or increase the fermentation volume of L-threonine. Use of the recombinant strain to produce L-threonine involves fermenting the recombinant strain to produce L-threonine.

According to the second technical solution, a nucleotide sequence is proposed that contains a nucleotide sequence formed due to a mutation in the ^520th base of the coding sequence of the spoT gene, presented in SEQ ID NO: 13.

According to the present invention, a mutation is a change in a base/nucleotide at a site, and the mutation method may be at least one selected from the following methods: mutagenesis, PCR site-directed mutagenesis and/or homologous recombination, etc.

In accordance with the present invention, the mutation is that guanine (G) is replaced by thymine (T) at ^{the 520th} base in SEQ ID NO: 13; in particular, the mutant nucleotide sequence is shown in SEQ ID NO: 14.

The present invention provides a recombinant protein encoded by the above nucleotide sequence.

The recombinant protein disclosed herein contains the amino acid sequence set forth in SEQ ID NO: 16; in particular, the recombinant protein contains a replacement of glycine with cysteine at position 174 ^of the amino acid sequence shown in SEQ ID NO: 15.

The present invention provides a recombinant vector containing the above nucleotide sequence or recombinant protein. The recombinant vector disclosed herein is constructed by introducing the above nucleotide sequence into a plasmid; in one embodiment, the plasmid is a pKOV plasmid. In particular, the nucleotide sequence and plasmid can be digested with an endonuclease to form complementary overhangs, which are ligated to construct a recombinant vector.

The present invention also provides a recombinant strain containing a spoT gene coding nucleotide sequence containing a point mutation in the coding sequence, for example, the spoT gene coding nucleotide sequence shown in SEQ ID NO: 13 containing a point mutation at base ⁵²⁰ .

In accordance with the present invention, the mutation is to replace guanine (G) with thymine (T) at the ^520th base in SEQ ID NO: 13.

In one embodiment of the present invention, the recombinant strain contains the nucleotide sequence set forth in SEQ ID NO: 14.

In one embodiment of the present invention, the recombinant strain contains the amino acid sequence set forth in SEQ ID NO: 16. The recombinant strain disclosed herein is constructed by introducing the above recombinant vector into a host strain; The host strain is not specifically defined, but may be selected from L-threonine-producing strains known in the art that contain the spoT gene, for example Escherichia coli. In one embodiment of the present invention, the host strain is E. coli strain K12 (W3110) or E. coli strain CGMCC 7.232.

For the recombinant strain disclosed herein, plasmid pKOV was used as a vector.

The recombinant strain of the present invention may or may not additionally contain other modifications.

The present invention provides a method for constructing a recombinant strain, which comprises the following step:

modifying the nucleotide sequence of the coding region of the spoT gene shown in SEQ ID NO: 13 to allow a mutation to occur at the ^520th base of the sequence to produce a recombinant strain containing a mutant coding spoT gene.

According to the construction method of the present invention, modification includes the use of at least one of the following methods: mutagenesis, PCR site-directed mutagenesis and/or homologous recombination, and the like.

According to the construction method of the present invention, the mutation is that guanine (G) is replaced by thymine (T) at the ^520th base in SEQ ID NO: 13; in particular, the mutant nucleotide sequence is shown in SEQ ID NO: 14.

In addition, the construction method includes the following steps:

(1) modifying the nucleotide sequence of the open reading frame region of the wild-type spoT gene shown in SEQ ID NO: 13 to allow a mutation to occur at base ⁵²⁰ of the sequence to produce a mutant nucleotide sequence;

(2) ligating the mutant nucleotide sequence to the plasmid to construct a recombinant vector; And

(3) introducing a recombinant vector into a host strain to obtain a recombinant strain having a point mutation.

According to the construction method of the present invention, step (1) includes: constructing a coding region of the spoT gene containing a point mutation, particularly including synthesizing two pairs of primers for amplifying fragments of the coding region of the spoT gene according to the coding sequence of the spoT gene, and introducing a point mutation mutations into the coding region of the wild-type spoT gene (SEQ ID NO: 13) using PCR site-directed mutagenesis techniques to obtain the nucleotide sequence (SEQ ID NO: 14) of the coding region of the spoT gene containing a point mutation, where the nucleotide sequence is designated spoT ^{( G520T)} .

In one embodiment of the present invention, in step (1), the primers are:

P1: 5' CGGGATCCGAACAGCAAGAGCAGGAAGC 3' (SEQ ID NO: 17);

P2: 5' TGTGTGTGGATACATAAAACG 3' (SEQ ID NO: 18);

P3: 5' GCACCGTTTATGTATCCACC 3'(SEQ ID NO: 19); And

P4: 5' AAGGAAAAAAGCGGCCGCATCGACAAGTTCAAGCCAAGC 3' (SEQ ID NO: 20).

In one embodiment of the present invention, step (1) includes: using primers P1/P2 and P3/P4 for PCR amplification using E. coli K12 as a template to obtain two isolated DNA fragments (spoT ^(G520T) -Up and spoT ^(G520T) -Down), having a length of 620 bp. and 880 bp and containing coding regions of the spoT gene containing a point mutation; separating and purifying the two DNA fragments using agarose gel electrophoresis, and then performing PCR with overlapping primers using P1 and P4 as primers and the two DNA fragments as templates to obtain the spoT ^(G520T) -Up-Down fragment.

In one embodiment of the present invention, the nucleotide sequence of the spoT ^(G520T) -Up-Down fragment is 1500 bp in length.

In one embodiment of the present invention, PCR amplification is performed as follows: denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and elongation at 72°C for 30 seconds (30 cycles).

In one embodiment of the present invention, PCR amplification with overlapping primers is performed as follows: denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and elongation at 72°C for 60 seconds (30 cycles).

According to the construction method of the present invention, step (2) includes: constructing a recombinant vector, particularly including resolving and purifying the spoT ^(G520T) -Up-Down fragment using agarose gel electrophoresis, then digesting the purified fragment and plasmid pKOV using BamHI /Not I, and separation and purification of the digested fragment and digested pKOV plasmid using agarose gel electrophoresis followed by ligation to obtain the recombinant vector pKOY-spoT ^(G520T) .

According to the construction method of the present invention, step (3) includes: constructing a recombinant strain, particularly including introducing the recombinant vector pKOV-spoT ^(G520T) into a host strain to obtain a recombinant strain.

In one embodiment of the present invention, the introduction in step (3) is an electrotransformation process.

According to the construction method of the present invention, the method further includes the step of screening a recombinant strain; for example, screening is carried out using culture medium with chloramphenicol. The present invention also provides a recombinant strain obtained using the above construction method.

The present invention provides the use of the above recombinant strain for the production of L-threonine.

The use of a nucleotide sequence, a recombinant protein, a recombinant vector, and a recombinant strain to produce L-threonine involves fermenting the recombinant strain to produce L-threonine.

According to the third technical solution, a nucleotide sequence is proposed that contains a nucleotide sequence formed due to a mutation in the ^74th base of the coding sequence of the wild type yebN gene presented in SEQ ID NO: 23.

In accordance with the present invention, the mutation is that guanine (G) is replaced by adenine (A) at the ^74th base in SEQ ID NO: 23; in particular, the nucleotide sequence is shown in SEQ ID NO: 24. A mutation is a change in base/nucleotide at a site, and the mutation method may be at least one selected from the following methods: mutagenesis, site-directed mutagenesis by PCR and/ or homologous recombination, etc.

The present invention provides a recombinant protein encoded by the above nucleotide sequence.

The recombinant protein disclosed herein contains the amino acid sequence set forth in SEQ ID NO: 26; in particular, the recombinant protein contains a substitution of glycine for aspartic acid at the ^25th position of the amino acid sequence shown in SEQ ID NO: 25. The present invention provides a recombinant vector containing the above nucleotide sequence or recombinant protein. The recombinant vector disclosed herein is constructed by introducing the above nucleotide sequence into a plasmid; in one embodiment, the plasmid is a pKOV plasmid. In particular, the nucleotide sequence and plasmid can be digested with an endonuclease to form complementary overhangs, which are ligated to construct a recombinant vector.

The present invention also provides a recombinant strain containing the coding nucleotide sequence of the yebN gene containing a point mutation in the coding sequence, for example, the coding nucleotide sequence Teu&yebN shown in SEQ ID NO: 23 containing a point mutation in the ^74th base.

According to the recombinant strain, the coding nucleotide sequence of the yebN gene contains a mutation in which guanine (G) is replaced by adenine (A) at the ^74th base in SEQ ID NO: 23.

In one embodiment of the present invention, the recombinant strain contains the nucleotide sequence set forth in SEQ ID NO: 24. In one embodiment of the present invention, the recombinant strain contains the amino acid sequence set forth in SEQ ID NO: 26. The recombinant strain disclosed herein is constructed by introducing the above recombinant vector into the host strain; The host strain is not specifically defined, but may be selected from L-threonine-producing strains known in the art that contain the yebN gene, for example Escherichia coli. In one embodiment of the present invention, the host strain is E. coli K12, its derivative strain E. coli K12 (W3110), or E. coli strain CGMCC 7.232.

For the recombinant strain disclosed herein, plasmid pKOV was used as a vector.

The recombinant strain of the present invention may or may not additionally contain other modifications.

The present invention provides a method for constructing a recombinant strain, which comprises the following step:

modifying the nucleotide sequence of the wild-type yebN gene coding region shown in SEQ ID NO: 23 to allow a mutation to occur at the ^74th base of the sequence to produce a recombinant strain containing the mutant yebN coding gene. According to the construction method of the present invention, modification includes the use of at least one of the following methods: mutagenesis, PCR site-directed mutagenesis and/or homologous recombination, and the like.

According to the construction method of the present invention, the mutation is that guanine (G) is replaced by adenine (A) at the ^74th base in SEQ ID NO: 23; in particular, the mutant nucleotide sequence is shown in SEQ ID NO: 24.

In addition, the construction method includes the following steps:

(1) modifying the nucleotide sequence of the open reading frame region of the wild-type yebN gene shown in SEQ ID NO: 1 to allow a mutation to occur at the ^74th base of the sequence to produce a mutant nucleotide sequence of the open reading frame region of the yebN gene;

(2) ligating the mutant nucleotide sequence to the plasmid to construct a recombinant vector; And

(3) introducing the recombinant vector into the host strain to obtain a recombinant strain containing the point mutation.

According to the construction method of the present invention, step (1) includes: constructing a reuayebN coding region containing a point mutation, particularly including synthesizing two pairs of primers for amplifying fragments of the yebN gene coding region according to the coding sequence of the yebN gene, and introducing a point mutation into the coding region of the wild-type yebN gene (SEQ ID NO: 23) using PCR site-directed mutagenesis techniques to obtain the nucleotide sequence (SEQ ID NO: 24) of the coding region of the yebN gene containing a point mutation, where the nucleotide sequence is designated yebN ^{(G74A )} .

In one embodiment of the present invention, in step (1), the primers are:

P1: 5' CGGGATCCCTTTCGCCAATGTCTGGGATTG 3' (SEQ ID NO: 27);

P2: 5' ATGGAGGGGTGGCATSTTTTATS 3' (SEQ ID NO: 28);

P3: 5' TGCATCAATTCGGTAAAAGATG 3' (SEQ ID NO: 29); And

P4: 5' AAGGAAAAAAGCGGGCCGCCAACCTGCACCTCTGCTGTA 3' (SEQ ID NO: 30). In one embodiment of the present invention, step (1) includes: using primers P1/P2 and P3/P4 for PCR amplification using E. coli K12 as a template to obtain two isolated DNA fragments (yebN ^(G74A) -Up and yebN ^(G74A) -Down), having a length of 690 bp. and 700 bp and containing coding regions of the yebN gene containing a point mutation; separating and purifying the two DNA fragments using agarose gel electrophoresis, and then performing PCR with overlapping primers using P1 and P4 as primers and the two DNA fragments as templates to obtain the yebN ^(G74A) -Up-Down fragment.

In one embodiment of the present invention, the nucleotide sequence of the yebN ^(G74A) -Up-Down fragment is 1340 bp in length.

In one embodiment of the present invention, PCR amplification is performed as follows: denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and elongation at 72°C for 30 seconds (30 cycles).

In one embodiment of the present invention, PCR amplification with overlapping primers is performed as follows: denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and elongation at 72°C for 60 seconds (30 cycles).

According to the construction method of the present invention, step (2) includes: constructing a recombinant vector, particularly including resolving and purifying the yebN ^(G74A) -Up-Down fragment using agarose gel electrophoresis, then cleaving the purified fragment and plasmid pKOV using BamH I/Not I, and separation and purification of the cleaved yebN ^(G74A) -Up-Down fragment and the cleaved pKOV plasmid using agarose gel electrophoresis followed by ligation to obtain the recombinant vector pKON-yebN ^(G74A) .

According to the construction method of the present invention, step (3) includes: constructing a recombinant strain, particularly including introducing the recombinant vector pKOV-yebN ^(G74A) into a host strain to obtain a recombinant strain.

In one embodiment of the present invention, the introduction in step (3) is an electrotransformation process.

According to the construction method of the present invention, the method further includes the step of screening a recombinant strain; for example, screening is carried out using culture medium with chloramphenicol. The present invention also provides a recombinant strain obtained using the above construction method.

The present invention provides the use of the above nucleotide sequence, recombinant protein, recombinant vector and recombinant strain for the production of L-threonine.

Use of the recombinant strain to produce L-threonine involves fermenting the recombinant strain to produce L-threonine.

DETAILED DESCRIPTION OF THE INVENTION

The above and other features and advantages of the present invention are described and illustrated in more detail in the following description of examples of the present invention. It should be understood that the following examples are intended to illustrate the technical solutions of the present invention and are in no way intended to limit the scope of legal protection of the present invention as defined in the claims and their equivalents.

Unless otherwise indicated, the materials and reagents presented herein are either commercially available or can be obtained by one skilled in the art in light of the prior art.

Example 1

(1) Construction of Plasmid pKOV-kdtA ^(G82A) with the Coding Region of the kdtA Gene Containing a Site-Directed Mutation (G28A) (equivalent to the replacement of alanine with threonine at position ²⁸ (A28T) in the amino acid sequence SEQ ID NO: 3 encoding the protein wild type, the altered amino acid sequence being SEQ ID NO: 4). 3-deoxy-O-mannosesulfamyltransferase is encoded by the kdtA gene, and in E. coli strain K12 and its derivative strain (eg, MG1655), the ORF sequence of the wild-type kdtA gene is represented by sequence 73556-74833, GenBank accession number CP032667.1. Two pairs of kdtA amplification primers were designed and synthesized according to the sequence, and a vector was constructed for base G replaced with base A at position ⁸² in the coding region sequence of the kdtA gene of the original strain. The primers (synthesized by Shanghai Invitrogen Corporation) had the following structure:

P1: 5' CGGGATCCACAGTGAACCCGCCAACA 3' (SEQ ID NO: 5);

P2: 5' TGCGCGGACTGTAAGACTC 3' (SEQ ID NO: 6);

P3: 5' GAGTCTTACGTCCGCGCA 3' (SEQ ID NO: 7); And

P4: 5' AAGGAAAAAAGCGGCCGCTTTCCCCGCACCTTTTATTG 3' (SEQ ID NO: 8). The construction method was as follows: the use of primers P1/P2 and P3/P4 for PCR amplification using the genome of the wild strain E. coli K12 as a template to obtain two DNA fragments having a length of 927 bp. and 695 p.o. and point mutation (fragments kdtA ^(G82A) -Up and kdtA ^(G82A) -Down). PCR amplification was performed as follows: denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and elongation at 72°C for 30 s (30 cycles). The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were used as templates, and P1 and P4 were used as primers to perform PCR with overlapping primers to obtain the fragment (kdtA ^(G82A) -Up -Down), having a length of approximately 1622 bp. PCR amplification with overlapping primers was performed as follows: denaturation at 94°C for 30 s, annealing at 52°C for 30 s and elongation at 72°C for 60 s (30 cycles). The kdtA ^(G82A) -Up-Down fragment was separated and purified using agarose gel electrophoresis method, then the purified fragment and plasmid pKOV (purchased from Addgene) were digested with BanK VNotl, and the cleaved kdtA ^(G82A) -Up-Down fragment and cleaved The pKOV plasmid was separated and purified using agarose gel electrophoresis followed by ligation to produce the pKO V-kdtA ^(G82A) vector. The V-kdtA ^(GS2A) pKO vector was submitted to a sequencing company for sequencing and identification, the result is shown in SEQ ID NO: 11, and the V-kdtA ^(GS2A) pKO vector with the correct point mutation (kdtA ^(GS2A) ) was saved for later use. (2) Construction of a Modified Strain with the kdtA ^(GS2A) gene _. Containing a Point Mutation

The wild-type kdtA gene was conserved on the chromosomes of the wild-type Escherichia coli strain E. coli K12 (W3110) and the highly capable L-threonine-producing E. coli strain CGMCC 7.232 (preserved in the China General Microbiological Culture Collection Center). The constructed plasmid pKOV-kdtA ^(GS2A) was transferred into E. coli K12 (W3110) and E. coliCGM.CC 7.232, respectively, and by allelic replacement, base G was replaced by base A at position 82 ^of the kdtA gene sequences in the chromosomes of the two strains. This method was carried out as follows: transformation of the plasmid pKO V -kdtA(G82A) into competent cells of the host bacterium through the electrotransformation process, and adding the cells to 0.5 ml of liquid culture medium SOC; stirring the mixture in a shaker at 30°C and 100 rpm for 2 hours; applying 100 μl of culture solution to LB solid culture medium containing chloramphenicol (34 mg/ml), and culturing at 30°C for 18 hours; selecting grown monoclonal colonies, inoculating colonies in 10 ml of LB liquid culture medium, and culturing at 37°C and 200 rpm for 8 hours; applying 100 μl of culture solution to LB solid culture medium containing chloramphenicol (34 mg/ml), and culturing at 42°C for 12 hours; selection of 15 single colonies, inoculation of colonies in 1 ml of liquid LB medium and cultivation at 37°C and 200 rpm for 4 hours; application to a solid culture medium containing 10% sucrose, 100 μl of culture solution, and cultivation at 30°C for 24 hours; selecting monoclonal colonies and isolating colonies on LB solid culture medium containing chloramphenicol (34 mg/ml) and in a one to one ratio with LB solid culture medium; and selecting strains that grow on solid LB culture medium and do not grow on solid LB culture medium containing chloramphenicol (34 mg/ml) for identification by PCR amplification. The primers (synthesized by Shanghai hivitrogen Corporation) for use in PCR amplification were as follows:

P5: 5' CTTCCCGAAAAGGCCGATTG3' (SEQ ID NO: 9); And

P6: 5' ACAAATATATTTAATTC 3' (SEQ ID NO: 10).

SSCP (Single-Strand DNA Conformational Polymorphism Assay) electrophoresis was performed on the PCR-amplified product; the amplified fragment of plasmid pKOV-kdtA ^(G82A) was used for the positive control, the amplified fragment of wild-type Escherichia coli was used for the negative control, and water was used for the blank sample. In SSCP electrophoresis, single-stranded nucleotide chains having the same length but different sequence structures formed different spatial structures in the ice bath and also had different mobility during electrophoresis. Therefore, the position of the fragment on electrophoresis does not correspond to the position of the material used for the negative control, and a strain in which the position of the fragment on electrophoresis corresponds to the position of the material used for the positive control is the strain with the allele successfully replaced. PCR amplification was performed on the target fragment by using the successfully replaced allele strain as a template and using primers P5 and P6, and then the target fragment was ligated into the pMD19-T vector for sequencing. By comparing the sequences obtained from sequencing, it was determined that the recon formed by replacing base G with base A at position ⁸² in the sequence of the coding region of the kdtA gene was a successfully modified strain, and the sequencing results are shown in SEQ ID NO: 12. Recon , derived from E. coli K12 (W3110) was named YPThr07, and the recon derived from E. coli CGMCC 7.232 was named YPThr 08.

(3) Threonine Fermentation Experiment

E. coli strain K12 (W3110), E. coli strain CGMCC 7.232 and mutant strains YPThr07 and YPThr08 were inoculated at 25 ml in the liquid culture medium described in Table 1, respectively, and cultured at 37°C and 200 rpm for 12 hours. Then, 1 ml of the resulting culture of each strain was inoculated into 25 ml of the liquid nutrient medium described in Table 1, and fermented at 37°C and 200 rpm for 36 hours. The L-threonine content was determined using the HPLC method, three copies of each strain were selected, the average value was calculated, the results are presented in Table 2.

As can be seen from the results of Table 2, replacing alanine in the ^28th position of the amino acid sequence of the kdtA gene with threonine helps to increase the productivity of L-threonine for the original strain producing L-threonine, both with high and low productivity.

Example 2

(1) Construction of Plasmid pKOV-spoT ^(G520T) with the Coding Region of the spoT Gene Containing a Site-Directed Mutation (G520T) (equivalent to the replacement of glycine by cysteine at position ¹⁷⁴ (G174C) in the protein-coding amino acid sequence SEQ ID NO: 15, the altered amino acid sequence is SEQ ID NO: 16)

The SPOT enzyme is encoded by the spoT gene, and in E. coli strain K12 and its derivative strain (eg, W3110), the ORF sequence of the wild-type spoT gene is represented by sequence 3815907-3818015, GenBank accession number AP009048.1. Two pairs of spoT amplification primers were designed and synthesized according to the sequence, and a vector was constructed for base G replaced with base A at position ⁵²⁰ in the coding region sequence of the spoT gene of the original strain. The primers (synthesized by Shanghai mvitrogen Corporation) have the following structure:

P1: 5' CGGGATCCGAACAGCAAGAGCAGGAAGC 3' (the underlined portion indicates the BamYL I restriction endonuclease cut site) (SEQ ID NO: 17);

P2: 5' TGTGTGTGGATACATAAAACG 3' (SEQ ID NO: 18);

P3: 5' GCACCGTTTATGTATCCACC 3' (SEQ ID NO: 19); And

P1: 5' AAGGAAAAAAGCGGGCCGCACGCAAGCAAGTTCAGCCCAAGC 3' (the underlined portion indicates the Not I restriction endonuclease cut site) (SEQ ID NO: 20); The construction method was as follows: the use of primers P1/P2 and P3/P4 for PCR amplification using the genome of the wild strain E. coli K12 as a template to obtain two DNA fragments having a length of 620 bp. and 880 bp and point mutation (fragments spoT ^(G520T) -Up and spoT ^(G520T) -Down). PCR system: 10 × Ex Taq buffer 5 µl, dNTP mixture (2.5 mmol each) 4 µl, Mg ²⁺ (25 mmol) 4 µl, primers (10 pmol) 2 µl each, Ex Taq (5 U/µl ) 0.25 μl, total volume 50 μl, where PCR was performed as follows: denaturation at 94°C for 30 s, annealing at 52°C for 30 s, elongation at 72°C for 30 s (30 cycles). The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were used as templates, and P1 and P4 were used as primers to perform PCR with overlapping primers to obtain the fragment (spoT ^(G520T) -Up -Down), having a length of approximately 1500 bp. PCR system: 10 x Ex Taq buffer 5 μl, dNTP mixture (2.5 mmol each) 4 μl, Mg ²⁺ (25 mmol) 4 μl, primers (10 pmol) 2 µl each, Ex Taq (5 U/µl) 0.25 µl, total volume 50 µl, where PCR with overlapping primers was carried out as follows: denaturation at 94°C for 30 s, annealing at 52°C for 30 s, elongation at 72°C for 60 s (30 cycles). The spoT ^(G520T) -Up-Down fragment was separated and purified using agarose gel electrophoresis method, then the purified fragment and plasmid pKOV (purchased from Addgene) were digested with BamH I/NotI, and the digested spoT ^(G520T) -Up-Down fragment and cleaved pKOV plasmid were separated and purified using agarose gel electrophoresis followed by ligation to obtain the pKO vector V-spoT ^(G520T) . The pKOV-spoT ^(G520T) vector was sent to a sequencing company for sequencing and identification, and the pKOY-spoT ^(G520T) vector with the correct point mutation (spoT ^(G520T) ) was stored for later use.

(2) Construction of a Modified Strain with the spoT gene ^(G520T) Containing a Point Mutation

The wild-type spoT gene was conserved on the chromosomes of the wild-type Escherichia coli strain E. coli K12 (W3110) and the highly capable L-threonine-producing E. coli strain CGMCC 7.232 (preserved in the China General Microbiological Culture Collection Center). The constructed plasmid pKOV-spoT ^(G520T) was transferred into E. coli K12 (W3110) and E. coliCGM.CC 7.232, respectively, and by allelic replacement, the G base was replaced with a T base at position 520 of the spoT gene sequences in the chromosomes of the two strains. This method was carried out as follows: transformation of the plasmid pKO V-spoT ^(G520T) into competent host bacterial cells through the electrotransformation process, and adding the cells to 0.5 ml of SOC liquid culture medium; stirring the mixture in a shaker at 30°C and 100 rpm for 2 hours; applying 100 μl of culture solution to LB solid culture medium containing chloramphenicol (34 μg/ml), and culturing at 30°C for 18 hours; selecting grown monoclonal colonies, inoculating colonies in 10 ml of LB liquid culture medium, and culturing at 37°C and 200 rpm for 8 hours; applying 100 μl of culture solution to LB solid culture medium containing chloramphenicol (34 μg/ml), and culturing at 42°C for 12 hours; selection of 15 single colonies, inoculation of colonies in 1 ml of liquid LB medium and cultivation at 37°C and 200 rpm for 4 hours; application to a solid culture medium containing 10% sucrose, 100 μl of culture solution, and cultivation at 30°C for 24 hours; selecting monoclonal colonies and isolating colonies on LB solid culture medium containing chloramphenicol (34 μg/ml) and in a one-to-one ratio with LB solid culture medium; and selecting strains that grow on solid LB culture medium and do not grow on solid LB culture medium containing chloramphenicol (34 μg/ml) for identification by PCR amplification. The primers (synthesized by Shanghai Invitrogen Corporation) for PCR amplification were as follows:

P5: 5' CTTTTGCAAGATGATTATGG 3' (SEQ ID NO: 21); And

P6: 5' CACGGTATTCCCGCTTTCTCTG 3' (SEQ ID NO: 22).

PCR system: 10 × Ex Taq buffer 5 µl, dNTP mixture (2.5 mmol each) 4 µl, Mg ²⁺ (25 mmol) 4 µl, primers (10 pmol) 2 µl each, Ex Taq (5 U/µl ) 0.25 μl, total volume 50 μl, where PCR amplification was carried out as follows: predenaturation at 94°C for 5 minutes, (denaturation at 94°C for 30 s, annealing at 52°C for 30 s, elongation at 72°C for 30 s, 30 cycles), and re-elongation at 72°C for 10 minutes. SSCP (Single-Strand DNA Conformational Polymorphism Assay) electrophoresis was performed on the PCR-amplified product; the amplified fragment of plasmid pKOV-spoT ^(G520T) was used for the positive control, the amplified fragment of wild-type Escherichia coli was used for the negative control, and water was used for the blank sample. In SSCP electrophoresis, single-stranded nucleotide chains having the same length but different sequence structures formed different spatial structures in the ice bath and also had different mobility during electrophoresis. Therefore, the position of the fragment on electrophoresis does not correspond to the position of the material used for the negative control, and a strain in which the position of the fragment on electrophoresis corresponds to the position of the material used for the positive control is the strain with the allele successfully replaced. PCR amplification was performed on the target fragment by using the successfully replaced allele strain as a template and using primers P5 and P6, and then the target fragment was ligated into the pMD19-T vector for sequencing. By comparing the sequences obtained from sequencing, it was determined that the recon formed by replacing the G base with a T base at position 520 in the sequence of the coding region of the spoT gene was a successfully modified strain. The recon derived from E. coli K12 (W3110) was named YPThr03, and the recon derived from E. coli CGMCC 7.232 was named YPThr 04.

(3) Threonine Fermentation Experiment

E. coli strain K12 (W3110), E. coli strain CGMCC 7.232 and mutant strains YPThr03 and YPThr04 were inoculated at 25 ml in the liquid culture medium described in Table 1, respectively, and cultured at 37°C and 200 rpm for 12 hours. Then, 1 ml of the resulting culture of each strain was inoculated into 25 ml of the liquid nutrient medium described in Table 1, and fermented at 37°C and 200 rpm for 36 hours. The L-threonine content was determined using the HPLC method, three copies of each strain were selected, the average value was calculated, the results are presented in Table 2.

As can be seen from the results of Table 2, replacing glycine in the ^174th position of the amino acid sequence of the spoT gene with cysteine helps to increase the productivity of L-threonine for the original strain producing L-threonine, both with high and low productivity.

Example 3:

(1) Construction of Plasmid pKOV-yebN ^(G74A) with the Coding Region of the yebN Gene Containing a Site-Directed Mutation (G74A) (equivalent to the replacement of glycine with aspartic acid at the 25th base (G25D) in the protein-coding amino acid sequence SEQ ID NO: 25 , the altered amino acid sequence is SEQ ID NO: 26)

The YEBN enzyme is encoded by the yebN gene, and in E. coli strain K12 and its derivative strain (eg, W3110), the ORF sequence of the wild-type yebN gene is represented by sequence 1907402-1907968, GenBank accession number AP009048.1. Two pairs of yebN amplification primers were designed and synthesized according to the sequence, and a vector was constructed for base G replaced with base A at position 74 in the coding region sequence of the yebN gene of the original strain. The primers (synthesized by Shanghai mvitrogen Corporation) have the following structure:

P1: 5' CGGGATCCCTTTCGCCAATGTCTGGATTG 3' (the underlined part indicates the site of excision by Bam H I restriction endonuclease) (SEQ ID NO: 27);

P2: 5' ATGGAGGGGTGGCATCTTTAC 3' (SEQ ID NO: 28);

P3: 5' TGCATCAATTCGGTAAAAGATG 3' (SEQ ID NO:29); And

P4: 5' AAGGAAAAAAGCGGGCCGCCAACCTCCGCACCTCTGCTGTA 3' (the underlined portion indicates the Not I restriction endonuclease cut site) (SEQ ID NO: 30). The construction method was as follows: the use of primers P1/P2 and P3/P4 for PCR amplification using the genome of the wild strain E. coli K12 as a template to obtain two DNA fragments having a length of 690 bp. and 700 p.o. and a point mutation (fragments yebN ^(G74A) -Up and yebN ^(G74A) -Down). PCR system: 10 × Ex Taq buffer 5 µl, dNTP mixture (2.5 mmol each) 4 µl, Mg ²⁺ (25 mmol) 4 µl, primers (10 pmol) 2 µl each, Ex Taq (5 U/µl ) 0.25 μl, total volume 50 μl, where PCR was performed as follows: denaturation at 94°C for 30 s, annealing at 52°C for 30 s, elongation at 72°C for 30 s (30 cycles). The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were used as templates, and P1 and P4 were used as primers to perform PCR with overlapping primers to obtain the fragment (yebN ^(G74A) -Up -Down), having a length of approximately 1340 bp.

PCR system: 10 × Ex Taq buffer 5 µl, dNTP mixture (2.5 mmol each) 4 µl, Mg ²⁺ (25 mmol) 4 µl, primers (10 pmol) 2 µl each, Ex Taq (5 U/µl ) 0.25 μl, total volume 50 μl, where PCR with overlapping primers was carried out as follows: denaturation at 94°C for 30 s, annealing at 52°C for 30 s, elongation at 72°C for 60 s (30 cycles).

The yebN ^(G74A) -Up-Down fragment was separated and purified using agarose gel electrophoresis method, then the purified fragment and plasmid pKOV (purchased from Addgene) were digested with BamH I/NotI, and the digested yebN ^(G74A) -Up-Down fragment and cleaved pKOV plasmid were separated and purified using agarose gel electrophoresis followed by ligation to produce the pKO V - yebN ^(G74A) vector. The pKOY-yebN ^(G74A) vector was sent to a sequencing company for sequencing and identification, and the vector pKOV-yebN ^(G74A) with the correct point mutation (yebN ^(G74A) ) was saved for later use.

(2) Construction of a Modified Strain with the yebN ^(G74A) Gene Containing a Point Mutation

The wild-type yebN gene was conserved on the chromosomes of the wild-type Escherichia coli strain E. coli K12 (W3110) and the highly capable L-threonine-producing E. coli strain CGMCC 7.232 (preserved in the China General Microbiological Culture Collection Center). The constructed plasmid pKOV-yebN ^(G74A) was transferred into E. coli K12 (W3110) and E. coZ/CGMCC 7.232, respectively, and by allelic substitution, the G base was replaced by an A base at the ^74th position of the genome sequences of the two strains.

This method was carried out as follows: transformation of the plasmid pKO V -yebN ^(G74A) into competent cells of the host bacterium through the process of electrotransformation, and adding the cells to 0.5 ml of liquid culture medium SOC; stirring the mixture in a shaker at 30°C and 100 rpm for 2 hours; applying 100 μl of culture solution to LB solid culture medium containing chloramphenicol (34 μg/ml), and culturing at 30°C for 18 hours; selecting grown monoclonal colonies, inoculating colonies in 10 ml of LB liquid culture medium, and culturing at 37°C and 200 rpm for 8 hours; applying 100 μl of culture solution to LB solid culture medium containing chloramphenicol (34 μg/ml), and culturing at 42°C for 12 hours; selection of 1-5 single colonies, inoculation of colonies in 1 ml of liquid LB medium and cultivation at 37°C and 200 rpm for 4 hours; application to a solid culture medium containing 10% sucrose, 100 μl of culture solution, and cultivation at 30°C for 24 hours; selecting monoclonal colonies and isolating colonies on LB solid culture medium containing chloramphenicol (34 μg/ml) and in a one-to-one ratio with LB solid culture medium; and selecting strains that grow on solid LB culture medium and do not grow on solid LB culture medium containing chloramphenicol (34 μg/ml) for identification by PCR amplification. The primers (synthesized by Shanghai Invitrogen Corporation) for PCR amplification were as follows:

P5: 5' CCATCACCGGCTTGTTTGTTC 3' (SEQ ID NO: 31); And

P6: 5' ACGAAAAATCCTTCAATAATTC 3' (SEQ ID NO: 32).

PCR system: 10 × Ex Taq buffer 5 µl, dNTP mixture (2.5 mmol each) 4 µl, Mg ²⁺ (25 mmol) 4 µl, primers (10 pmol) 2 µl each, Ex Taq (5 U/µl ) 0.25 μl, total volume 50 μl, where PCR amplification was carried out as follows: predenaturation at 94°C for 5 minutes, (denaturation at 94°C for 30 s, annealing at 52°C for 30 s, elongation at 72°C for 30 s, 30 cycles), and re-elongation at 72°C for 10 minutes. SSCP (Single-Strand DNA Conformational Polymorphism Analysis) electrophoresis was performed on the PCR-amplified product; the amplified fragment of plasmid pKOV-yebN ^(G74A) was used for the positive control, the amplified fragment of wild-type Escherichia coli was used for the negative control, and water was used for the blank sample. In SSCP electrophoresis, single-stranded nucleotide chains having the same length but different sequence structures formed different spatial structures in the ice bath and also had different mobility during electrophoresis. Therefore, the position of the fragment on electrophoresis does not correspond to the position of the material used for the negative control, and a strain in which the position of the fragment on electrophoresis corresponds to the position of the material used for the positive control is the strain with the allele successfully replaced. PCR amplification was performed on the target fragment by using the successfully replaced allele strain as a template and using primers P5 and P6, and then the target fragment was ligated into the pMD19-T vector for sequencing. By comparing the sequences obtained from sequencing, it was determined that the recon formed by replacing base G with base A at position 74 in the sequence of the coding region of the yebN gene was a successfully modified strain. The recon derived from E. coli K12 (W3110) was named YPThr05, and the recon derived from E. coli CGMCC 7.232 was named YPThr 06.

(3) Threonine Fermentation Experiment

E. coli strain K12 (W3110), E. coli strain CGMCC 7.232 and mutant strains YPThr05 and YPThr06 were inoculated at 25 ml in the liquid culture medium described in Table 1, respectively, and cultured at 37°C and 200 rpm for 12 hours. Then, 1 ml of the resulting culture of each strain was inoculated into 25 ml of the liquid nutrient medium described in Table 1, and fermented at 37°C and 200 rpm for 36 hours. The L-threonine content was determined using the HPLC method, three copies of each strain were selected, the average value was calculated, the results are presented in Table 2.

As can be seen from the results of Table 2, the replacement of glycine in the ^25th position of the amino acid sequence of the yebN gene with aspartic acid helps to increase the production of L-threonine by the original strain producing L-threonine, both with high and low productivity.

Examples according to the present invention are described above. However, the present invention is not limited to the above examples. Any changes, equivalents, improvements, etc., made without departing from the essence and principle of the present invention, fall within the scope of legal protection of the present invention.

--->

Sequence Sheet

<110> Heilongjiang Eppen Biotech Co., Ltd

<120> RECOMBINANT STRAIN BASED ON ESCHERICHIACOLI, ITS METHOD

DESIGN AND ITS APPLICATION

<130>CPWO20110939

<160> 32

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1278

<212> DNA

<213> Escherichia coli

<400> 1

atgctcgaat tgctttacac cgcccttctc taccttattc agccgctgat ctggatacgg

60

ctctgggtgc gcggacgtaa ggctccggcc tatcgaaaac gctggggtga acgttacggt

120

ttttaccgcc atccgctaaa accaggcggc attatgctgc actccgtctc cgtcggtgaa

180

actctggcgg caatcccgtt ggtgcgcgcg ctgcgtcatc gttatcctga tttaccgatt

240

accgtaacaa ccatgacgcc aaccggttcg gagcgcgtac aatcggcttt cgggaaggat

300

gttcagcacg tttatctgcc gtatgatctg cccgatgcac tcaaccgttt cctgaataaa

360

gtcgacccta aactggtgtt gattatggaa accgaactat ggcctaacct gattgcggcg

420

ctacataaac gtaaaattcc gctggtgatc gctaacgcgc gactctctgc ccgctcggcc

480

gcaggttatg ccaaactggg taaattcgtc cgtcgcttgc tgcgtcgtat tacgctgatt

540

gctgcgcaaa atgaagaaga tggtgcacgt tttgtggcgc tgggcgcaaa aaataatcag

600

gtgaccgtta ccggtagcct gaaattcgat atttctgtaa cgccgcagtt ggctgctaaa

660

gccgtgacgc tgcgccgcca gtgggcacca caccgcccgg tatggattgc caccagcact

720

cacgaaggcg aagagagtgt ggtgatcgcc gcacatcagg cattgttaca gcaattcccg

780

aatttattgc tcatcctggt accccgtcat ccggaacgct tcccggatgc gattaacctt

840

gtccgccagg ctggactaag ctatatcaca cgctcttcag gggaagtccc ctccaccagc

900

acgcaggttg tggttggcga tacgatgggc gagttgatgt tactgtatgg cattgccgat

960

ctcgcctttg ttggcggttc actggttgaa cgtggtgggc ataatccgct ggaagctgcc

1020

gcacacgcta ttccggtatt gatggggccg catactttta actttaaaga catttgcgcg

1080

cggctggagc aggcaagcgg gctgattacc gttaccgatg ccactacgct tgcaaaagag

1140

gtttcctctt tactcaccga cgccgattac cgtagtttct atggccgtca tgccgttgaa

1200

gtactgtatc aaaaccaggg cgcgctacag cgtctgcttc aactgctgga accttacctg

1260

ccaccgaaaacgcattga

1278

<210> 2

<211> 1278

<212> DNA

<213> Artificial sequence

<400> 2

atgctcgaattgctttacaccgcccttctctaccttattcagccgctgatctggatacgg

60

ctctgggtgcgcggacgtaagactccggcctatcgaaaacgctggggtgaacgttacggt

120

ttttaccgccatccgctaaaaccaggcggcattatgctgcactccgtctccgtcggtgaa

180

actctggcggcaatcccgttggtgcgcgcgctgcgtcatcgttatcctgatttaccgatt

240

accgtaacaaccatgacgccaaccggttcggagcgcgtacaatcggctttcgggaaggat

300

gttcagcacgtttatctgccgtatgatctgcccgatgcactcaaccgtttcctgaataaa

360

gtcgaccctaaactggtgttgattatggaaaccgaactatggcctaacctgattgcggcg

420

ctacataaacgtaaaattccgctggtgatcgctaacgcgcgactctctgcccgctcggcc

480

gcaggttatgccaaactgggtaaattcgtccgtcgcttgctgcgtcgtattacgctgatt

540

gctgcgcaaaatgaagaagatggtgcacgttttgtggcgctgggcgcaaaaaataatcag

600

gtgaccgttaccggtagcctgaaattcgatatttctgtaacgccgcagttggctgctaaa

660

gccgtgacgctgcgccgccagtgggcaccacaccgcccggtatggattgccaccagcact

720

cacgaaggcgaagagagtgtggtgatcgccgcacatcaggcattgttacagcaattcccg

780

aatttattgctcatcctggtaccccgtcatccggaacgcttcccggatgcgattaacctt

840

gtccgccaggctggactaagctatatcacacgctcttcaggggaagtcccctccaccagc

900

acgcaggttgtggttggcgatacgatgggcgagttgatgttactgtatggcattgccgat

960

ctcgcctttgttggcggttcactggttgaacgtggtgggcataatccgctggaagctgcc

1020

gcacacgctattccggtattgatggggccgcatacttttaactttaaagacatttgcgcg

1080

cggctggagcaggcaagcgggctgattaccgttaccgatgccactacgcttgcaaaagag

1140

gtttcctctttactcaccgacgccgattaccgtagtttctatggccgtcatgccgttgaa

1200

gtactgtatcaaaaccagggcgcgctacagcgtctgcttcaactgctggaaccttacctg

1260

ccaccgaaaa cgcattga

1278

<210> 3

<211> 425

<212> PROTEIN

<213> Escherichia coli

<400> 3

Met Leu Glu Leu Leu Tyr Thr Ala Leu Leu Tyr Leu Ile Gln Pro Leu

1 5 10 15

Ile Trp Ile Arg Leu Trp Val Arg Gly Arg Lys Ala Pro Ala Tyr Arg

20 25 30

Lys Arg Trp Gly Glu Arg Tyr Gly Phe Tyr Arg His Pro Leu Lys Pro

35 40 45

Gly Gly Ile Met Leu His Ser Val Ser Val Gly Glu Thr Leu Ala Ala

50 55 60

Ile Pro Leu Val Arg Ala Leu Arg His Arg Tyr Pro Asp Leu Pro Ile

65 70 75 80

Thr Val Thr Thr Met Thr Pro Thr Gly Ser Glu Arg Val Gln Ser Ala

85 90 95

Phe Gly Lys Asp Val Gln His Val Tyr Leu Pro Tyr Asp Leu Pro Asp

100 105 110

Ala Leu Asn Arg Phe Leu Asn Lys Val Asp Pro Lys Leu Val Leu Ile

115 120 125

Met Glu Thr Glu Leu Trp Pro Asn Leu Ile Ala Ala Leu His Lys Arg

130 135 140

Lys Ile Pro Leu Val Ile Ala Asn Ala Arg Leu Ser Ala Arg Ser Ala

145 150 155 160

Ala Gly Tyr Ala Lys Leu Gly Lys Phe Val Arg Arg Leu Leu Arg Arg

165 170 175

Ile Thr Leu Ile Ala Ala Gln Asn Glu Glu Asp Gly Ala Arg Phe Val

180 185 190

Ala Leu Gly Ala Lys Asn Asn Gln Val Thr Val Thr Gly Ser Leu Lys

195 200 205

Phe Asp Ile Ser Val Thr Pro Gln Leu Ala Ala Lys Ala Val Thr Leu

210 215 220

Arg Arg Gln Trp Ala Pro His Arg Pro Val Trp Ile Ala Thr Ser Thr

225 230 235 240

His Glu Gly Glu Glu Ser Val Val Ile Ala Ala His Gln Ala Leu Leu

245 250 255

Gln Gln Phe Pro Asn Leu Leu Leu Ile Leu Val Pro Arg His Pro Glu

260 265 270

Arg Phe Pro Asp Ala Ile Asn Leu Val Arg Gln Ala Gly Leu Ser Tyr

275 280 285

Ile Thr Arg Ser Ser Gly Glu Val Pro Ser Thr Ser Thr Gln Val Val

290 295 300

Val Gly Asp Thr Met Gly Glu Leu Met Leu Leu Tyr Gly Ile Ala Asp

305 310 315 320

Leu Ala Phe Val Gly Gly Ser Leu Val Glu Arg Gly Gly His Asn Pro

325 330 335

Leu Glu Ala Ala Ala His Ala Ile Pro Val Leu Met Gly Pro His Thr

340 345 350

Phe Asn Phe Lys Asp Ile Cys Ala Arg Leu Glu Gln Ala Ser Gly Leu

355 360 365

Ile Thr Val Thr Asp Ala Thr Thr Leu Ala Lys Glu Val Ser Ser Leu

370 375 380

Leu Thr Asp Ala Asp Tyr Arg Ser Phe Tyr Gly Arg His Ala Val Glu

385 390 395 400

Val Leu Tyr Gln Asn Gln Gly Ala Leu Gln Arg Leu Leu Gln Leu Leu

405 410 415

Glu Pro Tyr Leu Pro Pro Lys Thr His

420 425

<210> 4

<211> 425

<212> PROTEIN

<213> Artificial sequence

<400> 4

Met Leu Glu Leu Leu Tyr Thr Ala Leu Leu Tyr Leu Ile Gln Pro Leu

1 5 10 15

Ile Trp Ile Arg Leu Trp Val Arg Gly Arg Lys Thr Pro Ala Tyr Arg

20 25 30

Lys Arg Trp Gly Glu Arg Tyr Gly Phe Tyr Arg His Pro Leu Lys Pro

35 40 45

Gly Gly Ile Met Leu His Ser Val Ser Val Gly Glu Thr Leu Ala Ala

50 55 60

Ile Pro Leu Val Arg Ala Leu Arg His Arg Tyr Pro Asp Leu Pro Ile

65 70 75 80

Thr Val Thr Thr Met Thr Pro Thr Gly Ser Glu Arg Val Gln Ser Ala

85 90 95

Phe Gly Lys Asp Val Gln His Val Tyr Leu Pro Tyr Asp Leu Pro Asp

100 105 110

Ala Leu Asn Arg Phe Leu Asn Lys Val Asp Pro Lys Leu Val Leu Ile

115 120 125

Met Glu Thr Glu Leu Trp Pro Asn Leu Ile Ala Ala Leu His Lys Arg

130 135 140

Lys Ile Pro Leu Val Ile Ala Asn Ala Arg Leu Ser Ala Arg Ser Ala

145 150 155 160

Ala Gly Tyr Ala Lys Leu Gly Lys Phe Val Arg Arg Leu Leu Arg Arg

165 170 175

Ile Thr Leu Ile Ala Ala Gln Asn Glu Glu Asp Gly Ala Arg Phe Val

180 185 190

Ala Leu Gly Ala Lys Asn Asn Gln Val Thr Val Thr Gly Ser Leu Lys

195 200 205

Phe Asp Ile Ser Val Thr Pro Gln Leu Ala Ala Lys Ala Val Thr Leu

210 215 220

Arg Arg Gln Trp Ala Pro His Arg Pro Val Trp Ile Ala Thr Ser Thr

225 230 235 240

His Glu Gly Glu Glu Ser Val Val Ile Ala Ala His Gln Ala Leu Leu

245 250 255

Gln Gln Phe Pro Asn Leu Leu Leu Ile Leu Val Pro Arg His Pro Glu

260 265 270

Arg Phe Pro Asp Ala Ile Asn Leu Val Arg Gln Ala Gly Leu Ser Tyr

275 280 285

Ile Thr Arg Ser Ser Gly Glu Val Pro Ser Thr Ser Thr Gln Val Val

290 295 300

Val Gly Asp Thr Met Gly Glu Leu Met Leu Leu Tyr Gly Ile Ala Asp

305 310 315 320

Leu Ala Phe Val Gly Gly Ser Leu Val Glu Arg Gly Gly His Asn Pro

325 330 335

Leu Glu Ala Ala Ala His Ala Ile Pro Val Leu Met Gly Pro His Thr

340 345 350

Phe Asn Phe Lys Asp Ile Cys Ala Arg Leu Glu Gln Ala Ser Gly Leu

355 360 365

Ile Thr Val Thr Asp Ala Thr Thr Leu Ala Lys Glu Val Ser Ser Leu

370 375 380

Leu Thr Asp Ala Asp Tyr Arg Ser Phe Tyr Gly Arg His Ala Val Glu

385 390 395 400

Val Leu Tyr Gln Asn Gln Gly Ala Leu Gln Arg Leu Leu Gln Leu Leu

405 410 415

Glu Pro Tyr Leu Pro Pro Lys Thr His

420 425

<210> 5

<211> 26

<212> DNA

<213> Artificial sequence

<400> 5

cgggatccaccagtgaaccgccaaca

26

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

tgcgcggacgtaagactc

18

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence

<400> 7

gagtcttacgtccgcgca

18

<210> 8

<211> 35

<212> DNA

<213> Artificial sequence

<400> 8

aaggaaaaaagcggccgcttcccgcacctttattg

35

<210> 9

<211> 18

<212> DNA

<213> Artificial sequence

<400> 9

cttcccgaaagccgattg

18

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence

<400> 10

acaaaatatactttaatc

18

<210> 11

<211> 1596

<212> DNA

<213> Artificial sequence

<400> 11

accagtgaaccgccaacaaaggcgagatcggcaatgccatacagtaacatcaactcgccc

60

atcgtatcgccaaccacaacctgcgtgctggtggaggggacttcccctgaagagcgtgtg

120

atatagcttagtccagcctggcggacaaggttaatcgcatccgggaagcgttccggatga

180

cggggtaccaggatgagcaataaattcgggaattgctgtaacaatgcctgatgtgcggcg

240

atcaccacactctcttcgccttcgtgagtgctggtggcaatccataccgggcggtgtggt

300

gcccactggcggcgcagcgtcacggctttagcagccaactgcggcgttacagaaatatcg

360

aatttcaggctaccggtaacggtcacctgattattttttgcgcccagcgccacaaaacgt

420

gcaccatcttcttcattttgcgcagcaatcagcgtaatacgacgcagcaagcgacggacg

480

aatttacccagtttggcataacctgcggccgagcgggcagagagtcgcgcgttagcgatc

540

accagcggaattttacgtttatgtagcgccgcaatcaggttaggccatagttcggtttcc

600

ataatcaacaccagtttagggtcgactttattcaggaaacggttgagtgcatcgggcaga

660

tcatacggcagataaacgtgctgaacatccttcccgaaagccgattgtacgcgctccgaa

720

ccggttggcgtcatggttgttacggtaatcggtaaatcaggataacgatgacgcagcgcg

780

cgcaccaacgggattgccgccagagtttcaccgacggagacggagtgcagcataatgccg

840

cctggttttagcggatggcggtaaaaaccgtaacgttcaccccagcgttttcgataggcc

900

ggagacttacgtccgcgcacccagagccgtatccagatcagcggctgaataaggtagaga

960

agggcggtgtaaagcaattcgagcatagtaaatagctgacttatggatgtgctggggatt

1020

ctatgtatttagctgtggctttaccattacttttcccgtttttgacttaaatagcttcag

1080

tttggtctgatctgccgctacatcttcattttttttgtatttttatgcgattcattgaaa

1140

ctcggccccattttcaaatctacataggccgtactgacattatcgaaatgctatttttta

1200

tctatttgatttttatgattaaagtatattttgtgtataaaaatcattcgggtcggattg

1260

ctgcgaaagaaatgatacactagcacgtcaaagtaagtgcgttatcagtattcaggtagc

1320

tgttgagcctggggcggtagcgtgcttttttctgcttaacttaaccagacaatcacacaa

1380

aagagtcgctagtggaaaagccatttcgaaaaatcctggtcataaagatgcgatatcatg

1440

gggatatgttattaactactcctgtcatcagtacgctcaagcagaattatcctgatgcaa

1500

aaatcgatatgctgctttatcaggacaccatccctattttgtctgaaaacccggaaatta

1560

atgcgctctatgggataagcaataaaggtgcgggaa

1596

<210> 12

<211> 544

<212> DNA

<213> Artificial sequence

<400> 12

cttcccgaaagccgattgtacgcgctccgaaccggttggcgtcatggttgttacggtaat

60

cggtaaatcaggataacgatgacgcagcgcgcgcaccaacgggattgccgccagagtttc

120

accgacggagacggagtgcagcataatgccgcctggttttagcggatggcggtaaaaacc

180

gtaacgttcaccccagcgttttcgataggccggagacttacgtccgcgcacccagagccg

240

tatccagatcagcggctgaataaggtagagaagggcggtgtaaagcaattcgagcatagt

300

aaatagctgacttatggatgtgctggggattctatgtatttagctgtggctttaccatta

360

cttttcccgtttttgacttaaatagcttcagtttggtctgatctgccgctacatcttcat

420

tttttttgtatttttatgcgattcattgaaactcggccccatttcaaatctacataggc

480

cgtactgacattatcgaaatgctattttttatctatttgatttttatgattaaagtatat

540

tttg

544

<210> 13

<211> 2109

<212> DNA

<213>Escherichia coli

<400> 13

atgtatctgtttgaaagcctgaatcaactgattcaaacctacctgccggaagaccaaatc

60

aagcgtctgcggcaggcgtatctcgttgcacgtgatgctcacgaggggcaaacacgttca

120

agcggtgaaccctatatcacgcacccggtagcggttgcctgcattctggccgagatgaaa

180

ctcgactatgaaacgctgatggcggcgctgctgcatgacgtgattgaagatactcccgcc

240

acctaccaggatatggaacagctttttggtaaaagcgtcgccgagctggtagagggggtg

300

tcgaaacttgataaactcaagttccgcgataagaaagaggcgcaggccgaaaactttcgc

360

aagatgattatggcgatggtgcaggatatccgcgtcatcctcatcaaacttgccgaccgt

420

acccacaacatgcgcacgctgggctcacttcgcccggacaaacgtcgccgcatcgcccgt

480

gaaactctcgaaatttatagcccgctggcgcaccgtttaggtatccaccacattaaaacc

540

gaactcgaagagctgggttttgaggcgctgtatcccaaccgttatcgcgtaatcaaagaa

600

gtggtgaaagccgcgcgcggcaaccgtaaagagatgatccagaagattctctttctgaaatc

660

gaagggcgtttgcaggaagcgggaataccgtgccgcgtcagtggtcgcgagaagcatctt

720

tattcgatttactgcaaaatggtgctcaaagagcagcgttttcactcgatcatggacatc

780

tacgctttccgcgtgatcgtcaatgattctctgacacctgttatcgcgtgctgggccagatg

840

cacagcctgtacaagccgcgtccgggccgcgtgaaagactatatcgccattccaaaagcg

900

aacggctatcagtctttgcacacctcgatgatcggcccgcacggtgtgccggttgaggtc

960

cagatccgtaccgaagatatggaccagatggcggagatgggtgttgccgcgcactgggct

1020

tataaagagcacggcgaaaccagtactaccgcacaaatccgcgcccagcgctggatgcaa

1080

agcctgctggagctgcaacagagcgccggtagttcgtttgaatttatcgagagcgttaaa

1140

tccgatctcttcccggatgagatttacgttttcacaccggaagggcgcattgtcgagctg

1200

cctgccggtgcaacgcccgtcgacttcgcttatgcagtgcataccgatatcggtcatgcc

1260

tgcgtgggcgcacgcgttgaccgccagccttacccgctgtcgcagccgcttaccagcggt

1320

caaaccgttgaaatcattaccgctccgggcgctcgcccgaatgccgcttggctgaacttt

1380

gtcgttagctcgaaagcgcgcgccaaaattcgtcagttgctgaaaaacctcaagcgtgat

1440

gattctgtaagcctgggccgtcgtctgctcaaccatgctttgggtggtagccgtaagctg

1500

aatgaaatcccgcaggaaaatattcagcgcgagctggatcgcatgaagctggcaacgctt

1560

gacgatctgctggcagaaatcggacttggtaacgcaatgagcgtggtggtcgcgaaaaat

1620

ctgcaacatggggacgcctccattccaccggcaacccaaagccacggacatctgcccatt

1680

aaaggtgccgatggcgtgctgatcacctttgcgaaatgctgccgccctattcctggcgac

1740

ccgattatcgcccacgtcagccccggtaaaggtctggtgatccaccatgaatcctgccgt

1800

aatatccgtggctaccagaaagagccagagaagtttatggctgtggaatgggataaagag

1860

acggcgcaggagttcatcaccgaaatcaaggtggagatgttcaatcatcagggtgcgctg

1920

gcaaacctgacggcggcaattaacaccacgacttcgaatattcaaagtttgaatacggaa

1980

gagaaagatggtcgcgtctacagcgcctttattcgtctgaccgctcgtgaccgtgtgcat

2040

ctggcgaatatcatgcgcaaaatccgcgtgatgccagacgtgattaaagtcacccgaaac

2100

cgaaattaa

2109

<210> 14

<211> 2109

<212> DNA

<213> Artificial sequence

<400> 14

atgtatctgtttgaaagcctgaatcaactgattcaaacctacctgccggaagaccaaatc

60

aagcgtctgcggcaggcgtatctcgttgcacgtgatgctcacgaggggcaaacacgttca

120

agcggtgaaccctatatcacgcacccggtagcggttgcctgcattctggccgagatgaaa

180

ctcgactatgaaacgctgatggcggcgctgctgcatgacgtgattgaagatactcccgcc

240

acctaccaggatatggaacagctttttggtaaaagcgtcgccgagctggtagagggggtg

300

tcgaaacttgataaactcaagttccgcgataagaaagaggcgcaggccgaaaactttcgc

360

aagatgattatggcgatggtgcaggatatccgcgtcatcctcatcaaacttgccgaccgt

420

acccacaacatgcgcacgctgggctcacttcgcccggacaaacgtcgccgcatcgcccgt

480

gaaactctcgaaatttatagcccgctggcgcaccgtttatgtatccaccacattaaaacc

540

gaactcgaagagctgggttttgaggcgctgtatcccaaccgttatcgcgtaatcaaagaa

600

gtggtgaaagccgcgcgcggcaaccgtaaagagatgatccagaagattctctttctgaaatc

660

gaagggcgtttgcaggaagcgggaataccgtgccgcgtcagtggtcgcgagaagcatctt

720

tattcgatttactgcaaaatggtgctcaaagagcagcgttttcactcgatcatggacatc

780

tacgctttccgcgtgatcgtcaatgattctctgacacctgttatcgcgtgctgggccagatg

840

cacagcctgtacaagccgcgtccgggccgcgtgaaagactatatcgccattccaaaagcg

900

aacggctatcagtctttgcacacctcgatgatcggcccgcacggtgtgccggttgaggtc

960

cagatccgtaccgaagatatggaccagatggcggagatgggtgttgccgcgcactgggct

1020

tataaagagcacggcgaaaccagtactaccgcacaaatccgcgcccagcgctggatgcaa

1080

agcctgctggagctgcaacagagcgccggtagttcgtttgaatttatcgagagcgttaaa

1140

tccgatctcttcccggatgagatttacgttttcacaccggaagggcgcattgtcgagctg

1200

cctgccggtgcaacgcccgtcgacttcgcttatgcagtgcataccgatatcggtcatgcc

1260

tgcgtgggcgcacgcgttgaccgccagccttacccgctgtcgcagccgcttaccagcggt

1320

caaaccgttgaaatcattaccgctccgggcgctcgcccgaatgccgcttggctgaacttt

1380

gtcgttagctcgaaagcgcgcgccaaaattcgtcagttgctgaaaaacctcaagcgtgat

1440

gattctgtaagcctgggccgtcgtctgctcaaccatgctttgggtggtagccgtaagctg

1500

aatgaaatcccgcaggaaaatattcagcgcgagctggatcgcatgaagctggcaacgctt

1560

gacgatctgctggcagaaatcggacttggtaacgcaatgagcgtggtggtcgcgaaaaat

1620

ctgcaacatggggacgcctccattccaccggcaacccaaagccacggacatctgcccatt

1680

aaaggtgccgatggcgtgctgatcacctttgcgaaatgctgccgccctattcctggcgac

1740

ccgattatcgcccacgtcagccccggtaaaggtctggtgatccaccatgaatcctgccgt

1800

aatatccgtggctaccagaaagagccagagaagtttatggctgtggaatgggataaagag

1860

acggcgcaggagttcatcaccgaaatcaaggtggagatgttcaatcatcagggtgcgctg

1920

gcaaacctgacggcggcaattaacaccacgacttcgaatattcaaagtttgaatacggaa

1980

gagaaagatggtcgcgtctacagcgcctttattcgtctgaccgctcgtgaccgtgtgcat

2040

ctggcgaatatcatgcgcaaaatccgcgtgatgccagacgtgattaaagtcacccgaaac

2100

cgaaattaa

2109

<210> 15

<211> 702

<212> PROTEIN

<213> Escherichia coli

<400> 15

Met Tyr Leu Phe Glu Ser Leu Asn Gln Leu Ile Gln Thr Tyr Leu Pro

1 5 10 15

Glu Asp Gln Ile Lys Arg Leu Arg Gln Ala Tyr Leu Val Ala Arg Asp

20 25 30

Ala His Glu Gly Gln Thr Arg Ser Ser Gly Glu Pro Tyr Ile Thr His

35 40 45

Pro Val Ala Val Ala Cys Ile Leu Ala Glu Met Lys Leu Asp Tyr Glu

50 55 60

Thr Leu Met Ala Ala Leu Leu His Asp Val Ile Glu Asp Thr Pro Ala

65 70 75 80

Thr Tyr Gln Asp Met Glu Gln Leu Phe Gly Lys Ser Val Ala Glu Leu

85 90 95

Val Glu Gly Val Ser Lys Leu Asp Lys Leu Lys Phe Arg Asp Lys Lys

100 105 110

Glu Ala Gln Ala Glu Asn Phe Arg Lys Met Ile Met Ala Met Val Gln

115 120 125

Asp Ile Arg Val Ile Leu Ile Lys Leu Ala Asp Arg Thr His Asn Met

130 135 140

Arg Thr Leu Gly Ser Leu Arg Pro Asp Lys Arg Arg Arg Ile Ala Arg

145 150 155 160

Glu Thr Leu Glu Ile Tyr Ser Pro Leu Ala His Arg Leu Gly Ile His

165 170 175

His Ile Lys Thr Glu Leu Glu Glu Leu Gly Phe Glu Ala Leu Tyr Pro

180 185 190

Asn Arg Tyr Arg Val Ile Lys Glu Val Val Lys Ala Ala Arg Gly Asn

195 200 205

Arg Lys Glu Met Ile Gln Lys Ile Leu Ser Glu Ile Glu Gly Arg Leu

210 215 220

Gln Glu Ala Gly Ile Pro Cys Arg Val Ser Gly Arg Glu Lys His Leu

225 230 235 240

Tyr Ser Ile Tyr Cys Lys Met Val Leu Lys Glu Gln Arg Phe His Ser

245 250 255

Ile Met Asp Ile Tyr Ala Phe Arg Val Ile Val Asn Asp Ser Asp Thr

260 265 270

Cys Tyr Arg Val Leu Gly Gln Met His Ser Leu Tyr Lys Pro Arg Pro

275 280 285

Gly Arg Val Lys Asp Tyr Ile Ala Ile Pro Lys Ala Asn Gly Tyr Gln

290 295 300

Ser Leu His Thr Ser Met Ile Gly Pro His Gly Val Pro Val Glu Val

305 310 315 320

Gln Ile Arg Thr Glu Asp Met Asp Gln Met Ala Glu Met Gly Val Ala

325 330 335

Ala His Trp Ala Tyr Lys Glu His Gly Glu Thr Ser Thr Thr Ala Gln

340 345 350

Ile Arg Ala Gln Arg Trp Met Gln Ser Leu Leu Glu Leu Gln Gln Ser

355 360 365

Ala Gly Ser Ser Phe Glu Phe Ile Glu Ser Val Lys Ser Asp Leu Phe

370 375 380

Pro Asp Glu Ile Tyr Val Phe Thr Pro Glu Gly Arg Ile Val Glu Leu

385 390 395 400

Pro Ala Gly Ala Thr Pro Val Asp Phe Ala Tyr Ala Val His Thr Asp

405 410 415

Ile Gly His Ala Cys Val Gly Ala Arg Val Asp Arg Gln Pro Tyr Pro

420 425 430

Leu Ser Gln Pro Leu Thr Ser Gly Gln Thr Val Glu Ile Ile Thr Ala

435 440 445

Pro Gly Ala Arg Pro Asn Ala Ala Trp Leu Asn Phe Val Val Ser Ser

450 455 460

Lys Ala Arg Ala Lys Ile Arg Gln Leu Leu Lys Asn Leu Lys Arg Asp

465 470 475 480

Asp Ser Val Ser Leu Gly Arg Arg Leu Leu Asn His Ala Leu Gly Gly

485 490 495

Ser Arg Lys Leu Asn Glu Ile Pro Gln Glu Asn Ile Gln Arg Glu Leu

500 505 510

Asp Arg Met Lys Leu Ala Thr Leu Asp Asp Leu Leu Ala Glu Ile Gly

515 520 525

Leu Gly Asn Ala Met Ser Val Val Val Ala Lys Asn Leu Gln His Gly

530 535 540

Asp Ala Ser Ile Pro Pro Ala Thr Gln Ser His Gly His Leu Pro Ile

545 550 555 560

Lys Gly Ala Asp Gly Val Leu Ile Thr Phe Ala Lys Cys Cys Arg Pro

565 570 575

Ile Pro Gly Asp Pro Ile Ile Ala His Val Ser Pro Gly Lys Gly Leu

580 585 590

Val Ile His His Glu Ser Cys Arg Asn Ile Arg Gly Tyr Gln Lys Glu

595 600 605

Pro Glu Lys Phe Met Ala Val Glu Trp Asp Lys Glu Thr Ala Gln Glu

610 615 620

Phe Ile Thr Glu Ile Lys Val Glu Met Phe Asn His Gln Gly Ala Leu

625 630 635 640

Ala Asn Leu Thr Ala Ala Ile Asn Thr Thr Thr Ser Asn Ile Gln Ser

645 650 655

Leu Asn Thr Glu Glu Lys Asp Gly Arg Val Tyr Ser Ala Phe Ile Arg

660 665 670

Leu Thr Ala Arg Asp Arg Val His Leu Ala Asn Ile Met Arg Lys Ile

675 680 685

Arg Val Met Pro Asp Val Ile Lys Val Thr Arg Asn Arg Asn

690 695 700

<210> 16

<211> 702

<212> PROTEIN

<213> Escherichia coli

<400> 16

Met Tyr Leu Phe Glu Ser Leu Asn Gln Leu Ile Gln Thr Tyr Leu Pro

1 5 10 15

Glu Asp Gln Ile Lys Arg Leu Arg Gln Ala Tyr Leu Val Ala Arg Asp

20 25 30

Ala His Glu Gly Gln Thr Arg Ser Ser Gly Glu Pro Tyr Ile Thr His

35 40 45

Pro Val Ala Val Ala Cys Ile Leu Ala Glu Met Lys Leu Asp Tyr Glu

50 55 60

Thr Leu Met Ala Ala Leu Leu His Asp Val Ile Glu Asp Thr Pro Ala

65 70 75 80

Thr Tyr Gln Asp Met Glu Gln Leu Phe Gly Lys Ser Val Ala Glu Leu

85 90 95

Val Glu Gly Val Ser Lys Leu Asp Lys Leu Lys Phe Arg Asp Lys Lys

100 105 110

Glu Ala Gln Ala Glu Asn Phe Arg Lys Met Ile Met Ala Met Val Gln

115 120 125

Asp Ile Arg Val Ile Leu Ile Lys Leu Ala Asp Arg Thr His Asn Met

130 135 140

Arg Thr Leu Gly Ser Leu Arg Pro Asp Lys Arg Arg Arg Ile Ala Arg

145 150 155 160

Glu Thr Leu Glu Ile Tyr Ser Pro Leu Ala His Arg Leu Cys Ile His

165 170 175

His Ile Lys Thr Glu Leu Glu Glu Leu Gly Phe Glu Ala Leu Tyr Pro

180 185 190

Asn Arg Tyr Arg Val Ile Lys Glu Val Val Lys Ala Ala Arg Gly Asn

195 200 205

Arg Lys Glu Met Ile Gln Lys Ile Leu Ser Glu Ile Glu Gly Arg Leu

210 215 220

Gln Glu Ala Gly Ile Pro Cys Arg Val Ser Gly Arg Glu Lys His Leu

225 230 235 240

Tyr Ser Ile Tyr Cys Lys Met Val Leu Lys Glu Gln Arg Phe His Ser

245 250 255

Ile Met Asp Ile Tyr Ala Phe Arg Val Ile Val Asn Asp Ser Asp Thr

260 265 270

Cys Tyr Arg Val Leu Gly Gln Met His Ser Leu Tyr Lys Pro Arg Pro

275 280 285

Gly Arg Val Lys Asp Tyr Ile Ala Ile Pro Lys Ala Asn Gly Tyr Gln

290 295 300

Ser Leu His Thr Ser Met Ile Gly Pro His Gly Val Pro Val Glu Val

305 310 315 320

Gln Ile Arg Thr Glu Asp Met Asp Gln Met Ala Glu Met Gly Val Ala

325 330 335

Ala His Trp Ala Tyr Lys Glu His Gly Glu Thr Ser Thr Thr Ala Gln

340 345 350

Ile Arg Ala Gln Arg Trp Met Gln Ser Leu Leu Glu Leu Gln Gln Ser

355 360 365

Ala Gly Ser Ser Phe Glu Phe Ile Glu Ser Val Lys Ser Asp Leu Phe

370 375 380

Pro Asp Glu Ile Tyr Val Phe Thr Pro Glu Gly Arg Ile Val Glu Leu

385 390 395 400

Pro Ala Gly Ala Thr Pro Val Asp Phe Ala Tyr Ala Val His Thr Asp

405 410 415

Ile Gly His Ala Cys Val Gly Ala Arg Val Asp Arg Gln Pro Tyr Pro

420 425 430

Leu Ser Gln Pro Leu Thr Ser Gly Gln Thr Val Glu Ile Ile Thr Ala

435 440 445

Pro Gly Ala Arg Pro Asn Ala Ala Trp Leu Asn Phe Val Val Ser Ser

450 455 460

Lys Ala Arg Ala Lys Ile Arg Gln Leu Leu Lys Asn Leu Lys Arg Asp

465 470 475 480

Asp Ser Val Ser Leu Gly Arg Arg Leu Leu Asn His Ala Leu Gly Gly

485 490 495

Ser Arg Lys Leu Asn Glu Ile Pro Gln Glu Asn Ile Gln Arg Glu Leu

500 505 510

Asp Arg Met Lys Leu Ala Thr Leu Asp Asp Leu Leu Ala Glu Ile Gly

515 520 525

Leu Gly Asn Ala Met Ser Val Val Val Ala Lys Asn Leu Gln His Gly

530 535 540

Asp Ala Ser Ile Pro Pro Ala Thr Gln Ser His Gly His Leu Pro Ile

545 550 555 560

Lys Gly Ala Asp Gly Val Leu Ile Thr Phe Ala Lys Cys Cys Arg Pro

565 570 575

Ile Pro Gly Asp Pro Ile Ile Ala His Val Ser Pro Gly Lys Gly Leu

580 585 590

Val Ile His His Glu Ser Cys Arg Asn Ile Arg Gly Tyr Gln Lys Glu

595 600 605

Pro Glu Lys Phe Met Ala Val Glu Trp Asp Lys Glu Thr Ala Gln Glu

610 615 620

Phe Ile Thr Glu Ile Lys Val Glu Met Phe Asn His Gln Gly Ala Leu

625 630 635 640

Ala Asn Leu Thr Ala Ala Ile Asn Thr Thr Thr Ser Asn Ile Gln Ser

645 650 655

Leu Asn Thr Glu Glu Lys Asp Gly Arg Val Tyr Ser Ala Phe Ile Arg

660 665 670

Leu Thr Ala Arg Asp Arg Val His Leu Ala Asn Ile Met Arg Lys Ile

675 680 685

Arg Val Met Pro Asp Val Ile Lys Val Thr Arg Asn Arg Asn

690 695 700

<210> 17

<211> 28

<212> DNA

<213> Artificial sequence

<400> 17

cgggatccgaacagcaagagcaggaagc

28

<210> 18

<211> 19

<212> DNA

<213> Artificial sequence

<400> 18

tgtggtggatacataaacg

19

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

gcaccgtttatgtatccacc

20

<210> 20

<211> 38

<212> DNA

<213> Artificial sequence

<400> 20

aaggaaaaaagcggccgcacgacaaagttcagccaagc

38

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

ctttcgcaagatgattatgg

20

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<400> 22

caggtattcccgcttcctg

20

<210> 23

<211> 567

<212> DNA

<213>Escherichiacoli

<400> 23

atgaatatcactgctactgttcttcttgcgtttggtatgtcgatggatgcatttgctgca

60

tcaatcggtaaaggtgccaccctccataaaccgaaattttctgaagcattgcgaaccggc

120

cttatttttggtgccgtcgaaaccctgacgccgctgatcggctggggaatgggcatgtta

180

gccagccggtttgtccttgaatggaaccactggattgcgtttgtgctgctgatattcctc

240

ggcgggcgaatgattattgagggttttcgtggcgcagatgatgaagatgaagagccgcgc

300

cgtcgacacggtttctggctactggtaaccaccgcgattgccaccagcctggatgccatg

360

gctgtgggtgttggtcttgctttcctgcaggtcaacattatcgcgaccgcattggccatt

420

ggttgtgcaaccttgattatgtcaacattagggatgatggttggtcgctttatcggctca

480

attattgggaaaaaagcggaaattctcggcgggctggtgctgatcggcatcggcgtccag

540

atcctctggacgcacttccacggttaa

567

<210> 24

<211> 567

<212> DNA

<213> Artificial sequence

<400> 24

atgaatatcactgctactgttcttcttgcgtttggtatgtcgatggatgcatttgctgca

60

tcaatcggtaaagatgccaccctccataaaccgaaattttctgaagcattgcgaaccggc

120

cttatttttggtgccgtcgaaaccctgacgccgctgatcggctggggaatgggcatgtta

180

gccagccggtttgtccttgaatggaaccactggattgcgtttgtgctgctgatattcctc

240

ggcgggcgaatgattattgagggttttcgtggcgcagatgatgaagatgaagagccgcgc

300

cgtcgacacggtttctggctactggtaaccaccgcgattgccaccagcctggatgccatg

360

gctgtgggtgttggtcttgctttcctgcaggtcaacattatcgcgaccgcattggccatt

420

ggttgtgcaaccttgattatgtcaacattagggatgatggttggtcgctttatcggctca

480

attattgggaaaaaagcggaaattctcggcgggctggtgctgatcggcatcggcgtccag

540

atcctctgga cgcacttcca cggttaa

567

<210> 25

<211> 188

<212> PROTEIN

<213> Escherichia coli

<400> 25

Met Asn Ile Thr Ala Thr Val Leu Leu Ala Phe Gly Met Ser Met Asp

1 5 10 15

Ala Phe Ala Ala Ser Ile Gly Lys Gly Ala Thr Leu His Lys Pro Lys

20 25 30

Phe Ser Glu Ala Leu Arg Thr Gly Leu Ile Phe Gly Ala Val Glu Thr

35 40 45

Leu Thr Pro Leu Ile Gly Trp Gly Met Gly Met Leu Ala Ser Arg Phe

50 55 60

Val Leu Glu Trp Asn His Trp Ile Ala Phe Val Leu Leu Ile Phe Leu

65 70 75 80

Gly Gly Arg Met Ile Ile Glu Gly Phe Arg Gly Ala Asp Asp Glu Asp

85 90 95

Glu Glu Pro Arg Arg Arg His Gly Phe Trp Leu Leu Val Thr Thr Ala

100 105 110

Ile Ala Thr Ser Leu Asp Ala Met Ala Val Gly Val Gly Leu Ala Phe

115 120 125

Leu Gln Val Asn Ile Ile Ala Thr Ala Leu Ala Ile Gly Cys Ala Thr

130 135 140

Leu Ile Met Ser Thr Leu Gly Met Met Val Gly Arg Phe Ile Gly Ser

145 150 155 160

Ile Ile Gly Lys Lys Ala Glu Ile Leu Gly Gly Leu Val Leu Ile Gly

165 170 175

Ile Gly Val Gln Ile Leu Trp Thr His Phe His Gly

180 185

<210> 26

<211> 188

<212> PROTEIN

<213> Artificial sequence

<400> 26

Met Asn Ile Thr Ala Thr Val Leu Leu Ala Phe Gly Met Ser Met Asp

1 5 10 15

Ala Phe Ala Ala Ser Ile Gly Lys Asp Ala Thr Leu His Lys Pro Lys

20 25 30

Phe Ser Glu Ala Leu Arg Thr Gly Leu Ile Phe Gly Ala Val Glu Thr

35 40 45

Leu Thr Pro Leu Ile Gly Trp Gly Met Gly Met Leu Ala Ser Arg Phe

50 55 60

Val Leu Glu Trp Asn His Trp Ile Ala Phe Val Leu Leu Ile Phe Leu

65 70 75 80

Gly Gly Arg Met Ile Ile Glu Gly Phe Arg Gly Ala Asp Asp Glu Asp

85 90 95

Glu Glu Pro Arg Arg Arg His Gly Phe Trp Leu Leu Val Thr Thr Ala

100 105 110

Ile Ala Thr Ser Leu Asp Ala Met Ala Val Gly Val Gly Leu Ala Phe

115 120 125

Leu Gln Val Asn Ile Ile Ala Thr Ala Leu Ala Ile Gly Cys Ala Thr

130 135 140

Leu Ile Met Ser Thr Leu Gly Met Met Val Gly Arg Phe Ile Gly Ser

145 150 155 160

Ile Ile Gly Lys Lys Ala Glu Ile Leu Gly Gly Leu Val Leu Ile Gly

165 170 175

Ile Gly Val Gln Ile Leu Trp Thr His Phe His Gly

180 185

<210> 27

<211> 28

<212> DNA

<213> Artificial sequence

<400> 27

cgggatccct tcgccaatgt ctggattg

28

<210> 28

<211> 20

<212> DNA

<213> Artificial sequence

<400> 28

atggagggtg gcatctttac

20

<210> 29

<211> 20

<212> DNA

<213> Artificial sequence

<400> 29

tgcatcaatc ggtaaagatg

20

<210> 30

<211> 38

<212> DNA

<213> Artificial sequence

<400> 30

aaggaaaaaa gcggccgcca actccgcact ctgctgta

38

<210> 31

<211> 19

<212> DNA

<213> Artificial sequence

<400> 31

ccaccacggcttgttgttc

19

<210> 32

<211> 19

<212> DNA

<213> Artificial sequence

<400> 32

acgaaaaccctcaataatc

19

<---

Claims (13)

1. A nucleotide for the enzymatic production of L-threonine, containing a nucleotide sequence formed as a result of a mutation consisting of the replacement of guanine (G) with adenine (A) at the 82nd base of the coding sequence of the wild-type kdtA gene presented in SEQ ID NO: 1. 2. The nucleotide according to claim 1, where the mutant nucleotide sequence is presented in SEQ ID NO: 2. 3. A recombinant protein for the enzymatic production of L-threonine, encoded by the nucleotide according to claim 1, where the specified amino acid sequence of the recombinant protein is presented in SEQ ID NO: 4. 4. Recombinant vector for the enzymatic production of L-threonine, containing the nucleotide according to claim 1. 5. Recombinant vector according to claim 4, where the recombinant vector is formed by introducing a nucleotide sequence into a plasmid. 6. Recombinant bacteria for the enzymatic production of L-threonine, containing the nucleotide according to claim 1. 7. Recombinant bacterium according to claim 6, where the recombinant bacterium is constructed by introducing the recombinant vector according to claim 4 into the host strain; said host strain is selected from E. Coli K12, its derivative strain E. coli K12 (W3110) or E. coli strain CGMCC 7.232. 8. A method for constructing a recombinant bacterium according to claim 6, including the following steps: (1) modifying the nucleotide sequence of the wild type gene shown in SEQ ID NO: 1 to obtain the mutant nucleotide sequence shown in SEQ ID NO: 2; (2) ligating the mutant nucleotide sequence to the plasmid to construct a recombinant vector; And (3) introducing a recombinant vector into a host strain to produce a recombinant bacterium. 9. A method for constructing a recombinant bacterium according to claim 8, characterized in that said plasmid is a pKOV plasmid. 10. Use of a nucleotide according to claim 1, a recombinant protein according to claim 3, a recombinant vector according to claim 4 or a recombinant bacterium according to claim 6 for the enzymatic production of L-threonine.