CN111471693A - Corynebacterium glutamicum for producing lysine and construction method and application thereof - Google Patents
Corynebacterium glutamicum for producing lysine and construction method and application thereof Download PDFInfo
- Publication number
- CN111471693A CN111471693A CN201911185618.9A CN201911185618A CN111471693A CN 111471693 A CN111471693 A CN 111471693A CN 201911185618 A CN201911185618 A CN 201911185618A CN 111471693 A CN111471693 A CN 111471693A
- Authority
- CN
- China
- Prior art keywords
- corynebacterium glutamicum
- seq
- sequence
- amino acid
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The corynebacterium glutamicum is in a site of an endogenous NCgl0267 genome of the corynebacterium glutamicum through point mutation, for example, the 539 th thymine (T) of the NCgl0267 is changed into cytosine (C).
Description
Technical Field
The invention belongs to the field of genetic engineering, and relates to corynebacterium glutamicum for producing lysine, and a construction method and application thereof.
Background
L-lysine is one of the important components of protein, is an essential amino acid which can not be synthesized by human body, and has very important function in the fields of pharmacy, animal feed and the like.
At present, the fermentation method is mainly adopted for producing lysine industrially, the strains for producing lysine industrially by fermentation are mainly variant strains of corynebacterium and brevibacterium, wherein the corynebacterium glutamicum is the most widely used lysine-producing strain in industrial production, the corynebacterium glutamicum is a gram-positive microorganism, has high growth speed, is nonpathogenic and has weak degradation capability on self metabolites, and therefore, is widely used for producing L-amino acid, nucleotide and other organic acids, a plurality of patents and documents disclose a method for producing L-lysine by adopting the microbial fermentation method, for example, CN1197957C discloses the corynebacterium glutamicum with monofluoroacetic acid resistance and α -thiazole-D L-alanine resistance, but the fermentation performance of the existing corynebacterium glutamicum producing L-lysine is still poor, the acid production rate is still low, and the requirement of large-scale industrial production cannot be met.
Disclosure of Invention
The invention provides the following technical scheme:
in a first aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence which is mutated at the sequence position of SEQ ID No.1 or a sequence complementary thereto. In one embodiment, the nucleic acid molecule comprises a substitution at position 539 in SEQ ID NO 1, for example the substitution is T539C. Specifically, the nucleic acid molecule comprises a nucleotide sequence shown in SEQ ID NO. 2 or a complementary sequence thereof.
In one embodiment, the nucleic acid molecule encodes a protein or a partial protein fragment comprising an amino acid sequence which has a substitution at position 180 of SEQ ID NO:3, e.g., the substitution is V180A, as compared to the amino acid sequence of SEQ ID NO: 3.
In a second aspect of the invention, there is provided a protein or partial protein fragment comprising an amino acid sequence having a mutation at a position shown in SEQ ID No. 3. In one embodiment, the amino acid sequence includes a substitution at position 180 of SEQ ID NO. 3, for example the substitution is V180A. In particular, the amino acid sequence of the protein or part of the protein fragment comprises the amino acid sequence shown in SEQ ID NO. 4, or the protein or part of the protein fragment is encoded by the nucleic acid molecule of the first aspect of the invention.
In a third aspect of the invention, there is provided a recombinant vector, for example a recombinant expression vector, comprising a nucleic acid molecule according to the first aspect of the invention, and also a host cell into which the recombinant vector has been introduced.
In a fourth aspect of the invention, there is provided a recombinant Corynebacterium glutamicum comprising the nucleic acid molecule of the first aspect of the invention or the amino acid sequence of the second aspect, in one embodiment the genome of Corynebacterium glutamicum has been altered by the introduction of the nucleic acid molecule of the invention, in another embodiment the endogenous NCgl0267 Gene (Gene ID: 1021336) in the genome of Corynebacterium glutamicum has been altered, for example by introducing a point mutation at a specific site in the endogenous NCgl0267 genome of Corynebacterium glutamicum by means of homologous recombination, PCR recombination, etc. in one embodiment the recombinant Corynebacterium glutamicum is used to produce L-lysine, for example by cultivation in a suitable medium to produce L-lysine.
In a fifth aspect of the present invention, there is provided a method for constructing a recombinant Corynebacterium glutamicum comprising modifying the endogenous NCgl0267 gene in the genome of Corynebacterium glutamicum, for example, by introducing a point mutation at a specific site in the endogenous NCgl0267 genome of Corynebacterium glutamicum by homologous recombination, PCR point mutation, or the like.
In one embodiment, the method of construction comprises: an amplification primer of the coding region sequence of the NCgl0267 gene is designed according to the known genome sequence of Corynebacterium glutamicum, and a point mutation is introduced into the specific site of the coding region of the NCgl0267 gene of the host strain by means of allelic replacement.
In one embodiment, the amplification primer is P1:5'CGGGATCCGTCGCAGGCATGATGCCACT 3'(BamH I)(SEQ ID NO:5)
P2:5'GAATCACGACTTCGGGCCAGACTTCATTCAC 3'(SEQ ID NO:6)
P3:5'GTGAATGAAGTCTGGCCCGAAGTCGTGATTC 3'(SEQ ID NO:7)
P4:5'CCCAAGCTTCTCGCTGTGTGGCCGTTAGAAGC 3'(HindⅢ)(SEQ ID NO:8)
In one embodiment, the method of construction comprises: the genome of Corynebacterium glutamicum is taken as a template, primers P1 and P2, P3 and P4 are respectively used for carrying out PCR amplification on a DNA fragment containing the NCgl0267 gene coding region, and then the two DNA fragments are taken as templates, and P1 and P4 are taken as primers for carrying out overlap PCR (overlap PCR) amplification to obtain a DNA fragment containing mutation sites.
In one embodiment, the construction method further comprises linking the DNA fragment containing the mutation site with a plasmid vector to obtain a recombinant vector, and transforming the recombinant vector into a corynebacterium glutamicum host strain to obtain a recombinant corynebacterium glutamicum. The recombinant C.glutamicum corresponding to position 539 of SEQ ID NO.1 had a thymine (T) to a cytosine (C), which finally resulted in the change of valine (V) to alanine (A) at amino acid 180 of the encoded protein SEQ ID NO. 3.
In the present invention, the Corynebacterium glutamicum host strain is any strain of Corynebacterium glutamicum known in the art to have lysine-producing ability, preferably containing the coding region of the NCgl0267 gene, e.g., ATCC13032, YP 97158.
In the present invention, the plasmid vector is an expression vector known in the art, such as pK18mobsacB plasmid.
In a sixth aspect of the invention, a method of making L-lysine is provided using a recombinant Corynebacterium glutamicum strain as described above, in one embodiment, the recombinant Corynebacterium glutamicum strain is fermented with a fermentation medium, and L-lysine is isolated from the fermentation broth.
The invention has the advantages of
The invention introduces point mutation into the genome of the corynebacterium glutamicum strain producing lysine, greatly improves the L-lysine producing capability of the corynebacterium glutamicum by changing the specific site of the NCgl0267 gene coding region, still keeps good growth capability and biological characteristics of the strain, has simple strain construction method, low cost and high strain quality, and is suitable for industrialized large-scale production.
Detailed Description
The present invention is further illustrated in the following examples, which are not intended to limit the scope of the invention. The details of the partial gene cloning method vary depending on the reagents, enzymes or kits provided by the supplier, and should be conducted according to the product instructions, and will not be described in detail in the examples.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 construction of transformation vector pK18-NCgl0267 containing the coding region of the NCgl0267 Gene with a point mutationT539C
According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the coding region sequence of NCgl0267 gene are designed and synthesized, and point mutation is introduced in the coding region (SEQ ID NO:1) of NCgl0267 gene in the background of strain YP97158 (preservation No: CGMCC No.12856, preservation date: 2016 (8/16 th) and preservation unit: institute of microbiology, national academy of sciences, 3 th of Xilu 1 # of the sunward region of Beijing) by means of allelic gene replacement, the amino acid sequence of the corresponding encoded protein is sequence 3, and the nucleotide sequence 539 th position T of the NCgl0267 gene is changed into C (SEQ ID NO: 2: NCgl 0267)T539C) The amino acid sequence corresponding to the encoded protein (SEQ ID NO:3) has a valine to alanine at position 180 (SEQ ID NO: 4: NCgl0267V180A). The primers were designed as follows (synthesized by Shanghai Invitrogen corporation):
P1:5'CGGGATCCGTCGCAGGCATGATGCCACT 3'(BamH I)(SEQ ID NO:5)
P2:5'GAATCACGACTTCGGGCCAGACTTCATTCAC 3'(SEQ ID NO:6)
P3:5'GTGAATGAAGTCTGGCCCGAAGTCGTGATTC 3'(SEQ ID NO:7)
P4:5'CCCAAGCTTCTCGCTGTGTGGCCGTTAGAAGC 3'(HindⅢ)(SEQ ID NO:8)
the construction method comprises using Corynebacterium glutamicum ATCC13032 as template, and primers P1 and P2, P3 and P4, respectively, to perform PCR amplification, wherein the PCR system comprises 10 × Ex Taq Buffer 5 mu L mix (2.5 mM each) 4 mu L and Mg2+(25mM) 4. mu. L, primers (10pM) each 2. mu. L, Ex Taq (5U/. mu. L) 0.25. mu. L, and a total volume of 50. mu. L, wherein the PCR amplification is carried out by pre-denaturing at 94 ℃ for 5min, (denaturing at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extending at 72 ℃ for 40s, for 30 cycles), and over-extending at 72 ℃ for 10min to obtain two DNA fragments (NCgl0267 Up and NCgl0267 Down) having sizes of 670bp and 692bp, respectively, and comprising the coding region of the NCgl0267 gene, and the two DNA fragments are separated and purified by agarose gel electrophoresis, and then the two DNA fragments are used as templates, P1 and P4 are used as primers, and the DNA fragment NCgl0267 having a length of about 1331bp is amplified by OVeplap PCRT539CPCR System 10 × Ex Taq Buffer 5. mu. L mix (2.5 mM each) 4. mu. L, Mg2+(25mM) 4. mu. L, primers (10pM) each 2. mu. L, Ex Taq (5U/. mu. L) 0.25. mu. L, and a total volume of 50. mu. L, said PCR amplification being carried out by pre-denaturation at 94 ℃ for 5min, (denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 90s, 30 cycles), and over-extension at 72 ℃ for 10min, this NCgl0267T539CThe DNA fragment of (a) results in the conversion of thymine (T) at position 539 of the coding region of the YP97158 NCgl0267 gene to cytosine (C), and finally in the conversion of valine (V) to alanine (A) at position 180 of the encoded protein. Separating purified NCgl0267 by agarose gel electrophoresisT539CAnd pK18mobsacB plasmid (purchased from Addgene) were separately digested with BamH I/HindIII, separated and purified by agarose gel electrophoresis, and ligated to obtain vector pK18-NCgl0267T539CThe plasmid contains a kanamycin resistance marker. And the vector pK18-NCgl0267T539CSending to a sequencing company for sequencing and identifying, and adding a vector pK18-NCgl0267 containing a correct point mutation (T-C)T539CAnd (5) storing for later use.
Example 2 construction of a plasmid containing a Point mutationNCgl0267T539COf (4) an engineered strain
The construction method comprises the following steps: the allele substitution plasmid pK18-NCgl0267T539CThe DNA was transformed into L-lysine-producing bacterial patent strain YP97158 by electric shock (see WO2014121669A 1; the construction method thereof is confirmed by sequencing to retain the wild-type NCgl0267 gene coding region on the chromosome of the strain), and the single colonies generated by the culture were identified by primer P1 and universal primer M13F, respectively, and the strain with an amplified band of 1400bp size was a positive strain, the positive strain was cultured on a medium containing 15% sucrose, the single colonies generated by the culture were cultured on a medium containing kanamycin and a medium not containing kanamycin, respectively, and the single colonies were grown on a medium not containing kanamycin, while the strains not grown on a medium containing kanamycin were further identified by PCR using the following primers (synthesized by Shanghai invitrogen Co.):
P5:5'TCAGAGGTGTAGTGCCATCC 3'(SEQ ID NO:9)
P6:5'CTTTGAAGACCAAGTAGCTC 3'(SEQ ID NO:10)
the amplification product obtained by amplifying the positive strain by the primers P5 and P6 is subjected to sscp electrophoresis (by the plasmid pK18-NCgl 0267) after high-temperature denaturation and ice bathT539CThe amplified fragment is a positive control, the YP97158 amplified fragment is a negative control, and water is used as a blank control). due to the difference of the fragment structures and the difference of the electrophoresis positions, the electrophoresis positions of the fragments are inconsistent with the positions of the negative control fragments, and the strains consistent with the positions of the positive control fragments are strains with successful allelic substitution, the target fragments of the positive strains are amplified again through PCR, are connected to a PMD19-T vector for sequencing, sequence verification strains with mutated base sequences through sequence alignment are successful in allelic substitution, and are named as YP L-4-016.
Example 3L lysine fermentation experiment
The strain YP L-4-016 and the original strain YP97158 constructed in example 2 were subjected to fermentation experiments in a B L BIO-5GC-4-H model fermenter (purchased from Bailan Biotech Co., Ltd., Shanghai) with the media shown in Table 1 and the control procedures shown in Table 2, and the results are shown in Table 3, for each strain, which were repeated three times.
TABLE 1 fermentation Medium formulation
| Composition (I) | Formulation of |
| Starch hydrolysis sugar | 30g/L |
| Ammonium sulfate | 12g/L |
| Magnesium sulfate | 0.87g/L |
| Molasses for health protection | 20g/L |
| Acidified corn steep liquor | 3mL/L |
| Phosphoric acid | 0.4mL/L |
| Potassium chloride | 0.53g/L |
| Defoaming agent (2% foam) | 4mL/L |
| Ferrous sulfate | 120mg/L |
| Manganese sulfate | 120mg/L |
| Nicotinamide | 42mg/L |
| Calcium pantothenate | 6.3mg/L |
| Vitamin B1 | 6.3mg/L |
| Solution of copper or zinc salt | 0.6g/L |
| Biotin | 0.88mg/L |
TABLE 2 fermentation control Process
TABLE 3L results of lysine fermentation experiments
As a result, the coding region of NCgl0267 gene was point-mutated in Corynebacterium glutamicum to NCgl0267 as shown in Table 3T539CThis contributes to the improvement of the yield of L-lysine.
The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Nemeng Guyi products Biotechnology Ltd
<120> Corynebacterium glutamicum producing lysine and construction method and application thereof
<130>CPCN19111424
<160>10
<170>SIPOSequenceListing 1.0
<210>1
<211>867
<212>DNA
<213>Corynebacterium glutamicum
<400>1
atggaaccga aaaaacctgt cacatataaa gaacttgccc acgaatattc aagaagaacg 60
tttaacaaac tcttcaccaa aattactggc ttcgtctatc taaaaaacga tctaatcaac 120
gatcccaact tagtgaccca agcactgctc aaaagatgcc cagaaggagt acttcgcgga 180
tatgcagcat taaagcaacg tggctatcag cttttagacg atcagtggat gccaatcatc 240
agtgtttccg gagatctaaa caggagggac tgctcacgag gtgaaattct caggcggatt 300
gaaccagaaa acaccctgct cagtggcaac attaggttcg ttaatgatgt tcaagcgatc 360
caagacgtct tcgacctgca ttctctcaac gactttgaag accaagtagc tctcatcgat 420
catctcatca ggcagcgccc cgaattattc caagaactca tacaagagcc aaaacttaag 480
aaacacactc aatacgccaa tccttttgct gaatctccgc aagaatcacg acttcgggtc 540
agacttcatt cactgggtta ccacggcttc atcccacaga ttcatgttga atacgacggt 600
caatcctatt ttctagatct cgcagatccg ctgtggcagg ttgccctcga atacaacggc 660
ggatggcact acacctctga gcagcgagag aaagattctc atcggaagaa tgctctgaaa 720
agtgcgggat gggatgtcct agaagtgaca tcaaaaactc tgcagaatcc gaattcctgg 780
aacaacctga tacaacagat caatagctct ctccgccgaa agcaggctca gcgacgccga 840
aggttaccca tgcaaacggt gggctaa 867
<210>2
<211>867
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atggaaccga aaaaacctgt cacatataaa gaacttgccc acgaatattc aagaagaacg 60
tttaacaaac tcttcaccaa aattactggc ttcgtctatc taaaaaacga tctaatcaac 120
gatcccaact tagtgaccca agcactgctc aaaagatgcc cagaaggagt acttcgcgga 180
tatgcagcat taaagcaacg tggctatcag cttttagacg atcagtggat gccaatcatc 240
agtgtttccg gagatctaaa caggagggac tgctcacgag gtgaaattct caggcggatt 300
gaaccagaaa acaccctgct cagtggcaac attaggttcg ttaatgatgt tcaagcgatc 360
caagacgtct tcgacctgca ttctctcaac gactttgaag accaagtagc tctcatcgat 420
catctcatca ggcagcgccc cgaattattc caagaactca tacaagagcc aaaacttaag 480
aaacacactc aatacgccaa tccttttgct gaatctccgc aagaatcacg acttcgggcc 540
agacttcatt cactgggtta ccacggcttc atcccacaga ttcatgttga atacgacggt 600
caatcctatt ttctagatct cgcagatccg ctgtggcagg ttgccctcga atacaacggc 660
ggatggcact acacctctga gcagcgagag aaagattctc atcggaagaa tgctctgaaa 720
agtgcgggat gggatgtcct agaagtgaca tcaaaaactc tgcagaatcc gaattcctgg 780
aacaacctga tacaacagat caatagctct ctccgccgaa agcaggctca gcgacgccga 840
aggttaccca tgcaaacggt gggctaa 867
<210>3
<211>288
<212>PRT
<213>Corynebacterium glutamicum
<400>3
Met Glu Pro Lys Lys Pro Val Thr Tyr Lys Glu Leu Ala His Glu Tyr
1 5 10 15
Ser Arg Arg Thr Phe Asn Lys Leu Phe Thr Lys Ile Thr Gly Phe Val
20 25 30
Tyr Leu Lys Asn Asp Leu Ile Asn Asp Pro Asn Leu Val Thr Gln Ala
35 40 45
Leu Leu Lys Arg Cys Pro Glu Gly Val Leu Arg Gly Tyr Ala Ala Leu
50 55 60
Lys Gln Arg Gly Tyr Gln Leu Leu Asp Asp Gln Trp Met Pro Ile Ile
65 70 75 80
Ser Val Ser Gly Asp Leu Asn Arg Arg Asp Cys Ser Arg Gly Glu Ile
85 90 95
Leu Arg Arg Ile Glu Pro Glu Asn Thr Leu Leu Ser Gly Asn Ile Arg
100 105 110
Phe Val Asn Asp Val Gln Ala Ile Gln Asp Val Phe Asp Leu His Ser
115 120 125
Leu Asn Asp Phe Glu Asp Gln Val Ala Leu Ile Asp His Leu Ile Arg
130 135 140
Gln Arg Pro Glu Leu Phe Gln Glu Leu Ile Gln Glu Pro Lys Leu Lys
145 150 155160
Lys His Thr Gln Tyr Ala Asn Pro Phe Ala Glu Ser Pro Gln Glu Ser
165 170 175
Arg Leu Arg Val Arg Leu His Ser Leu Gly Tyr His Gly Phe Ile Pro
180 185 190
Gln Ile His Val Glu Tyr Asp Gly Gln Ser Tyr Phe Leu Asp Leu Ala
195 200 205
Asp Pro Leu Trp Gln Val Ala Leu Glu Tyr Asn Gly Gly Trp His Tyr
210 215 220
Thr Ser Glu Gln Arg Glu Lys Asp Ser His Arg Lys Asn Ala Leu Lys
225 230 235 240
Ser Ala Gly Trp Asp Val Leu Glu Val Thr Ser Lys Thr Leu Gln Asn
245 250 255
Pro Asn Ser Trp Asn Asn Leu Ile Gln Gln Ile Asn Ser Ser Leu Arg
260 265 270
Arg Lys Gln Ala Gln Arg Arg Arg Arg Leu Pro Met Gln Thr Val Gly
275 280 285
<210>4
<211>288
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>4
Met Glu Pro Lys Lys Pro Val Thr Tyr Lys Glu Leu Ala His Glu Tyr
1 5 10 15
Ser Arg Arg Thr Phe Asn Lys Leu Phe Thr Lys Ile Thr Gly Phe Val
20 25 30
Tyr Leu Lys Asn Asp Leu Ile Asn Asp Pro Asn Leu Val Thr Gln Ala
35 40 45
Leu Leu Lys Arg Cys Pro Glu Gly Val Leu Arg Gly Tyr Ala Ala Leu
50 55 60
Lys Gln Arg Gly Tyr Gln Leu Leu Asp Asp Gln Trp Met Pro Ile Ile
65 70 75 80
Ser Val Ser Gly Asp Leu Asn Arg Arg Asp Cys Ser Arg Gly Glu Ile
85 90 95
Leu Arg Arg Ile Glu Pro Glu Asn Thr Leu Leu Ser Gly Asn Ile Arg
100 105 110
Phe Val Asn Asp Val Gln Ala Ile Gln Asp Val Phe Asp Leu His Ser
115 120 125
Leu Asn Asp Phe Glu Asp Gln Val Ala Leu Ile Asp His Leu Ile Arg
130 135 140
Gln Arg Pro Glu Leu Phe Gln Glu Leu Ile Gln Glu Pro Lys Leu Lys
145 150 155 160
Lys His Thr Gln Tyr Ala Asn Pro Phe Ala Glu Ser Pro Gln GluSer
165 170 175
Arg Leu Arg Ala Arg Leu His Ser Leu Gly Tyr His Gly Phe Ile Pro
180 185 190
Gln Ile His Val Glu Tyr Asp Gly Gln Ser Tyr Phe Leu Asp Leu Ala
195 200 205
Asp Pro Leu Trp Gln Val Ala Leu Glu Tyr Asn Gly Gly Trp His Tyr
210 215 220
Thr Ser Glu Gln Arg Glu Lys Asp Ser His Arg Lys Asn Ala Leu Lys
225 230 235 240
Ser Ala Gly Trp Asp Val Leu Glu Val Thr Ser Lys Thr Leu Gln Asn
245 250 255
Pro Asn Ser Trp Asn Asn Leu Ile Gln Gln Ile Asn Ser Ser Leu Arg
260 265 270
Arg Lys Gln Ala Gln Arg Arg Arg Arg Leu Pro Met Gln Thr Val Gly
275 280 285
<210>5
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
cgggatccgt cgcaggcatg atgccact 28
<210>6
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gaatcacgac ttcgggccag acttcattca c 31
<210>7
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
gtgaatgaag tctggcccga agtcgtgatt c 31
<210>8
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
cccaagcttc tcgctgtgtg gccgttagaa gc 32
<210>9
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
tcagaggtgt agtgccatcc 20
<210>10
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ctttgaagac caagtagctc20
Claims (8)
1. A nucleic acid molecule comprising a nucleotide sequence which is mutated at the sequence position of SEQ ID No.1 or the complement thereof. Preferably, the nucleic acid molecule comprises the nucleotide sequence of SEQ ID NO.1 with substitution mutation at position 539. For example, the nucleic acid molecule includes the nucleotide sequence shown in SEQ ID NO. 2 or a complementary sequence thereof.
2. A protein or partial protein fragment encoded by the nucleic acid molecule of claim 1. Preferably, the protein or partial protein fragment comprises an amino acid sequence which is comprised in SEQ ID NO:3 at position 180. For example, the amino acid sequence is SEQ ID NO: 4.
3. An amino acid sequence comprising a stretch of SEQ ID NO:3 at a position in the amino acid sequence. Preferably, the amino acid sequence is comprised in SEQ ID NO:3 at position 180. For example, the amino acid sequence includes SEQ ID NO: 4.
4. A recombinant vector comprising the nucleic acid molecule of claim 1.
5. A recombinant corynebacterium glutamicum strain obtained by mutating a site of the endogenous NCgl0267 genome of corynebacterium glutamicum. For example, the mutation is achieved by homologous recombination, or PCR point mutation. Preferably, the Corynebacterium glutamicum contains the nucleic acid molecule of claim 1 or the amino acid sequence of claim 3.
6. A method of constructing a recombinant corynebacterium glutamicum, comprising: a step of mutating a site of the endogenous NCgl0267 genome of corynebacterium glutamicum. Specifically, an amplification primer of the coding region sequence of the NCgl0267 gene was designed based on the known genomic sequence of Corynebacterium glutamicum, and a point mutation was introduced at the site of the coding region of the NCgl0267 gene of the host strain by allelic replacement. Preferably, it comprises a substitution mutation at position 539 in SEQ ID NO. 1. For example, thymine (T) at position 539 of SEQ ID NO.1 is changed to cytosine (C), eventually resulting in the change of valine (V) to alanine (A) at amino acid 180 of the encoded protein SEQ ID NO. 3.
7. The method according to claim 6, further comprising ligating the DNA fragment containing the mutation site with a plasmid vector to obtain a recombinant vector, and transforming the recombinant vector into a host strain of Corynebacterium glutamicum to obtain a recombinant Corynebacterium glutamicum.
8. A process for the preparation of L-lysine, using the recombinant Corynebacterium glutamicum of claim 5 or the Corynebacterium glutamicum obtained by the process of any of claims 6 to 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911185618.9A CN111471693B (en) | 2019-11-27 | 2019-11-27 | Corynebacterium glutamicum for producing lysine and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911185618.9A CN111471693B (en) | 2019-11-27 | 2019-11-27 | Corynebacterium glutamicum for producing lysine and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111471693A true CN111471693A (en) | 2020-07-31 |
| CN111471693B CN111471693B (en) | 2022-04-01 |
Family
ID=71745016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911185618.9A Active CN111471693B (en) | 2019-11-27 | 2019-11-27 | Corynebacterium glutamicum for producing lysine and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111471693B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979165A (en) * | 2020-08-07 | 2020-11-24 | 黑龙江伊品生物科技有限公司 | Recombinant strain for producing L-lysine and construction method and application thereof |
| CN113603755A (en) * | 2021-08-17 | 2021-11-05 | 华南理工大学 | Corynebacterium glutamicum protein Ncgl1307 and surface display system and construction method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20070056807A (en) * | 2005-11-30 | 2007-06-04 | 씨제이 주식회사 | A microorganism of corynebacterium genus having enhanced l-lysine productivity and a method of producing l-lysine using the same |
| US20100015674A1 (en) * | 2003-12-18 | 2010-01-21 | Basf Se | Methods For The Preparation of Lysine By Fermentation Of Corynebacterium Glutamicum |
| CN110079566A (en) * | 2019-05-16 | 2019-08-02 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc promoter |
| CN110195087A (en) * | 2019-05-16 | 2019-09-03 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc gene |
| CN110218749A (en) * | 2019-05-16 | 2019-09-10 | 内蒙古伊品生物科技有限公司 | With the method for the bacterial fermentation production lysine for changing NCgl1859 |
-
2019
- 2019-11-27 CN CN201911185618.9A patent/CN111471693B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100015674A1 (en) * | 2003-12-18 | 2010-01-21 | Basf Se | Methods For The Preparation of Lysine By Fermentation Of Corynebacterium Glutamicum |
| KR20070056807A (en) * | 2005-11-30 | 2007-06-04 | 씨제이 주식회사 | A microorganism of corynebacterium genus having enhanced l-lysine productivity and a method of producing l-lysine using the same |
| CN110079566A (en) * | 2019-05-16 | 2019-08-02 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc promoter |
| CN110195087A (en) * | 2019-05-16 | 2019-09-03 | 黑龙江伊品生物科技有限公司 | With the method for the bacterial fermentation production L-lysine for changing ppc gene |
| CN110218749A (en) * | 2019-05-16 | 2019-09-10 | 内蒙古伊品生物科技有限公司 | With the method for the bacterial fermentation production lysine for changing NCgl1859 |
Non-Patent Citations (2)
| Title |
|---|
| KIM,P. 等: ""Corynebacterium glutamicum strain JH41 chromosome, complete genome，Accession No:CP041729.1"", 《GENBANK》 * |
| 苏会波 等: ""谷氨酸棒杆菌生产L-赖氨酸的培养优化和产酸特性研究"", 《食品工业科技》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979165A (en) * | 2020-08-07 | 2020-11-24 | 黑龙江伊品生物科技有限公司 | Recombinant strain for producing L-lysine and construction method and application thereof |
| CN113603755A (en) * | 2021-08-17 | 2021-11-05 | 华南理工大学 | Corynebacterium glutamicum protein Ncgl1307 and surface display system and construction method thereof |
| CN113603755B (en) * | 2021-08-17 | 2023-06-16 | 华南理工大学 | Corynebacterium glutamicum protein Ncgl1307, surface display system and construction method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111471693B (en) | 2022-04-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110607313B (en) | Recombinant strain for high yield of L-lysine and construction method and application thereof | |
| CN110195087B (en) | Method for producing L-lysine by fermentation using bacteria with modified ppc gene | |
| CN111979165B (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
| CN111979164B (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
| CN111850010B (en) | dapB gene modified recombinant strain and construction method and application thereof | |
| CN111909944A (en) | Recombinant strain modified by lysC gene and construction method and application thereof | |
| CN111471693B (en) | Corynebacterium glutamicum for producing lysine and construction method and application thereof | |
| WO2022143761A1 (en) | Recombinant strain for producing l-glutamic acid by means of modifying gene bbd29_04920, and construction method and use thereof | |
| CN111961635B (en) | Recombinant strain for producing L-lysine and construction method and application thereof | |
| CN110592109B (en) | Recombinant strain modified by spoT gene and construction method and application thereof | |
| CN110846333B (en) | Recombinant strain modified by deoB gene and construction method and application thereof | |
| CN110846312B (en) | Promoter nucleic acid sequence of sdaA gene, recombinant strain containing nucleic acid sequence and application of recombinant strain | |
| CN110079566B (en) | Method for producing L-lysine by fermentation of bacteria with modified ppc promoter | |
| CN110218749B (en) | Method for producing lysine by fermentation using NCgl 1859-modified bacteria | |
| CN110592084B (en) | Recombinant strain transformed by rhtA gene promoter, construction method and application thereof | |
| WO2022143639A1 (en) | Recombinant strain for producing l-glutamic acid by means of modifying gene bbd29_11265, and construction method and use thereof | |
| WO2022143646A1 (en) | Recombinant strain for producing l-glutamic acid by modifying gene bbd29_09525, and construction method therefor and application thereof | |
| CN110804617B (en) | KdtA gene modified recombinant strain and construction method and application thereof | |
| CN110564742B (en) | Recombinant strain modified by yebN gene and construction method and application thereof | |
| CN114409751A (en) | YH 66-04470 gene mutation recombinant bacterium and application thereof in preparation of arginine | |
| CN114369559B (en) | Recombinant strain for producing L-amino acid and construction method and application thereof | |
| CN112266891B (en) | Recombinant strain for producing L-amino acid and construction method and application thereof | |
| CN114507273B (en) | YH66_07020 protein and application of related biological material thereof in improving arginine yield | |
| US20230295645A1 (en) | Recombinant strain producing l-lysine and construction methods therefor and use thereof | |
| EP3992293A1 (en) | Escherichia coli-based recombinant strain, construction method therefor and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |