CN111471693B - Corynebacterium glutamicum for producing lysine and construction method and application thereof - Google Patents
Corynebacterium glutamicum for producing lysine and construction method and application thereof Download PDFInfo
- Publication number
- CN111471693B CN111471693B CN201911185618.9A CN201911185618A CN111471693B CN 111471693 B CN111471693 B CN 111471693B CN 201911185618 A CN201911185618 A CN 201911185618A CN 111471693 B CN111471693 B CN 111471693B
- Authority
- CN
- China
- Prior art keywords
- corynebacterium glutamicum
- leu
- seq
- gln
- arg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a corynebacterium glutamicum for producing lysine, a construction method and application thereof. The Corynebacterium glutamicum strain of the present invention is produced by point mutation at a site in the genome of endogenous NCgl0267 of Corynebacterium glutamicum, for example, thymine (T) at position 539 of NCgl0267 is changed to cytosine (C). The corynebacterium glutamicum strain can effectively improve the yield of L-lysine.
Description
Technical Field
The invention belongs to the field of genetic engineering, and relates to corynebacterium glutamicum for producing lysine, and a construction method and application thereof.
Background
L-lysine is one of the important components of protein, is an essential amino acid which can not be synthesized by human bodies, and has very important functions in the fields of pharmacy, animal feed and the like.
At present, lysine is produced industrially mainly by fermentation. The strains for producing lysine by industrial fermentation are mainly variant strains of corynebacterium, brevibacterium and the like, wherein the corynebacterium glutamicum is the most widely used lysine-producing strain in industrial production. Corynebacterium glutamicum is a gram-positive microorganism which grows rapidly, is nonpathogenic, has a weak ability to degrade its own metabolites, and is therefore widely used for the production of L-amino acids, nucleotides and other organic acids. There are many patents and literatures disclosing methods for producing L-lysine by microbial fermentation, and for example, CN1197957C discloses a Corynebacterium glutamicum having both monofluoroacetic acid resistance and alpha-thiazole-DL-alanine resistance. However, the existing corynebacterium glutamicum producing L-lysine still has poor fermentation performance and low acid production rate, and cannot meet the requirement of large-scale industrial production.
Disclosure of Invention
The invention provides the following technical scheme:
in a first aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence which is mutated at the sequence position of SEQ ID No.1 or a sequence complementary thereto. In one embodiment, the nucleic acid molecule comprises a substitution at position 539 in SEQ ID NO 1, for example the substitution is T539C. Specifically, the nucleic acid molecule comprises a nucleotide sequence shown in SEQ ID NO. 2 or a complementary sequence thereof.
In one embodiment, the nucleic acid molecule encodes a protein or a partial protein fragment comprising an amino acid sequence which has a substitution at position 180 of SEQ ID NO:3, e.g., the substitution is V180A, as compared to the amino acid sequence of SEQ ID NO: 3.
In a second aspect of the invention, there is provided a protein or partial protein fragment comprising an amino acid sequence having a mutation at a position shown in SEQ ID NO. 3. In one embodiment, the amino acid sequence includes a substitution at position 180 of SEQ ID NO. 3, for example the substitution is V180A. In particular, the amino acid sequence of the protein or part of the protein fragment comprises the amino acid sequence shown in SEQ ID NO. 4, or the protein or part of the protein fragment is encoded by the nucleic acid molecule of the first aspect of the invention.
In a third aspect of the invention, there is provided a recombinant vector, for example a recombinant expression vector, comprising a nucleic acid molecule according to the first aspect of the invention, and also a host cell into which the recombinant vector has been introduced.
In a fourth aspect of the invention, there is provided a recombinant Corynebacterium glutamicum strain comprising a nucleic acid molecule of the first aspect of the invention or an amino acid sequence of the second aspect of the invention. In one embodiment, the genome of Corynebacterium glutamicum has been altered by introduction of a nucleic acid molecule of the invention; in another embodiment, the endogenous NCgl0267 Gene (Gene ID: 1021336) in the genome of Corynebacterium glutamicum is altered, e.g., by introducing a point mutation by homologous recombination, PCR recombination, etc., to achieve introduction of a point mutation at a specific site in the endogenous NCgl0267 genome of Corynebacterium glutamicum. In one embodiment, the recombinant Corynebacterium glutamicum is used for the production of L-lysine, for example by cultivation in a suitable medium, producing L-lysine.
In a fifth aspect of the present invention, there is provided a method for constructing a recombinant Corynebacterium glutamicum comprising modifying the endogenous NCgl0267 gene in the genome of Corynebacterium glutamicum, for example, by introducing a point mutation at a specific site in the endogenous NCgl0267 genome of Corynebacterium glutamicum by homologous recombination, PCR point mutation, or the like.
In one embodiment, the method of construction comprises: an amplification primer of the coding region sequence of the NCgl0267 gene is designed according to the known genome sequence of Corynebacterium glutamicum, and a point mutation is introduced into the specific site of the coding region of the NCgl0267 gene of the host strain by means of allelic replacement.
In one embodiment, the amplification primer is P1:5'CGGGATCCGTCGCAGGCATGATGCCACT 3'(BamH I)(SEQ ID NO:5)
P2:5'GAATCACGACTTCGGGCCAGACTTCATTCAC 3'(SEQ ID NO:6)
P3:5'GTGAATGAAGTCTGGCCCGAAGTCGTGATTC 3'(SEQ ID NO:7)
P4:5'CCCAAGCTTCTCGCTGTGTGGCCGTTAGAAGC 3'(HindⅢ)(SEQ ID NO:8)
In one embodiment, the method of construction comprises: the genome of Corynebacterium glutamicum is taken as a template, primers P1 and P2, P3 and P4 are respectively used for carrying out PCR amplification on a DNA fragment containing the NCgl0267 gene coding region, and then the two DNA fragments are taken as templates, and P1 and P4 are taken as primers for carrying out overlap PCR (overlap PCR) amplification to obtain a DNA fragment containing mutation sites.
In one embodiment, the construction method further comprises linking the DNA fragment containing the mutation site with a plasmid vector to obtain a recombinant vector, and transforming the recombinant vector into a corynebacterium glutamicum host strain to obtain a recombinant corynebacterium glutamicum. The recombinant C.glutamicum corresponding to position 539 of SEQ ID NO.1 had a thymine (T) to a cytosine (C), which finally resulted in the change of valine (V) to alanine (A) at amino acid 180 of the encoded protein SEQ ID NO. 3.
In the present invention, the Corynebacterium glutamicum host strain is any strain of Corynebacterium glutamicum known in the art to have lysine-producing ability, preferably containing the coding region of the NCgl0267 gene, e.g., ATCC13032, YP 97158.
In the present invention, the plasmid vector is an expression vector known in the art, such as pK18mobsacB plasmid.
In a sixth aspect of the present invention, there is provided a process for producing L-lysine using the recombinant Corynebacterium glutamicum as described above. In one embodiment, the recombinant Corynebacterium glutamicum is fermented with a fermentation medium, and L-lysine is isolated from the fermentation broth.
The invention has the advantages of
The invention introduces point mutation into the genome of the corynebacterium glutamicum strain producing lysine, greatly improves the L-lysine producing capability of the corynebacterium glutamicum by changing the specific site of the NCgl0267 gene coding region, still keeps good growth capability and biological characteristics of the strain, has simple strain construction method, low cost and high strain quality, and is suitable for industrial large-scale production.
Detailed Description
The present invention is further illustrated in the following examples, which are not intended to limit the scope of the invention. The details of the partial gene cloning method vary depending on the reagents, enzymes or kits provided by the supplier, and should be conducted according to the product instructions, and will not be described in detail in the examples.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 construction of transformation vector pK18-NCgl0267 containing the coding region of the NCgl0267 Gene with a point mutationT539C
According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the coding region sequence of NCgl0267 gene are designed and synthesized, and point mutation is introduced in the coding region (SEQ ID NO:1) of NCgl0267 gene in the background of strain YP97158 (preservation No: CGMCC No.12856, preservation date: 2016 (8/16 th) and preservation unit: institute of microbiology of Chinese academy of sciences, No. 3 of Xilu 1 on the morning of Beijing) by means of allelic gene replacement, the amino acid sequence of the corresponding encoded protein is sequence 3, and the nucleotide sequence 539 th position T of NCgl0267 gene is changed into C (SEQ ID NO: 2: NCgl 0267)T539C) The amino acid sequence corresponding to the encoded protein (SEQ ID NO:3) has a valine to alanine at position 180 (SEQ ID NO: 4: NCgl0267V180A). The primers were designed as follows (synthesized by Shanghai Invitrogen corporation):
P1:5'CGGGATCCGTCGCAGGCATGATGCCACT 3'(BamH I)(SEQ ID NO:5)
P2:5'GAATCACGACTTCGGGCCAGACTTCATTCAC 3'(SEQ ID NO:6)
P3:5'GTGAATGAAGTCTGGCCCGAAGTCGTGATTC 3'(SEQ ID NO:7)
P4:5'CCCAAGCTTCTCGCTGTGTGGCCGTTAGAAGC 3'(HindⅢ)(SEQ ID NO:8)
the construction method comprises the following steps: using Corynebacterium glutamicum ATCC13032 as a template, and primers P1 and P2, and P3 and P4 respectively, and performing PCR amplification, wherein the PCR system comprises the following components: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg2+4 μ L (25mM), 2 μ L each of primers (10pM), 0.25 μ L of Ex Taq (5U/. mu.L) in total volume of 50 μ L, and the PCR amplification was performed as follows: 94 deg.CPre-denaturation for 5min, (denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 40s, 30 cycles), and over-extension at 72 ℃ for 10min to obtain two DNA fragments (NCgl0267 Up and NCgl0267 Down) with sizes of 670bp and 692bp, respectively, and containing the coding region of NCgl0267 gene. Separating and purifying the two DNA fragments by agarose gel electrophoresis, and amplifying a DNA fragment NCgl0267 with the length of about 1331bp by using the two DNA fragments as templates and P1 and P4 as primers through Overlap PCRT539C. And (3) PCR system: 10 XEx Taq Buffer 5. mu.L, dNTP mix (2.5 mM each) 4. mu.L, Mg2+4 μ L (25mM), 2 μ L each of primers (10pM), 0.25 μ L of Ex Taq (5U/. mu.L) in total volume of 50 μ L, and the PCR amplification was performed as follows: pre-denaturation at 94 ℃ for 5min, (denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 90s, 30 cycles), and over-extension at 72 ℃ for 10 min. This NCgl0267T539CThe DNA fragment of (a) results in the conversion of thymine (T) at position 539 of the coding region of the YP97158 NCgl0267 gene to cytosine (C), and finally in the conversion of valine (V) to alanine (A) at position 180 of the encoded protein. Separating purified NCgl0267 by agarose gel electrophoresisT539CAnd pK18mobsacB plasmid (purchased from Addgene) were separately digested with BamH I/HindIII, separated and purified by agarose gel electrophoresis, and ligated to obtain vector pK18-NCgl0267T539CThe plasmid contains a kanamycin resistance marker. And the vector pK18-NCgl0267T539CSending to a sequencing company for sequencing and identifying, and adding a vector pK18-NCgl0267 containing a correct point mutation (T-C)T539CAnd (5) storing for later use.
Example 2 construction of NCgl0267 comprising Point mutationT539COf (4) an engineered strain
The construction method comprises the following steps: the allele substitution plasmid pK18-NCgl0267T539CTransformed into an L-lysine-producing bacterial patent strain YP97158 by electric shock (the construction method can be seen in WO2014121669A 1; the wild type NCgl0267 gene coding region is reserved on the chromosome of the strain is confirmed by sequencing), and the single colony generated by culture is respectively identified by a primer P1 and a universal primer M13F, and the strain with 1400bp band is amplified to be a positive strain. Culturing the positive strain in a culture medium containing 15% sucrose, and culturing the single colony generated by the culture in a culture medium containing kanamycin and a culture medium not containing kanamycin respectivelyThe strains cultured on the medium, which grew on a kanamycin-free medium but did not grow on a kanamycin-containing medium, were further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Co.):
P5:5'TCAGAGGTGTAGTGCCATCC 3'(SEQ ID NO:9)
P6:5'CTTTGAAGACCAAGTAGCTC 3'(SEQ ID NO:10)
the amplification product obtained by amplifying the positive strain by the primers P5 and P6 is subjected to sscp electrophoresis (by the plasmid pK18-NCgl 0267) after high-temperature denaturation and ice bathT539CThe amplified fragment is a positive control, the YP97158 amplified fragment is a negative control, and water is used as a blank control), and the electrophoretic positions of the fragments are different due to different fragment structures, so that the strains of which the electrophoretic positions are inconsistent with the positions of the negative control fragments and the positive control fragments are strains of which allelic replacement is successful. The target fragment of the positive strain was amplified again by PCR and ligated to PMD19-T vector for sequencing, and the allelic replacement success of the strain was verified by sequence alignment of the mutated base sequence and was named YPL-4-016.
EXAMPLE 3L-lysine fermentation experiment
The strain YPL-4-016 and the original strain YP97158 constructed in example 2 were subjected to fermentation experiments in a BLBIO-5GC-4-H model fermenter (purchased from Bailan Biotech Co., Ltd., Shanghai) with the media shown in Table 1 and the control process shown in Table 2. Each strain was replicated three times, and the results are shown in Table 3.
TABLE 1 fermentation Medium formulation
| Composition (I) | Formulation of |
| Starch hydrolysis sugar | 30g/L |
| Sulfuric acidAmmonium salt | 12g/L |
| Magnesium sulfate | 0.87g/L |
| Molasses for health protection | 20g/L |
| Acidified corn steep liquor | 3mL/L |
| Phosphoric acid | 0.4mL/L |
| Potassium chloride | 0.53g/L |
| Defoaming agent (2% foam) | 4mL/L |
| Ferrous sulfate | 120mg/L |
| Manganese sulfate | 120mg/L |
| Nicotinamide | 42mg/L |
| Calcium pantothenate | 6.3mg/L |
| Vitamin B1 | 6.3mg/L |
| Solution of copper or zinc salt | 0.6g/L |
| Biotin | 0.88mg/L |
TABLE 2 fermentation control Process
TABLE 3 results of L-lysine fermentation experiments
As a result, the coding region of NCgl0267 gene was point-mutated in Corynebacterium glutamicum to NCgl0267 as shown in Table 3T539CAnd contributes to the improvement of the yield of the L-lysine.
The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Nemeng Guyi products Biotechnology Ltd
<120> Corynebacterium glutamicum producing lysine and construction method and application thereof
<130> CPCN19111424
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 867
<212> DNA
<213> Corynebacterium glutamicum
<400> 1
atggaaccga aaaaacctgt cacatataaa gaacttgccc acgaatattc aagaagaacg 60
tttaacaaac tcttcaccaa aattactggc ttcgtctatc taaaaaacga tctaatcaac 120
gatcccaact tagtgaccca agcactgctc aaaagatgcc cagaaggagt acttcgcgga 180
tatgcagcat taaagcaacg tggctatcag cttttagacg atcagtggat gccaatcatc 240
agtgtttccg gagatctaaa caggagggac tgctcacgag gtgaaattct caggcggatt 300
gaaccagaaa acaccctgct cagtggcaac attaggttcg ttaatgatgt tcaagcgatc 360
caagacgtct tcgacctgca ttctctcaac gactttgaag accaagtagc tctcatcgat 420
catctcatca ggcagcgccc cgaattattc caagaactca tacaagagcc aaaacttaag 480
aaacacactc aatacgccaa tccttttgct gaatctccgc aagaatcacg acttcgggtc 540
agacttcatt cactgggtta ccacggcttc atcccacaga ttcatgttga atacgacggt 600
caatcctatt ttctagatct cgcagatccg ctgtggcagg ttgccctcga atacaacggc 660
ggatggcact acacctctga gcagcgagag aaagattctc atcggaagaa tgctctgaaa 720
agtgcgggat gggatgtcct agaagtgaca tcaaaaactc tgcagaatcc gaattcctgg 780
aacaacctga tacaacagat caatagctct ctccgccgaa agcaggctca gcgacgccga 840
aggttaccca tgcaaacggt gggctaa 867
<210> 2
<211> 867
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggaaccga aaaaacctgt cacatataaa gaacttgccc acgaatattc aagaagaacg 60
tttaacaaac tcttcaccaa aattactggc ttcgtctatc taaaaaacga tctaatcaac 120
gatcccaact tagtgaccca agcactgctc aaaagatgcc cagaaggagt acttcgcgga 180
tatgcagcat taaagcaacg tggctatcag cttttagacg atcagtggat gccaatcatc 240
agtgtttccg gagatctaaa caggagggac tgctcacgag gtgaaattct caggcggatt 300
gaaccagaaa acaccctgct cagtggcaac attaggttcg ttaatgatgt tcaagcgatc 360
caagacgtct tcgacctgca ttctctcaac gactttgaag accaagtagc tctcatcgat 420
catctcatca ggcagcgccc cgaattattc caagaactca tacaagagcc aaaacttaag 480
aaacacactc aatacgccaa tccttttgct gaatctccgc aagaatcacg acttcgggcc 540
agacttcatt cactgggtta ccacggcttc atcccacaga ttcatgttga atacgacggt 600
caatcctatt ttctagatct cgcagatccg ctgtggcagg ttgccctcga atacaacggc 660
ggatggcact acacctctga gcagcgagag aaagattctc atcggaagaa tgctctgaaa 720
agtgcgggat gggatgtcct agaagtgaca tcaaaaactc tgcagaatcc gaattcctgg 780
aacaacctga tacaacagat caatagctct ctccgccgaa agcaggctca gcgacgccga 840
aggttaccca tgcaaacggt gggctaa 867
<210> 3
<211> 288
<212> PRT
<213> Corynebacterium glutamicum
<400> 3
Met Glu Pro Lys Lys Pro Val Thr Tyr Lys Glu Leu Ala His Glu Tyr
1 5 10 15
Ser Arg Arg Thr Phe Asn Lys Leu Phe Thr Lys Ile Thr Gly Phe Val
20 25 30
Tyr Leu Lys Asn Asp Leu Ile Asn Asp Pro Asn Leu Val Thr Gln Ala
35 40 45
Leu Leu Lys Arg Cys Pro Glu Gly Val Leu Arg Gly Tyr Ala Ala Leu
50 55 60
Lys Gln Arg Gly Tyr Gln Leu Leu Asp Asp Gln Trp Met Pro Ile Ile
65 70 75 80
Ser Val Ser Gly Asp Leu Asn Arg Arg Asp Cys Ser Arg Gly Glu Ile
85 90 95
Leu Arg Arg Ile Glu Pro Glu Asn Thr Leu Leu Ser Gly Asn Ile Arg
100 105 110
Phe Val Asn Asp Val Gln Ala Ile Gln Asp Val Phe Asp Leu His Ser
115 120 125
Leu Asn Asp Phe Glu Asp Gln Val Ala Leu Ile Asp His Leu Ile Arg
130 135 140
Gln Arg Pro Glu Leu Phe Gln Glu Leu Ile Gln Glu Pro Lys Leu Lys
145 150 155 160
Lys His Thr Gln Tyr Ala Asn Pro Phe Ala Glu Ser Pro Gln Glu Ser
165 170 175
Arg Leu Arg Val Arg Leu His Ser Leu Gly Tyr His Gly Phe Ile Pro
180 185 190
Gln Ile His Val Glu Tyr Asp Gly Gln Ser Tyr Phe Leu Asp Leu Ala
195 200 205
Asp Pro Leu Trp Gln Val Ala Leu Glu Tyr Asn Gly Gly Trp His Tyr
210 215 220
Thr Ser Glu Gln Arg Glu Lys Asp Ser His Arg Lys Asn Ala Leu Lys
225 230 235 240
Ser Ala Gly Trp Asp Val Leu Glu Val Thr Ser Lys Thr Leu Gln Asn
245 250 255
Pro Asn Ser Trp Asn Asn Leu Ile Gln Gln Ile Asn Ser Ser Leu Arg
260 265 270
Arg Lys Gln Ala Gln Arg Arg Arg Arg Leu Pro Met Gln Thr Val Gly
275 280 285
<210> 4
<211> 288
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Glu Pro Lys Lys Pro Val Thr Tyr Lys Glu Leu Ala His Glu Tyr
1 5 10 15
Ser Arg Arg Thr Phe Asn Lys Leu Phe Thr Lys Ile Thr Gly Phe Val
20 25 30
Tyr Leu Lys Asn Asp Leu Ile Asn Asp Pro Asn Leu Val Thr Gln Ala
35 40 45
Leu Leu Lys Arg Cys Pro Glu Gly Val Leu Arg Gly Tyr Ala Ala Leu
50 55 60
Lys Gln Arg Gly Tyr Gln Leu Leu Asp Asp Gln Trp Met Pro Ile Ile
65 70 75 80
Ser Val Ser Gly Asp Leu Asn Arg Arg Asp Cys Ser Arg Gly Glu Ile
85 90 95
Leu Arg Arg Ile Glu Pro Glu Asn Thr Leu Leu Ser Gly Asn Ile Arg
100 105 110
Phe Val Asn Asp Val Gln Ala Ile Gln Asp Val Phe Asp Leu His Ser
115 120 125
Leu Asn Asp Phe Glu Asp Gln Val Ala Leu Ile Asp His Leu Ile Arg
130 135 140
Gln Arg Pro Glu Leu Phe Gln Glu Leu Ile Gln Glu Pro Lys Leu Lys
145 150 155 160
Lys His Thr Gln Tyr Ala Asn Pro Phe Ala Glu Ser Pro Gln Glu Ser
165 170 175
Arg Leu Arg Ala Arg Leu His Ser Leu Gly Tyr His Gly Phe Ile Pro
180 185 190
Gln Ile His Val Glu Tyr Asp Gly Gln Ser Tyr Phe Leu Asp Leu Ala
195 200 205
Asp Pro Leu Trp Gln Val Ala Leu Glu Tyr Asn Gly Gly Trp His Tyr
210 215 220
Thr Ser Glu Gln Arg Glu Lys Asp Ser His Arg Lys Asn Ala Leu Lys
225 230 235 240
Ser Ala Gly Trp Asp Val Leu Glu Val Thr Ser Lys Thr Leu Gln Asn
245 250 255
Pro Asn Ser Trp Asn Asn Leu Ile Gln Gln Ile Asn Ser Ser Leu Arg
260 265 270
Arg Lys Gln Ala Gln Arg Arg Arg Arg Leu Pro Met Gln Thr Val Gly
275 280 285
<210> 5
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgggatccgt cgcaggcatg atgccact 28
<210> 6
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gaatcacgac ttcgggccag acttcattca c 31
<210> 7
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gtgaatgaag tctggcccga agtcgtgatt c 31
<210> 8
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cccaagcttc tcgctgtgtg gccgttagaa gc 32
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tcagaggtgt agtgccatcc 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ctttgaagac caagtagctc 20
Claims (10)
1. A nucleic acid molecule, wherein the nucleotide sequence of the nucleic acid molecule is the nucleotide sequence that thymine (T) at 539 th position of SEQ ID NO.1 is mutated into cytosine (C).
2. The nucleic acid molecule of claim 1, having a nucleotide sequence as set forth in SEQ ID NO 2.
3. A protein encoded by the nucleic acid molecule of claim 1.
4. The protein of claim 3 having an amino acid sequence of SEQ ID NO:3, the 180 th site of which is substituted by valine to alanine.
5. The protein of claim 3, having an amino acid sequence as set forth in SEQ ID NO:4, respectively.
6. A recombinant vector comprising the nucleic acid molecule of claim 1.
7. A method of constructing a recombinant corynebacterium glutamicum comprising the step of mutating a site of the endogenous NCgl0267 genome of corynebacterium glutamicum having a Gene ID of 1021336, said mutation being: thymine (T) at position 539 of SEQ ID NO:1 is changed to cytosine (C), resulting in the final change of valine (V) to alanine (A) at amino acid 180 of the encoded protein SEQ ID NO: 3.
8. The method according to claim 7, further comprising ligating the DNA fragment containing the mutation site with a plasmid vector to obtain a recombinant vector, and transforming the recombinant vector into a host strain of Corynebacterium glutamicum to obtain a recombinant Corynebacterium glutamicum.
9. A recombinant Corynebacterium glutamicum obtained by the method according to any one of claims 7 to 8.
10. A process for producing L-lysine by using the recombinant Corynebacterium glutamicum of claim 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911185618.9A CN111471693B (en) | 2019-11-27 | 2019-11-27 | Corynebacterium glutamicum for producing lysine and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911185618.9A CN111471693B (en) | 2019-11-27 | 2019-11-27 | Corynebacterium glutamicum for producing lysine and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111471693A CN111471693A (en) | 2020-07-31 |
| CN111471693B true CN111471693B (en) | 2022-04-01 |
Family
ID=71745016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911185618.9A Active CN111471693B (en) | 2019-11-27 | 2019-11-27 | Corynebacterium glutamicum for producing lysine and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111471693B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979165B (en) * | 2020-08-07 | 2021-05-07 | 黑龙江伊品生物科技有限公司 | Recombinant strain for producing L-lysine and construction method and application thereof |
| CN113603755B (en) * | 2021-08-17 | 2023-06-16 | 华南理工大学 | Corynebacterium glutamicum protein Ncgl1307, surface display system and construction method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070056807A (en) * | 2005-11-30 | 2007-06-04 | 씨제이 주식회사 | A microorganism of corynebacterium genus having enhanced l-lysine productivity and a method of producing l-lysine using the same |
| CN110079566A (en) * | 2019-05-16 | 2019-08-02 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc promoter |
| CN110195087A (en) * | 2019-05-16 | 2019-09-03 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc gene |
| CN110218749A (en) * | 2019-05-16 | 2019-09-10 | 内蒙古伊品生物科技有限公司 | With the method for the bacterial fermentation production lysine for changing NCgl1859 |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2547860A1 (en) * | 2003-12-18 | 2005-06-30 | Basf Aktiengesellschaft | Methods for the preparation of lysine by fermentation of corynebacterium glutamicum |
-
2019
- 2019-11-27 CN CN201911185618.9A patent/CN111471693B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070056807A (en) * | 2005-11-30 | 2007-06-04 | 씨제이 주식회사 | A microorganism of corynebacterium genus having enhanced l-lysine productivity and a method of producing l-lysine using the same |
| CN110079566A (en) * | 2019-05-16 | 2019-08-02 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc promoter |
| CN110195087A (en) * | 2019-05-16 | 2019-09-03 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc gene |
| CN110218749A (en) * | 2019-05-16 | 2019-09-10 | 内蒙古伊品生物科技有限公司 | With the method for the bacterial fermentation production lysine for changing NCgl1859 |
Non-Patent Citations (2)
| Title |
|---|
| "Corynebacterium glutamicum strain JH41 chromosome, complete genome，Accession No:CP041729.1";Kim,P. 等;《Genbank》;20190725;第1页 * |
| "谷氨酸棒杆菌生产L-赖氨酸的培养优化和产酸特性研究";苏会波 等;《食品工业科技》;20141231;第35卷(第17期);第130-133页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111471693A (en) | 2020-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110607313B (en) | Recombinant strain for high yield of L-lysine and construction method and application thereof | |
| CN111979165B (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
| CN110195087B (en) | Method for producing L-lysine by fermentation using bacteria with modified ppc gene | |
| CN111850010B (en) | dapB gene modified recombinant strain and construction method and application thereof | |
| CN111979164A (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
| CN111909944A (en) | Recombinant strain modified by lysC gene and construction method and application thereof | |
| CN111471693B (en) | Corynebacterium glutamicum for producing lysine and construction method and application thereof | |
| CN110592109B (en) | Recombinant strain modified by spoT gene and construction method and application thereof | |
| CN110846333B (en) | Recombinant strain modified by deoB gene and construction method and application thereof | |
| CN110846312B (en) | Promoter nucleic acid sequence of sdaA gene, recombinant strain containing nucleic acid sequence and application of recombinant strain | |
| CN110592084B (en) | Recombinant strain transformed by rhtA gene promoter, construction method and application thereof | |
| CN110079566B (en) | Method for producing L-lysine by fermentation of bacteria with modified ppc promoter | |
| CN111961635A (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
| CN110218749B (en) | Method for producing lysine by fermentation using NCgl 1859-modified bacteria | |
| CN112538491B (en) | YH66_08550 gene-based recombinant strain for producing L-isoleucine as well as construction method and application thereof | |
| WO2022143639A1 (en) | Recombinant strain for producing l-glutamic acid by means of modifying gene bbd29_11265, and construction method and use thereof | |
| CN110564742B (en) | Recombinant strain modified by yebN gene and construction method and application thereof | |
| CN110804617B (en) | KdtA gene modified recombinant strain and construction method and application thereof | |
| WO2022143646A1 (en) | Recombinant strain for producing l-glutamic acid by modifying gene bbd29_09525, and construction method therefor and application thereof | |
| WO2022143762A1 (en) | Recombinant strain of modifying gene bbd29_14900, and construction method and use thereof | |
| CN114409751A (en) | YH 66-04470 gene mutation recombinant bacterium and application thereof in preparation of arginine | |
| CN114277069B (en) | Method for preparing L-valine and biological material used by same | |
| EP3992293A1 (en) | Escherichia coli-based recombinant strain, construction method therefor and use thereof | |
| CN114507273A (en) | Application of YH66_07020 protein and related biological material thereof in improving yield of arginine | |
| CN117551708A (en) | Method for preparing L-glutamic acid and related BBD29_13530 gene mutant thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |