CN112266891B - Recombinant strain for producing L-amino acid and construction method and application thereof - Google Patents

Recombinant strain for producing L-amino acid and construction method and application thereof Download PDF

Info

Publication number
CN112266891B
CN112266891B CN202011105063.5A CN202011105063A CN112266891B CN 112266891 B CN112266891 B CN 112266891B CN 202011105063 A CN202011105063 A CN 202011105063A CN 112266891 B CN112266891 B CN 112266891B
Authority
CN
China
Prior art keywords
seq
amino acid
ncgl0609
polynucleotide
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011105063.5A
Other languages
Chinese (zh)
Other versions
CN112266891A (en
Inventor
魏爱英
孟刚
周晓群
赵春光
马风勇
贾慧萍
杨立鹏
苏厚波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inner Mongolia Eppen Biotech Co ltd
Original Assignee
Inner Mongolia Eppen Biotech Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inner Mongolia Eppen Biotech Co ltd filed Critical Inner Mongolia Eppen Biotech Co ltd
Priority to CN202011105063.5A priority Critical patent/CN112266891B/en
Priority to KR1020227045499A priority patent/KR20230042224A/en
Priority to EP20939601.9A priority patent/EP4163377A1/en
Priority to US18/001,218 priority patent/US20230313122A1/en
Priority to JP2022574296A priority patent/JP2023528619A/en
Priority to PCT/CN2020/142133 priority patent/WO2021248902A1/en
Publication of CN112266891A publication Critical patent/CN112266891A/en
Application granted granted Critical
Publication of CN112266891B publication Critical patent/CN112266891B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a method for introducing point mutation into NCgl0609 gene coding sequence in coryneform bacteria or improving its expression, and said method can make the strain with said mutation raise fermentation yield of amino acid. The point mutation is to mutate 1000 th base of NCgl0609 gene sequence from cytosine (C) to thymine (T) and replace 334 th arginine of coded corresponding amino acid with terminator.

Description

Recombinant strain for producing L-amino acid and construction method and application thereof
Technical Field
The invention belongs to the technical fields of genetic engineering and microorganisms, and particularly relates to a recombinant strain for producing L-amino acid, a construction method and application thereof.
Background
L-Lysine (L-Lysine) has wide application range, including various aspects such as medicine, food, feed and the like, wherein the L-Lysine applied to the feed additive accounts for more than 90% of the total amount. At present, china is the second major consumer market of L-lysine and the first major L-lysine producing country.
At present, L-lysine is mainly produced by adopting a direct fermentation method, wherein the direct fermentation method utilizes strains with complete L-lysine biosynthesis pathway, and waste molasses, starch hydrolysate and the like are used as substrates to produce the L-lysine through aerobic fermentation. The method accounts for 2/3 of the world L-lysine production, the technology is very mature, and the method is mainly in yeast, bacteria and mould and widely exists in microorganisms. At present, the industrial strains used for L-lysine fermentation are mainly mutant strains of Corynebacterium and Brevibacterium by mutagenesis. Along with the development of metabolic engineering and genetic engineering, the gene mutation is controllable, so that in the process of modifying an original strain by utilizing the metabolic engineering, a key enzyme gene for L-lysine production in the metabolic process can be accurately found, and then the expression of the key enzyme gene is improved, so that the improvement of the L-lysine yield is possible.
L-glutamic acid is mainly used for producing monosodium glutamate, spice, and is used as a salt substitute, a nutritional supplement, a biochemical reagent and the like. L-glutamic acid can be used as medicine to participate in metabolism of protein and sugar in brain, promote oxidation process, and combine with ammonia in vivo to form nontoxic glutamine, reduce blood ammonia, and relieve hepatic coma symptom. In the past, the production of monosodium glutamate is mainly carried out by a wheat gluten (gluten) hydrolysis method, and the large-scale production is carried out by a microbial fermentation method instead.
Disclosure of Invention
The object of the present invention is to develop a novel strain having L-amino acid-producing ability, thereby providing a method for efficiently producing L-amino acids.
In order to achieve the above object, the inventors of the present invention have found through studies that the NCgl0609 gene having an ability to ferment amino acids, which was not known in the prior art, can have an efficient L-amino acid-producing ability by modifying the gene or improving the expression thereof. Based on these findings, the present invention has been completed.
The present invention provides a bacterium producing an L-amino acid, wherein expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 is improved. The present invention also provides a method for producing an L-amino acid by using the microorganism.
In a first aspect the invention provides a bacterium producing an L-amino acid, wherein the expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 is improved. According to the invention, the improved expression is an enhanced expression of the polynucleotide, or the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 has a point mutation and the expression is enhanced.
The amino acid sequence of SEQ ID NO. 3 is a protein encoded by a gene NCgl 0609.
The bacteria have enhanced L-amino acid production.
The bacterium having L-amino acid-producing ability may be a bacterium capable of accumulating the target L-amino acid in the medium in an amount of preferably 0.5g/L or more, more preferably 1.0g/L or more.
The polynucleotide may encode an amino acid sequence having about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence homology with the amino acid sequence of SEQ ID NO. 3.
Expression of the polynucleotide may be enhanced by: expression of the regulatory sequence by substitution or mutation, introduction of mutation into the polynucleotide sequence, increase in copy number of the polynucleotide by insertion through chromosome or vector introduction, or a combination thereof, and the like.
Expression regulatory sequences of the polynucleotides may be modified. Expression regulatory sequences control the expression of a polynucleotide to which they are operably linked and may include, for example, promoters, terminators, enhancers, silencers, and the like. The polynucleotide may have a change in the initiation codon. Polynucleotides may be incorporated into specific sites of the chromosome, thereby increasing copy number. Herein, a specific site may include, for example, a transposon site or an intergenic site. Alternatively, the polynucleotide may be incorporated into an expression vector, which is introduced into a host cell, thereby increasing the copy number.
In one embodiment of the invention, the copy number is increased by incorporating the polynucleotide or the polynucleotide with the point mutation into a specific site of the chromosome of the microorganism.
In one embodiment of the invention, the nucleic acid sequence is overexpressed by incorporating a polynucleotide with a promoter sequence or a polynucleotide with a point mutation with a promoter sequence into a specific site of the chromosome of the microorganism.
In one embodiment of the invention, the polynucleotide or polynucleotide having a point mutation is incorporated into an expression vector, which is introduced into a host cell, thereby increasing the copy number.
In one embodiment of the invention, the polynucleotide with the promoter sequence or the polynucleotide with the point mutation with the promoter sequence is incorporated into an expression vector, which is introduced into a host cell, thereby overexpressing the amino acid sequence.
In a specific embodiment of the invention, the polynucleotide whose expression is improved comprises the nucleotide sequence of SEQ ID NO. 1.
In one embodiment of the invention, the expression improvement means that the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 has a point mutation such that the arginine at position 334 of the amino acid sequence of SEQ ID NO. 3 is replaced with a terminator.
According to the invention, the amino acid sequence shown in SEQ ID NO. 3, wherein the amino acid sequence after the substitution of arginine at position 334 with a terminator is shown in SEQ ID NO. 4.
In one embodiment of the present invention, the polynucleotide sequence having a point mutation is formed by mutating base 1000 of the polynucleotide sequence shown in SEQ ID NO. 1.
According to the invention, the mutation comprises a mutation of the 1000 th base of the polynucleotide sequence shown in SEQ ID NO.1 from cytosine (C) to thymine (T).
In one embodiment of the invention, the polynucleotide sequence having a point mutation comprises the polynucleotide sequence shown in SEQ ID NO. 2.
As used herein, the term "operably linked" refers to a functional linkage between a regulatory sequence and a polynucleotide sequence whereby the regulatory sequence controls transcription and/or translation of the polynucleotide sequence. The regulatory sequence may be a strong promoter capable of increasing the expression level of the polynucleotide. The regulatory sequence may be a promoter derived from a microorganism belonging to the genus Corynebacterium or may be a promoter derived from other microorganisms. For example, the promoter may be a trc promoter, a gap promoter, a tac promoter, a T7 promoter, a lac promoter, a trp promoter, an araBAD promoter or a cj7 promoter.
In a specific embodiment of the invention, the promoter is a polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 (NCgl 0609 gene).
As used herein, the term "vector" refers to a polynucleotide construct containing regulatory sequences and gene sequences of a gene and configured to express a target gene in a suitable host cell. Alternatively, a vector may in turn refer to a polynucleotide construct containing sequences that can be used for homologous recombination, whereby due to the vector introduced into the host cell, the regulatory sequences of endogenous genes in the genome of the host cell can be altered, or the target gene that can be expressed can be inserted into a specific site in the genome of the host. In this regard, the vector used in the present invention may further comprise a selectable marker to determine the introduction of the vector into a host cell or the insertion of the vector into a chromosome of the host cell. The selectable marker may comprise a marker that confers a selectable phenotype, such as drug resistance, auxotrophy, resistance to a cytotoxic agent, or expression of a surface protein. In an environment treated with such a selection agent, transformed cells may be selected because only cells expressing the selection marker may survive or exhibit a different phenotypic trait.
In some embodiments of the invention, the vector used is the pK18mobsacB plasmid, the pXMJ19 plasmid.
According to the present invention, the bacterium may be a microorganism belonging to the genus Corynebacterium, such as Corynebacterium glutamicum (Corynebacterium glutamicum), brevibacterium flavum (Brevibacterium flavum), brevibacterium lactofermentum (Brevibacterium lactofermentum), corynebacterium ammoniagenes (Corynebacterium ammoniagenes), corynebacterium beijing (Corynebacterium pekinense).
In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum YP97158, accession number: CGMCC No.12856, date of preservation: 8 months and 16 days of 2016, preservation unit: china general microbiological culture Collection center, north Chen West Lu No.1, 3, telephone: 010-64807355.
In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum ATCC 13869.
According to the invention, the bacteria may also have other improvements relating to the increase of the L-amino acid production.
In a second aspect of the present invention, there is provided a polynucleotide sequence, an amino acid sequence encoded by the polynucleotide sequence, a recombinant vector comprising the polynucleotide sequence, and a recombinant strain comprising the polynucleotide sequence.
According to the invention, the polynucleotide sequence has improved expression, which improvement comprises a point mutation of the polynucleotide encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO. 3, such that the arginine at position 334 of the amino acid sequence is replaced by a terminator.
According to the invention, the amino acid sequence shown in SEQ ID NO. 3, wherein the amino acid sequence after the substitution of arginine at position 334 by a terminator is shown in SEQ ID NO. 4.
According to the invention, the polynucleotide sequence encoding the polypeptide comprising the amino acid sequence shown in SEQ ID NO. 3 comprises the polynucleotide sequence shown in SEQ ID NO. 1.
In one embodiment of the present invention, the mutated polynucleotide sequence provided by the present invention is formed by the mutation of the 1000 th base of the polynucleotide sequence shown in SEQ ID NO. 1.
According to the present invention, the mutation means that the base/nucleotide of the site is changed, and the mutation method may be at least one selected from the group consisting of mutagenesis, PCR site-directed mutagenesis, and/or homologous recombination. In the present invention, PCR site-directed mutagenesis and/or homologous recombination are preferably used.
According to the invention, the mutation comprises a mutation of the 1000 th base of the polynucleotide sequence shown in SEQ ID NO.1 from cytosine (C) to thymine (T).
In one embodiment of the invention, the mutated polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO. 2.
According to the invention, the substituted amino acid sequence comprises the amino acid sequence shown in SEQ ID NO. 4.
According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.
In one embodiment of the invention, the plasmid is a pK18mobsacB plasmid.
In another embodiment of the present invention, the plasmid is a pXMJ19 plasmid.
Specifically, the polynucleotide sequence and the plasmid may be constructed into a recombinant vector by a nebulider recombination system.
According to the invention, the recombinant strain contains the polynucleotide sequence.
As one embodiment of the present invention, the starting strain of the recombinant strain is YP97158.
As an embodiment of the present invention, the starting strain of the recombinant strain is ATCC 13869.
In a third aspect of the present invention, there is also provided a method for constructing a recombinant strain producing an L-amino acid.
According to the invention, the construction method comprises the following steps:
the polynucleotide sequence of wild NCgl0609 as shown in SEQ ID NO.1 in host strain is modified to mutate 1000 th base to obtain recombinant strain containing mutation NCgl0609 encoding gene.
According to the construction method of the present invention, the modification includes at least one of mutagenesis, PCR site-directed mutagenesis, and/or homologous recombination.
According to the construction method of the invention, the mutation refers to mutation of the 1000 th base from cytosine (C) to thymine (T) in SEQ ID NO. 1; specifically, the polynucleotide sequence of the gene encoding the mutant NCgl0609 is shown as SEQ ID NO. 2.
Further, the construction method comprises the following steps:
(1) Modifying the nucleotide sequence of a wild NCgl0609 gene shown in SEQ ID NO.1 to mutate the 1000 th base of the gene to obtain a mutated NCgl0609 gene polynucleotide sequence;
(2) Connecting the mutant polynucleic acid sequence with a plasmid to construct a recombinant vector;
(3) And introducing the recombinant vector into a host strain to obtain the recombinant strain containing the mutant NCgl0609 encoding gene.
According to the construction method of the present invention, the step (1) includes: construction of point mutated NCgl0609 gene: according to the genome sequence of the unmodified strain, two pairs of primers P1 and P2, P3 and P4 for amplifying NCgl0609 gene fragment are synthesized, and point mutation is introduced into wild NCgl0609 gene SEQ ID NO.1 by PCR site-directed mutagenesis to obtain the nucleotide sequence SEQ ID NO. 2 of the point mutated NCgl0609 gene, which is recorded as NCgl0609 C1000T 。
In one embodiment of the invention, the unmodified strain genome may be derived from ATCC13032 strain, the genomic sequence of which may be obtained from NCBI website.
In one embodiment of the present invention, in the step (1), the primer is:
P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGGACGGCAACGTACATAAC3'(SEQ ID NO:5)
P2:5'GTTGCCGGTGAGTCAAACAGTCATTTTGC 3'(SEQ ID NO:6)
P3:5'GCAAAATGACTGTTTGACTCACCGGCAAC 3'(SEQ ID NO:7)
P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCGGCTG GAAATGTGGAG3'(SE Q ID NO:8)
in one embodiment of the invention, the PCR amplification is performed as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 40s (30 cycles), and overextension at 72℃for 10min.
In one embodiment of the invention, the overlapping PCR amplification is performed as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 52℃for 30s, and extension at 72℃for 60s (30 cycles), over-extension at 72℃for 10min.
According to the construction method of the present invention, the step (2) includes construction of a recombinant plasmid, comprising: separating and purifying NCgl0609 C1000T And pK18mobsacB plasmid, assembled by NEBuider recombination system to obtain recombinant plasmid.
According to the construction method of the present invention, the step (3) includes construction of a recombinant strain, and the recombinant plasmid is transformed into a host strain to obtain the recombinant strain.
In one embodiment of the invention, the conversion of step (3) is an electroconversion process.
In one embodiment of the invention, the host strain is YP97158.
In one embodiment of the invention, the recombination is achieved by homologous recombination.
In a fourth aspect of the present invention, there is also provided a method for constructing a recombinant strain producing an L-amino acid.
According to the invention, the construction method comprises the following steps:
amplifying the upstream and downstream homology arm fragments of the NCgl0609 gene, the coding region of the NCgl0609 gene and the promoter region sequence thereof, or amplifying NCgl0609 or NCgl0609 R334* The gene coding region and its promoter region sequence are then introduced into the genome of host strain by means of homologous recombination to form NCgl0609 or NCgl0609 R334* Genes to obtain the strain over-expressed NCgl0609 or NCgl0609 R334* And (3) a gene.
In one embodiment of the invention, the primers for amplifying the upstream homology arm fragment are:
P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTG GACTGAGG3'(SEQ ID NO:11)
P8:5'GAGATGATCCTCGCAGCTGGTGCACCGAGAACAGATG 3'(SEQ ID NO:12)
in one embodiment of the invention, the primers for amplifying the downstream homology arm fragment are:
P11:5'GGTCAAGGAAGGAGTTGTTGCCAGAATCAGATGGCGCAATTA AATC AAG 3'(SEQ ID NO:15)
P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGAC ACCTTCAACGGATC 3'(SEQ ID NO:16)
in one embodiment of the invention, the primers for amplifying the sequences of the coding region and the promoter region of the gene are:
P9:5'CATCTGTTCTCGGTGCACCAGCTGCGAGGATCATCTC 3'(SEQ ID NO:13)
P10:5'GATTTAATTGCGCCATCTGATTCTGGCAACAACTCCTTCCTTGACC 3'(SEQ ID NO:14)。
in one embodiment of the present invention, the aforementioned P7-P12 is used as a primer to amplify the obtained upstream homologous fragment, downstream homologous fragment and NCgl0609 or NCgl0609 with self-promoter R334* And (3) mixing the three fragments as templates for amplification to obtain the integrated homologous arm fragments.
In one embodiment of the invention, a PCR system is used: 10 xEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg 2+ (25 mM) 4. Mu.L, 2. Mu.L each of primer (10 pM), 0.25. Mu.L of Ex Taq (5U/. Mu.L), and a total volume of 50. Mu.L; PCR amplification was performed as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 60s (30 cycles), and overextension at 72℃for 10min.
In one embodiment of the invention, the shuttle plasmid PK18mobsacB and the upper and lower homology arm fragments, the gene coding region and the promoter region fragment are assembled by using NEBuider recombination system to obtain the integrated plasmid.
In one embodiment of the invention, the host strain is transfected with the integrative plasmid and NCgl0609 or NCgl0609 is introduced into the genome of the host strain in a homologous recombination manner R334* And (3) a gene.
In one embodiment of the invention, the host strain is YP97158.
In one embodiment of the invention, the host strain is a strain carrying the polynucleotide sequence shown in SEQ ID NO. 2.
In a fifth aspect of the present invention, there is also provided a method for constructing a recombinant strain producing an L-amino acid.
According to the invention, the construction method comprises the following steps:
amplifying NCgl0609 gene coding region and promoter region sequence, or NCgl0609 R334* The gene coding region and promoter region sequence, constructing an over-expression plasmid vector, and transferring the vector into a host strain to realize the over-expression of NCgl0609 or NCgl0609 by the strain R334* And (3) a gene.
In one embodiment of the invention, the primers for amplifying the sequences of the coding region and the promoter region of the gene are:
P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCAGCTGCGAGG A TCATCTC3'(SEQ ID NO:21)
P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACCAACAACTCCTTCCTTGACC3'(SEQ ID NO:22)
in one embodiment of the invention, the PCR system: 10 xEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg 2+ (25 mM) 4. Mu.L, 2. Mu.L each of primer (10 pM), 0.25. Mu.L of Ex Taq (5U/. Mu.L), and a total volume of 50. Mu.L; the PCR amplification was performed as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 60s (30 cycles), and overextension at 72℃for 10min.
In one embodiment of the invention, the shuttle plasmid pXMJ19 and NCgl0609 with its own promoter are used in the NEBuider recombination system R334* And assembling fragments to obtain the over-expression plasmid.
In one embodiment of the invention, the host strain is YP97158.
In one embodiment of the invention, the host strain is ATCC 13869.
In one embodiment of the invention, the host strain is a strain carrying the polynucleotide sequence shown in SEQ ID NO. 2.
The recombinant strain obtained by the invention can be independently applied to fermentation production of L-amino acid, and can also be mixed with other bacteria producing L-amino acid for fermentation production of L-amino acid.
In another aspect, the invention provides a method for producing an L-amino acid, comprising culturing the bacterium; and obtaining the L-amino acid from the culture.
The cultivation of the bacteria may be performed in a suitable medium under cultivation conditions known in the art. The medium may comprise: carbon source, nitrogen source, trace elements, and combinations thereof. During the culture, the pH of the culture may be adjusted. In addition, the culture may include prevention of bubble generation, for example, by using an antifoaming agent. In addition, the culturing may include injecting a gas into the culture. The gas may comprise any gas capable of maintaining aerobic conditions of the culture. In the cultivation, the temperature of the culture may be 20 to 45 ℃. The resulting L-amino acid may be recovered from the culture, i.e., the culture may be treated with sulfuric acid or hydrochloric acid or the like, followed by a combination of methods such as anion exchange chromatography, concentration, crystallization and isoelectric precipitation.
Definition of terms:
in the present invention, the term "bacterium having L-amino acid-producing ability" refers to a bacterium having an ability to produce and accumulate an L-amino acid of interest in a medium and/or cells of the bacterium to such an extent that the bacterium can collect the L-amino acid-producing bacterium when the bacterium is cultured in the medium. The bacterium having L-amino acid-producing ability may be a bacterium capable of accumulating the desired L-amino acid in a larger amount than that obtainable by the unmodified strain in the medium and/or cells of the bacterium.
Examples of the L-amino acid include basic amino acids such as L-lysine, L-ornithine, L-arginine, L-histidine and L-citrulline; aliphatic amino acids such as L-isoleucine, L-alanine, L-valine, L-leucine and glycine; amino acids as hydroxy-mono-amino carboxylic acids, such as L-threonine and L-serine; cyclic amino acids such as L-proline; aromatic amino acids such as L-phenylalanine, L-tyrosine and L-tryptophan; sulfur-containing amino acids such as L-cysteine, L-cystine and L-methionine; acidic amino acids such as L-glutamic acid and L-aspartic acid; and amino acids having amide groups in the side chains, such as L-glutamine and L-asparagine.
Specific examples of the L-amino acid include L-glutamic acid, L-lysine, L-threonine, L-arginine, L-histidine, L-isoleucine, L-valine, L-leucine, L-phenylalanine, L-tyrosine, L-tryptophan and L-cysteine.
More specific examples of the L-amino acid include L-glutamic acid, L-lysine, L-threonine and L-tryptophan. More specific examples of the L-amino acid include L-glutamic acid, L-lysine.
In the present invention, the term "amino acid" means an L-amino acid unless otherwise specified. In the present invention, the term "L-amino acid" refers to an L-amino acid in free form, a salt thereof, or a mixture thereof, unless otherwise specified.
The term "unmodified strain" refers to a control strain that has not been modified in such a way as to have specific characteristics. That is, examples of unmodified strains include wild-type strains and parent strains.
The term "homology" refers to the percent identity between two polynucleotides or two polypeptide modules. Sequence homology between one module and another can be determined by using methods known in the art. Such sequence homology can be determined, for example, by the BLAST algorithm.
The term "operably linked" refers to a functional linkage between a regulatory sequence and a polynucleotide sequence whereby the regulatory sequence controls transcription and/or translation of the polynucleotide sequence. The regulatory sequence may be a strong promoter capable of increasing the expression level of the polynucleotide. The regulatory sequence may be a promoter derived from a microorganism belonging to the genus Corynebacterium or may be a promoter derived from other microorganisms. For example, the promoter may be a trc promoter, a gap promoter, a tac promoter, a T7 promoter, a lac promoter, a trp promoter, an araBAD promoter or a cj7 promoter.
The term "vector" refers to a polynucleotide construct containing regulatory sequences and gene sequences of a gene and configured to express a target gene in a suitable host cell. Alternatively, a vector may in turn refer to a polynucleotide construct containing sequences that can be used for homologous recombination, whereby due to the vector introduced into the host cell, the regulatory sequences of endogenous genes in the genome of the host cell can be altered, or the target gene that can be expressed can be inserted into a specific site in the genome of the host. In this regard, the vector used in the present invention may further comprise a selectable marker to determine the introduction of the vector into a host cell or the insertion of the vector into a chromosome of the host cell. The selectable marker may comprise a marker that confers a selectable phenotype, such as drug resistance, auxotrophy, resistance to a cytotoxic agent, or expression of a surface protein. In an environment treated with such a selection agent, transformed cells may be selected because only cells expressing the selection marker may survive or exhibit a different phenotypic trait.
As used herein, the term "transformation" refers to the introduction of a polynucleotide into a host cell such that the polynucleotide can replicate as an extragenomic element or as inserted into the genome of the host cell. Methods of transforming vectors used in the present invention may include methods of introducing nucleic acids into cells. In addition, as disclosed in the related art, the electric pulse method may be performed according to host cells.
Advantageous effects
According to the invention, the NCgl0609 gene is weakened or knocked out, so that the influence of the product coded by the gene on the amino acid production capacity is found, the recombinant strain is obtained by introducing point mutation into a coding sequence or increasing the copy number or over-expression of the gene, and compared with a wild strain, the obtained strain is favorable for producing high-concentration amino acid.
Detailed Description
The technical scheme of the invention will be further described in detail below with reference to specific embodiments. It is to be understood that the following examples are illustrative only and are not to be construed as limiting the scope of the invention. All techniques implemented based on the above description of the invention are intended to be included within the scope of the invention. Unless otherwise indicated, the starting materials and reagents used in the following examples were either commercially available or may be prepared by known methods; the operations performed are known in the art or are performed according to a user manual of a commercially available commodity.
The following examples were conducted using the same basic medium composition to which sucrose, kanamycin, chloramphenicol, etc. were added as needed, as follows:
composition of the components Formulation of
Sucrose 10g/L
Polypeptone 10g/L
Beef extract 10g/L
Yeast powder 5g/L
Urea 2g/L
Sodium chloride 2.5g/L
Agar powder 20g/L
pH 7.0
Culture temperature 32℃
EXAMPLE 1 construction of transformation vector pk18-NCgl0609 comprising the coding region of the point mutated NCgl0609 gene R334*
Two pairs of primers for amplifying the sequence of the coding region of NCgl0609 gene were designed and synthesized according to the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, in the form of allelic substitution in strain YP97158 [ accession No.: CGMCC No.12856, date of preservation: 8 months and 16 days of 2016, preservation unit: the institute of microbiology, beijing, the Chaoyang district, north Chen West Lu 1, 3, telephone: 010-64807355, described in Chinese patent application CN106367432A (application date 2016, 9, 1, 2017, 2, 1) the NCgl0609 gene coding region (SEQ ID NO:1, corresponding to the amino acid sequence of the encoded protein is SEQ ID NO: 3), was introduced with point mutation, the 1000 th C of the nucleotide sequence of NCgl0609 gene was changed to T (SEQ ID NO: 2), the 334 th arginine of the amino acid sequence of the corresponding encoded protein was changed to terminator (SEQ ID NO:4:NCgl 0609) R334* ). Primers were designed as follows (synthesized by the company epivitrogen, shanghai):
P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGGACGGCAACGTACATAAC3'(SEQ ID NO:5)
P2:5'GTTGCCGGTGAGTCAAACAGTCATTTTGC 3'(SEQ ID NO:6)
P3:5'GCAAAATGACTGTTTGACTCACCGGCAAC 3'(SEQ ID NO:7)
P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCGGCTG GAAATGTGGAG3'(SEQ ID NO:8)
the construction method comprises the following steps: the Corynebacterium glutamicum ATCC13032 is used as a template, and primers P1 and P2, P3 and P4 are used for PCR amplification, and a PCR system is adopted: 10 xEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg 2+ (25 mM) 4. Mu.L each of primer (10 pM) 2. Mu.L, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L, the PCR amplification was performed as follows: pre-denaturation at 94℃for 5min, (denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 40s,30 cycles), over-extension at 72℃for 10min,two DNA fragments (NCgl 0609 Up and NCgl0609 Down) having 698bp and 648bp, respectively, and containing the coding region of the NCgl0609 gene were obtained. Separating and purifying the two DNA fragments by agarose gel electrophoresis, and amplifying the fragment which is 1317bp by using the two DNA fragments as templates and using P1 and P4 as primers through overlay PCR.
PCR system: 10 xEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg 2+ (25 mM) 4. Mu.L each of primer (10 pM) 2. Mu.L, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L, the PCR amplification was performed as follows: pre-denatured at 94℃for 5min, (denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 60s,30 cycles), and overextension at 72℃for 10min. This DNA fragment resulted in the conversion of cytosine (C) at position 1000 of the coding region of the YP97158 NCgl0609 gene to thymine (T), and finally the conversion of amino acid 334 of the encoded protein from arginine (R) to a terminator. The DNA fragment was subjected to agarose gel electrophoresis and then purified, and then ligated with the pK18mobsacB plasmid (purchased from Addgene, xbal/BamH I double digestion, respectively) purified by double digestion with NEBuilder enzyme (purchased from NEB) at 50℃for 30min, and the monoclonal obtained after transformation of the ligation product was identified by pcr to obtain the positive vector pK18-NCgl0609 R334* The plasmid contained a kanamycin resistance marker. The correct vector pk18-NCgl0609 is digested R334* Sequencing was carried out by the sequencing company and the vector pk18-NCgl0609 containing the correct point mutation (C-T) was identified R334* And (5) storing for standby.
Example 2 construction of NCgl0609 containing point mutations R334* Is an engineered strain of (2)
The construction method comprises the following steps: the allelic replacement plasmid pk18-NCgl0609 R334* The single bacterial colony generated by the culture is identified by a primer P1 and a universal primer M13R respectively, and the bacterial strain with 1375bp size strip can be amplified as a positive bacterial strain. Culturing positive strain on 15% sucrose-containing medium, culturing single colony on kanamycin-containing medium and kanamycin-free medium, respectively, and culturing single colony on kanamycin-free mediumStrains grown on medium containing plain, but not grown on medium containing kanamycin, were further identified by PCR using the following primers (synthesized by Shanghai in vitro).
P5:5'CTAGCCGGTTCCAGTCAG 3'(SEQ ID NO:9)
P6:5'GGACGTCTGTTCACCATTG 3'(SEQ ID NO:10)
The 264bp PCR amplified product was denatured at a high temperature of 95℃for 10min and ice-bath for 5min, followed by sscp electrophoresis (plasmid pk18-NCgl0609 R334* The amplified fragment is a positive control, the YP97158 amplified fragment is a negative control, water is used as a blank control), and the electrophoresis positions are different due to different fragment structures, so that the strain with the fragment electrophoresis positions inconsistent with the position of the negative control fragment and consistent with the position of the positive control fragment is the strain with successful allelic replacement. The positive strain NCgl0609 fragment was amplified again by primer P5/P6 PCR and ligated to PMD19-T vector for sequencing, and the strain with mutation (C-T) in the base sequence was the positive strain with successful allelic replacement by sequence alignment and named YPL-4-041.
Preparation and conditions of SSCP electrophoresis PAGE
Example 3 construction of genomic overexpression of NCgl0609 and NCgl0609 R334* Genetically engineered strains
Three pairs of amplified upstream and downstream homology arm fragments, NCgl0609 or NCgl0609, were designed and synthesized based on the genomic sequence of wild Corynebacterium glutamicum ATCC13032 published by NCBI R334* Primers for coding region and promoter region sequences of the genes are introduced into strain YP97158 in a homologous recombination mode to form NCgl0609 or NCgl0609 R334* And (3) a gene.
Primers were designed as follows (synthesized by the company epivitrogen, shanghai):
P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTG GACTGAGG3'(SEQ ID NO:11)
P8:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTG GACTGAGG3'(SEQ ID NO:12)
P9:5'CATCTGTTCTCGGTGCACCAGCTGCGAGGATCATCTC 3'(SEQ ID NO:13)
P10:5'GATTTAATTGCGCCATCTGATTCTGGCAACAACTCCTTCCTTGACC 3'(SEQ ID NO:14)
P11:5'GGTCAAGGAAGGAGTTGTTGCCAGAATCAGATGGCGCAATTA AATC AAG 3'(SEQ ID NO:15)
P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGACACCTTCAACGGATC 3'(SEQ ID NO:16)
the construction method comprises the following steps: the upstream homology arm fragment 768bp, NCgl0609 or NCgl0609 is obtained by PCR amplification with Corynebacterium glutamicum ATCC13032 or YPL-4-041 as template and with primers P7/P8, P9/P10, P11/P12, respectively R334* Gene and its promoter fragment 1626bp and downstream homology arm fragment 623bp. After the PCR reaction is finished, the amplified 3 fragments are respectively subjected to electrophoresis recovery by adopting a column type DNA gel recovery kit. The 3 fragments recovered were ligated with the pK18mobsacB plasmid purified after double digestion (purchased from Addgene, respectively Xbal/BamH I double digestion) with NEBuilder enzyme (purchased from NEB) at 50℃for 30min, and the resultant single clone was transformed and the resultant single clone was identified by pcr to obtain a positive integrative plasmid. The plasmid contains a kanamycin resistance marker, and recombinants with plasmid integration into the genome can be obtained by kanamycin selection.
PCR system: 10 XEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg2+ (25 mM) 4. Mu.L, primer (10 pM) 2. Mu.L each, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L. The PCR amplification was performed as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 60s (30 cycles), and overextension at 72℃for 10min. The integrated plasmid with correct sequence is electrically transformed into an L-lysine producing strain YP97158, single colony generated by culture is identified by PCR through a P13/P14 primer, the PCR is amplified to obtain a positive strain containing a fragment with the size of 1317bp, and the fragment is not amplified to obtain primordium. Culturing positive strain on 15% sucrose-containing culture medium, further performing PCR identification on single colony generated by culture by using P15/P16 primer, and amplifying to obtain 1352bp strain NCgl0609 or NCgl0609 R334* Positive strain with gene integration into YP97158 genome, designated YPL-4042 (without mutation points) and YPL-4-043 (with mutation points).
P13:5'TCCAAGGAAGATACACGCC 3'(SEQ ID NO:17)
P14:5'CGAAATGGAAGTTGTGCG 3'(SEQ ID NO:18)
P15:5'CGATGATGCCGATTACCTC 3'(SEQ ID NO:19)
P16:5'CGTTGGAATCTTGCGTTG 3'(SEQ ID NO:20)
Example 4 construction of plasmid over-expression of NCgl0609 or NCgl0609 R334* Genetically engineered strains
A pair of amplified NCgl0609 or NCgl0609 was designed and synthesized based on the genomic sequence of wild Corynebacterium glutamicum ATCC13032 published by NCBI R334* Primers for the sequences of the coding region and the promoter region of the gene were designed as follows (synthesized by Shanghai Invitrogen):
P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCAGCTGCGAGG A TCATCTC3'(SEQ ID NO:21)
P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACCAACAACTCCTTCCTTGACC3'(SEQ ID NO:22)
the construction method comprises the following steps: PCR amplification was performed with primers P17/P18 using Corynebacterium glutamicum ATCC13032 and YPL-4-041 as templates, respectively, to obtain NCgl0609 and NCgl0609 R334* The gene and its promoter fragment 1582bp, the amplified product is electrophoresed and purified by column type DNA gel recovery kit, the recovered DNA fragment is connected with shuttle plasmid pXMJ19 recovered by EcoR I enzyme digestion by NEBuilder enzyme (purchased to NEB company) at 50 ℃ for 30min, the monoclonal grown after conversion of the connection product is identified by pcr by M13 primer to obtain positive over-expression plasmids pXMJ19-NCgl0609 and pXMJ19-NCgl0609 R334* The plasmid was sequenced. Since the plasmid contains a chloramphenicol resistance marker, it is possible to select whether the plasmid is transformed into a strain by chloramphenicol.
PCR system: 10 XEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg2+ (25 mM) 4. Mu.L, primer (10 pM) 2. Mu.L each, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L.
The PCR amplification was performed as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 60s (30 cycles), and overextension at 72℃for 10min.
Correct pXMJ19-NCgl0609 and pXMJ19-NCgl0609 will be sequenced R334* The plasmids were respectively electrotransformed into the L-lysine-producing strain YP97158, and single colonies produced by the culture were identified by PCR using the primer M13F/P18, and positive strains containing a 1585bp fragment, designated YPL-4-044 (without the mutation point) and YPL-4-045 (with the mutation point), were amplified by PCR.
EXAMPLE 5 construction of an engineering Strain with the NCgl0609 Gene deleted on the genome
Two pairs of primers for amplifying fragments at both ends of the coding region of NCgl0609 gene were synthesized as upstream and downstream homology arm fragments according to the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI. The primers were designed as follows (synthesized by the company jejun, shanghai): p19:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGAA TGG GATGGGTCG3'(SEQ ID NO:23)
P20:5'CATCATCGGTTACTCTGGCCGAAATGGAAGTTGTGCG 3'(SEQ ID NO:24)
P21:5'CGCACAACTTCCATTTCGGCCAGAGTAACCGATGATG 3'(SEQ ID NO:25)
P22:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCAACAACTCCTTCCTTGACC3'(SEQ ID NO:26)
The construction method comprises the following steps: the Corynebacterium glutamicum ATCC13032 is used as a template, and primers P19/P20 and P21/P22 are used for PCR amplification to obtain an upstream homology arm fragment 661bp and a downstream homology arm fragment 692bp. Then, the primer P19/P22 is used for carrying out OVERLAP PCR to obtain the 1334bp of the whole homologous arm fragment. The amplified product was electrophoresed and purified using column type DNA gel recovery kit, the recovered DNA fragment was ligated with pK18mobsacB plasmid (purchased to Addgene, respectively digested with Xbal I/BamH I) purified by double digestion at 50℃for 30min with NEBuilder enzyme (purchased to NEB), and the resultant monoclonal after conversion was subjected to pcr identification with M13 primer to obtain positive knockout vector pK 18-. DELTA.NCgl 0609, which was sequenced. The plasmid contained kanamycin resistance as a selectable marker.
PCR system: 10 XEx Taq Buffer 5. Mu.L, dNTP mix (2.5 mM each) 4. Mu.L, mg2+ (25 mM) 4. Mu.L, primer (10 pM) 2. Mu.L each, ex Taq (5U/. Mu.L) 0.25. Mu.L, and total volume 50. Mu.L.
The PCR amplification was performed as follows: pre-denaturation at 94℃for 5min, denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 90s (30 cycles), and overextension at 72℃for 10min.
The correctly sequenced knockout plasmid pK 18-. DELTA.NCgl 0609 was electrotransformed into the lysine-producing proprietary strain YP97158 (see WO2014121669A1 for construction; sequencing confirmed that the strain has the wild-type NCgl0609 gene remaining on its chromosome), and single colonies generated by the culture were PCR-identified by the following primers (Shanghai Yingjun Co., ltd.):
P23:5'AATGAATGG GATGGGTCG 3'(SEQ ID NO:27)
P24:5'CAACAACT CCT TCCTTGACC 3'(SEQ ID NO:28)
the PCR amplified strain with 1334bp and 1788bp bands is positive strain, and only the strain with 1788bp band is original strain. Positive strains were screened on 15% sucrose medium, cultured on kanamycin-containing medium and kanamycin-free medium, grown on kanamycin-free medium, and the strains not grown on kanamycin-containing medium were further identified by PCR using P23/P24 primers, and the strain amplified to 1334bp band was a positive strain in which the NCgl0609 gene coding region was knocked out. The positive strain NCgl0609 fragment was amplified again by PCR with P23/P24 primers and ligated into the PMD19-T vector for sequencing, the correctly sequenced strain was designated YPL-4-046.
Example 6L lysine fermentation experiment
The strains constructed in the examples and the original strain YP97158 were subjected to fermentation experiments in a BLBIO-5GC-4-H type fermenter (available from Shanghai Biotech Co., ltd.) with the culture media shown in Table 1 and the control process shown in Table 2. Each strain was repeated three times and the results are shown in table 3.
TABLE 1 fermentation Medium formulation
Composition of the components Formulation of
Starch hydrolyzing sugar 30g/L
Ammonium sulfate 12g/L
Magnesium sulfate 0.87g/L
Molasses 20g/L
Acidified corn steep liquor 3mL/L
Phosphoric acid 0.4mL/L
Potassium chloride 0.53g/L
Defoaming agent (2% bubble enemy) 4mL/L
Ferrous sulfate 120mg/L
Manganese sulfate 120mg/L
Nicotinamide 42mg/L
Calcium pantothenate 6.3mg/L
Vitamin B1 6.3mg/L
Copper and zinc salt solution 0.6g/L
Biotin 0.88mg/L
TABLE 1 fermentation control process
TABLE 2L-lysine fermentation test results
Strain L-lysine production (g/100 ml) OD(660nm)
YP97158 18.9 37.3
YPL-4-041 19.3 38.1
YPL-4-042 19.2 37.8
YPL-4-043 19.5 38.4
YPL-4-044 19.4 37.7
YPL-4-045 19.7 38.3
YPL-4-046 18.0 36.8
As a result, as shown in Table 3, the NCgl0609 gene-encoding region was subjected to point mutation in Corynebacterium glutamicum R334* And over-expression is beneficial to the improvement of the yield and the growth rate of the L-lysine, and weakening or knocking out genes is not beneficial to the accumulation of the L-lysine, and meanwhile, the growth rate of the strain is reduced.
Example 7 introduction of overexpression of the NCgl0609 Gene in glutamic acid-producing Strain or Point mutation of the coding region of the NCgl0609 Gene NCgl0609 R334* And over-expressing and performing fermentation experiment
NCgl0609 containing point mutation was obtained by the same method as in examples 1-5 using the same primers and experimental conditions and using Corynebacterium ATCC13869 as starting strain and using ATCC13869 strain as expression strain R334* Glutamic acid-producing engineering strain of (2), genome over-expression of NCgl0609 and NCgl0609 R334* Glutamic acid production engineering strain of gene and over-expression of NCgl0609 and NCgl0609 on plasmid R334* Glutamic acid-producing engineering strain of gene, and NCgl060 deleted on genome9 glutamic acid production engineering strain of gene.
The strains constructed in the examples and the original strains were subjected to fermentation experiments using the strains of ATCC13869 as expression bacteria in a BLBIO-5GC-4-H type fermenter (available from Shanghai Biotech Co., ltd.) with the culture media shown in Table 4 and the control process shown in Table 5. Each strain was repeated three times and the results are shown in table 6.
TABLE 4 fermentation Medium formulation
Reagent name Proportioning of
Glucose 5.0g/L
Phosphoric acid 0.38g/L
Magnesium sulfate 1.85g/L
Potassium chloride 1.6g/L
Biotin 550μg/L
Vitamin B1 300μg/L
Ferrous sulfate 10mg/L
Manganese sulfate 10g/dl
KH2PO4 2.8g/L
Vitamin C 0.75mg/L
Vitamin B12 2.5μg/L
Para aminobenzoic acid 0.75mg/L
Defoaming agent 0.0015ml/dl
Betaine (betaine) 1.5g/L
Sugar cane molasses 7ml/L
Corn steep liquor 77ml/L
Aspartic acid 1.7g/L
Mao Fafen 2g/L
TABLE 5 fermentation control process
TABLE 6L results of glutamic acid fermentation experiments
Strain L-glutamic acid production (g/L) OD(660nm)
ATCC13869 101.0 42.3
YPG-013 103.5 43.4
YPG-014 103.9 42.8
YPG-015 103.2 43.7
YPG-016 103.6 42.6
YPG-017 103.8 43.6
YPG-018 98.5 40.5
As a result, as shown in Table 6, the NCgl0609 gene-encoding region was subjected to point mutation in Corynebacterium glutamicum R334* And over-expression is beneficial to the improvement of the yield and the growth rate of the L-glutamic acid, and weakening or knocking out genes is not beneficial to the accumulation of the L-glutamic acid, and meanwhile, the growth rate of the strain is reduced.
The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> inner Mongolian Italian biotechnology Co., ltd
<120> a recombinant strain producing L-amino acid, construction method and application thereof
<130> CPCN20111191
<160> 28
<170> PatentIn version 3.3
<210> 1
<211> 1083
<212> DNA
<213> Corynebacterium glutamicum
<400> 1
gtgtcacaca ccgcgtccac accgacgcca gaggaatact ccgcgcagca acccagcacc 60
cagggcactc gcgttgagtt ccgcggcata accaaagtct ttagcaacaa taaatctgct 120
aaaaccaccg cgcttgataa tgtcactctc accgtagaac ccggtgaggt aatcggcatc 180
atcggttact ctggcgccgg caagtccact cttgtccgcc tcatcaatgg ccttgactcc 240
cccacgagcg gttcgttgct gctcaacggc accgacatcg tcggaatgcc cgagtctaag 300
ctgcgtaaac tgcgcagtaa tatcggcatg attttccagc agttcaacct gttccagtcg 360
cgtactgcgg ctggaaatgt ggagtacccg ctggaagttg ccaagatgga caaggcagct 420
cgtaaagctc gcgtgcaaga aatgctcgag ttcgtcggcc tgggcgacaa aggcaaaaac 480
taccccgagc agctgtcggg cggccagaag cagcgcgtcg gcattgcccg tgcactggcc 540
accaatccaa cgcttttgct tgccgacgaa gccacctccg ctttggaccc agaaaccacc 600
catgaagttc tggagctgct gcgcaaggta aaccgcgaac tgggcatcac catcgttgtg 660
atcacccacg aaatggaagt tgtgcgttcc atcgcagaca aggttgctgt gatggaatcc 720
ggcaaagttg tggaatacgg cagcgtctac gaggtgttct ccaatccaca aacacaggtt 780
gctcaaaagt tcgtggccac cgcgctgcgt aacaccccag accaagtgga atcggaagat 840
ctgcttagcc atgagggacg tctgttcacc attgatctga ctgaaacgtc cggcttcttt 900
gcagcaaccg ctcgtgctgc cgaacaaggt gcttttgtca acatcgttca cggtggcgtg 960
accaccttgc aacgccaatc atttggcaaa atgactgttc gactcaccgg caacaccgct 1020
gcgattgaag agttctatca aaccttgacc aagaccacga ccatcaagga gatcacccga 1080
tga 1083
<210> 2
<211> 1083
<212> DNA
<213> artificial sequence
<400> 2
gtgtcacaca ccgcgtccac accgacgcca gaggaatact ccgcgcagca acccagcacc 60
cagggcactc gcgttgagtt ccgcggcata accaaagtct ttagcaacaa taaatctgct 120
aaaaccaccg cgcttgataa tgtcactctc accgtagaac ccggtgaggt aatcggcatc 180
atcggttact ctggcgccgg caagtccact cttgtccgcc tcatcaatgg ccttgactcc 240
cccacgagcg gttcgttgct gctcaacggc accgacatcg tcggaatgcc cgagtctaag 300
ctgcgtaaac tgcgcagtaa tatcggcatg attttccagc agttcaacct gttccagtcg 360
cgtactgcgg ctggaaatgt ggagtacccg ctggaagttg ccaagatgga caaggcagct 420
cgtaaagctc gcgtgcaaga aatgctcgag ttcgtcggcc tgggcgacaa aggcaaaaac 480
taccccgagc agctgtcggg cggccagaag cagcgcgtcg gcattgcccg tgcactggcc 540
accaatccaa cgcttttgct tgccgacgaa gccacctccg ctttggaccc agaaaccacc 600
catgaagttc tggagctgct gcgcaaggta aaccgcgaac tgggcatcac catcgttgtg 660
atcacccacg aaatggaagt tgtgcgttcc atcgcagaca aggttgctgt gatggaatcc 720
ggcaaagttg tggaatacgg cagcgtctac gaggtgttct ccaatccaca aacacaggtt 780
gctcaaaagt tcgtggccac cgcgctgcgt aacaccccag accaagtgga atcggaagat 840
ctgcttagcc atgagggacg tctgttcacc attgatctga ctgaaacgtc cggcttcttt 900
gcagcaaccg ctcgtgctgc cgaacaaggt gcttttgtca acatcgttca cggtggcgtg 960
accaccttgc aacgccaatc atttggcaaa atgactgttt gactcaccgg caacaccgct 1020
gcgattgaag agttctatca aaccttgacc aagaccacga ccatcaagga gatcacccga 1080
tga 1083
<210> 3
<211> 360
<212> PRT
<213> Corynebacterium glutamicum
<400> 3
Met Ser His Thr Ala Ser Thr Pro Thr Pro Glu Glu Tyr Ser Ala Gln
1 5 10 15
Gln Pro Ser Thr Gln Gly Thr Arg Val Glu Phe Arg Gly Ile Thr Lys
20 25 30
Val Phe Ser Asn Asn Lys Ser Ala Lys Thr Thr Ala Leu Asp Asn Val
35 40 45
Thr Leu Thr Val Glu Pro Gly Glu Val Ile Gly Ile Ile Gly Tyr Ser
50 55 60
Gly Ala Gly Lys Ser Thr Leu Val Arg Leu Ile Asn Gly Leu Asp Ser
65 70 75 80
Pro Thr Ser Gly Ser Leu Leu Leu Asn Gly Thr Asp Ile Val Gly Met
85 90 95
Pro Glu Ser Lys Leu Arg Lys Leu Arg Ser Asn Ile Gly Met Ile Phe
100 105 110
Gln Gln Phe Asn Leu Phe Gln Ser Arg Thr Ala Ala Gly Asn Val Glu
115 120 125
Tyr Pro Leu Glu Val Ala Lys Met Asp Lys Ala Ala Arg Lys Ala Arg
130 135 140
Val Gln Glu Met Leu Glu Phe Val Gly Leu Gly Asp Lys Gly Lys Asn
145 150 155 160
Tyr Pro Glu Gln Leu Ser Gly Gly Gln Lys Gln Arg Val Gly Ile Ala
165 170 175
Arg Ala Leu Ala Thr Asn Pro Thr Leu Leu Leu Ala Asp Glu Ala Thr
180 185 190
Ser Ala Leu Asp Pro Glu Thr Thr His Glu Val Leu Glu Leu Leu Arg
195 200 205
Lys Val Asn Arg Glu Leu Gly Ile Thr Ile Val Val Ile Thr His Glu
210 215 220
Met Glu Val Val Arg Ser Ile Ala Asp Lys Val Ala Val Met Glu Ser
225 230 235 240
Gly Lys Val Val Glu Tyr Gly Ser Val Tyr Glu Val Phe Ser Asn Pro
245 250 255
Gln Thr Gln Val Ala Gln Lys Phe Val Ala Thr Ala Leu Arg Asn Thr
260 265 270
Pro Asp Gln Val Glu Ser Glu Asp Leu Leu Ser His Glu Gly Arg Leu
275 280 285
Phe Thr Ile Asp Leu Thr Glu Thr Ser Gly Phe Phe Ala Ala Thr Ala
290 295 300
Arg Ala Ala Glu Gln Gly Ala Phe Val Asn Ile Val His Gly Gly Val
305 310 315 320
Thr Thr Leu Gln Arg Gln Ser Phe Gly Lys Met Thr Val Arg Leu Thr
325 330 335
Gly Asn Thr Ala Ala Ile Glu Glu Phe Tyr Gln Thr Leu Thr Lys Thr
340 345 350
Thr Thr Ile Lys Glu Ile Thr Arg
355 360
<210> 4
<211> 359
<212> PRT
<213> artificial sequence
<400> 4
Met Ser His Thr Ala Ser Thr Pro Thr Pro Glu Glu Tyr Ser Ala Gln
1 5 10 15
Gln Pro Ser Thr Gln Gly Thr Arg Val Glu Phe Arg Gly Ile Thr Lys
20 25 30
Val Phe Ser Asn Asn Lys Ser Ala Lys Thr Thr Ala Leu Asp Asn Val
35 40 45
Thr Leu Thr Val Glu Pro Gly Glu Val Ile Gly Ile Ile Gly Tyr Ser
50 55 60
Gly Ala Gly Lys Ser Thr Leu Val Arg Leu Ile Asn Gly Leu Asp Ser
65 70 75 80
Pro Thr Ser Gly Ser Leu Leu Leu Asn Gly Thr Asp Ile Val Gly Met
85 90 95
Pro Glu Ser Lys Leu Arg Lys Leu Arg Ser Asn Ile Gly Met Ile Phe
100 105 110
Gln Gln Phe Asn Leu Phe Gln Ser Arg Thr Ala Ala Gly Asn Val Glu
115 120 125
Tyr Pro Leu Glu Val Ala Lys Met Asp Lys Ala Ala Arg Lys Ala Arg
130 135 140
Val Gln Glu Met Leu Glu Phe Val Gly Leu Gly Asp Lys Gly Lys Asn
145 150 155 160
Tyr Pro Glu Gln Leu Ser Gly Gly Gln Lys Gln Arg Val Gly Ile Ala
165 170 175
Arg Ala Leu Ala Thr Asn Pro Thr Leu Leu Leu Ala Asp Glu Ala Thr
180 185 190
Ser Ala Leu Asp Pro Glu Thr Thr His Glu Val Leu Glu Leu Leu Arg
195 200 205
Lys Val Asn Arg Glu Leu Gly Ile Thr Ile Val Val Ile Thr His Glu
210 215 220
Met Glu Val Val Arg Ser Ile Ala Asp Lys Val Ala Val Met Glu Ser
225 230 235 240
Gly Lys Val Val Glu Tyr Gly Ser Val Tyr Glu Val Phe Ser Asn Pro
245 250 255
Gln Thr Gln Val Ala Gln Lys Phe Val Ala Thr Ala Leu Arg Asn Thr
260 265 270
Pro Asp Gln Val Glu Ser Glu Asp Leu Leu Ser His Glu Gly Arg Leu
275 280 285
Phe Thr Ile Asp Leu Thr Glu Thr Ser Gly Phe Phe Ala Ala Thr Ala
290 295 300
Arg Ala Ala Glu Gln Gly Ala Phe Val Asn Ile Val His Gly Gly Val
305 310 315 320
Thr Thr Leu Gln Arg Gln Ser Phe Gly Lys Met Thr Val Leu Thr Gly
325 330 335
Asn Thr Ala Ala Ile Glu Glu Phe Tyr Gln Thr Leu Thr Lys Thr Thr
340 345 350
Thr Ile Lys Glu Ile Thr Arg
355
<210> 5
<211> 55
<212> DNA
<213> artificial sequence
<400> 5
cagtgccaag cttgcatgcc tgcaggtcga ctctagggac ggcaacgtac ataac 55
<210> 6
<211> 29
<212> DNA
<213> artificial sequence
<400> 6
gttgccggtg agtcaaacag tcattttgc 29
<210> 7
<211> 29
<212> DNA
<213> artificial sequence
<400> 7
gcaaaatgac tgtttgactc accggcaac 29
<210> 8
<211> 56
<212> DNA
<213> artificial sequence
<400> 8
cagctatgac catgattacg aattcgagct cggtacccgc ggctggaaat gtggag 56
<210> 9
<211> 18
<212> DNA
<213> artificial sequence
<400> 9
ctagccggtt ccagtcag 18
<210> 10
<211> 19
<212> DNA
<213> artificial sequence
<400> 10
ggacgtctgt tcaccattg 19
<210> 11
<211> 55
<212> DNA
<213> artificial sequence
<400> 11
cagtgccaag cttgcatgcc tgcaggtcga ctctagaatg cgttctggac tgagg 55
<210> 12
<211> 55
<212> DNA
<213> artificial sequence
<400> 12
cagtgccaag cttgcatgcc tgcaggtcga ctctagaatg cgttctggac tgagg 55
<210> 13
<211> 37
<212> DNA
<213> artificial sequence
<400> 13
catctgttct cggtgcacca gctgcgagga tcatctc 37
<210> 14
<211> 46
<212> DNA
<213> artificial sequence
<400> 14
gatttaattg cgccatctga ttctggcaac aactccttcc ttgacc 46
<210> 15
<211> 49
<212> DNA
<213> artificial sequence
<400> 15
ggtcaaggaa ggagttgttg ccagaatcag atggcgcaat taaatcaag 49
<210> 16
<211> 60
<212> DNA
<213> artificial sequence
<400> 16
cagctatgac catgattacg aattcgagct cggtacccgc tatgacacct tcaacggatc 60
<210> 17
<211> 19
<212> DNA
<213> artificial sequence
<400> 17
tccaaggaag atacacgcc 19
<210> 18
<211> 18
<212> DNA
<213> artificial sequence
<400> 18
cgaaatggaa gttgtgcg 18
<210> 19
<211> 19
<212> DNA
<213> artificial sequence
<400> 19
cgatgatgcc gattacctc 19
<210> 20
<211> 18
<212> DNA
<213> artificial sequence
<400> 20
cgttggaatc ttgcgttg 18
<210> 21
<211> 55
<212> DNA
<213> artificial sequence
<400> 21
gcttgcatgc ctgcaggtcg actctagagg atcccccagc tgcgaggatc atctc 55
<210> 22
<211> 54
<212> DNA
<213> artificial sequence
<400> 22
atcaggctga aaatcttctc tcatccgcca aaaccaacaa ctccttcctt gacc 54
<210> 23
<211> 54
<212> DNA
<213> artificial sequence
<400> 23
cagtgccaag cttgcatgcc tgcaggtcga ctctagaatg aatgggatgg gtcg 54
<210> 24
<211> 37
<212> DNA
<213> artificial sequence
<400> 24
catcatcggt tactctggcc gaaatggaag ttgtgcg 37
<210> 25
<211> 37
<212> DNA
<213> artificial sequence
<400> 25
cgcacaactt ccatttcggc cagagtaacc gatgatg 37
<210> 26
<211> 58
<212> DNA
<213> artificial sequence
<400> 26
cagctatgac catgattacg aattcgagct cggtacccca acaactcctt ccttgacc 58
<210> 27
<211> 18
<212> DNA
<213> artificial sequence
<400> 27
aatgaatggg atgggtcg 18
<210> 28
<211> 20
<212> DNA
<213> artificial sequence
<400> 28
caacaactcc ttccttgacc 20

Claims (10)

1. A bacterium producing L-glutamic acid or L-lysine, characterized in that the bacterium is Corynebacterium glutamicumCorynebacterium glutamicum) Improved expression of a polynucleotide having an amino acid sequence encoding SEQ ID NO. 3; the improved expression is enhanced expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO. 3, or the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 has a point mutation and expression is enhanced, the point mutation of the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 being such that the arginine at position 334 of the amino acid sequence of SEQ ID NO. 3 is replaced by a terminator.
2. The bacterium of claim 1, wherein the polynucleotide encoding the amino acid sequence of SEQ ID NO. 3 has the nucleotide sequence of SEQ ID NO. 1.
3. The bacterium of claim 2, wherein said polynucleotide having a point mutation has the polynucleotide sequence shown in SEQ ID NO. 2.
4. A bacterium according to any one of claims 1 to 3, wherein said corynebacterium glutamicumCorynebacterium glutamicum) YP97158 or ATCC 13869.
5. The polynucleotide is characterized in that the sequence of the amino acid coded by the polynucleotide is shown as SEQ ID NO. 4.
6. The polynucleotide according to claim 5, wherein the polynucleotide has the sequence shown in SEQ ID NO. 2.
7. A protein is characterized in that the amino acid sequence is shown as SEQ ID NO. 4.
8. A recombinant vector comprising the polynucleotide of any one of claims 5-6.
9. A recombinant strain comprising the polynucleotide of any one of claims 5-6.
10. A method for producing L-glutamic acid or L-lysine, the method comprising: culturing the bacterium according to any one of claims 1 to 4, obtaining a culture, and recovering L-glutamic acid or L-lysine from the culture.
CN202011105063.5A 2020-06-08 2020-10-15 Recombinant strain for producing L-amino acid and construction method and application thereof Active CN112266891B (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN202011105063.5A CN112266891B (en) 2020-10-15 2020-10-15 Recombinant strain for producing L-amino acid and construction method and application thereof
KR1020227045499A KR20230042224A (en) 2020-06-08 2020-12-31 Recombinant strains producing L-amino acids and their construction methods and applications
EP20939601.9A EP4163377A1 (en) 2020-06-08 2020-12-31 Recombinant strain for producing l-amino acid, construction method therefor, and application thereof
US18/001,218 US20230313122A1 (en) 2020-06-08 2020-12-31 Recombinant strain for producing l-amino acid, construction method therefor, and application thereof
JP2022574296A JP2023528619A (en) 2020-06-08 2020-12-31 Recombinant strain producing L-amino acid, and construction method and use thereof
PCT/CN2020/142133 WO2021248902A1 (en) 2020-06-08 2020-12-31 Recombinant strain for producing l-amino acid, construction method therefor, and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011105063.5A CN112266891B (en) 2020-10-15 2020-10-15 Recombinant strain for producing L-amino acid and construction method and application thereof

Publications (2)

Publication Number Publication Date
CN112266891A CN112266891A (en) 2021-01-26
CN112266891B true CN112266891B (en) 2023-10-31

Family

ID=74337550

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011105063.5A Active CN112266891B (en) 2020-06-08 2020-10-15 Recombinant strain for producing L-amino acid and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN112266891B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1370236A (en) * 1999-06-25 2002-09-18 Basf公司 Corynebacterium glutamicum genes encoding proteins involved in memberane synthesis and membrane transport
CN1370235A (en) * 1999-06-25 2002-09-18 Basf公司 Corynebacterium glutamicum genes encoding stress, resistance and tolerance proteins
CN1807634A (en) * 1999-06-25 2006-07-26 Basf公司 Corynebacterium glutamicum genes encoding proteins involved in carbon metabolism and energy production
US8637295B1 (en) * 2009-02-20 2014-01-28 Evonik Degussa Gmbh Process for the production of L-lysine

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7270984B1 (en) * 1999-06-25 2007-09-18 Basf Aktiengesellschaft Polynucleotides encoding a 6-phosphogluconolactonase polypeptide from corynebacterium glutamicum
JP4623825B2 (en) * 1999-12-16 2011-02-02 協和発酵バイオ株式会社 Novel polynucleotide
DE10154270A1 (en) * 2001-11-05 2003-05-15 Basf Ag Genes that code for carbon metabolism and energy production proteins

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1370236A (en) * 1999-06-25 2002-09-18 Basf公司 Corynebacterium glutamicum genes encoding proteins involved in memberane synthesis and membrane transport
CN1370235A (en) * 1999-06-25 2002-09-18 Basf公司 Corynebacterium glutamicum genes encoding stress, resistance and tolerance proteins
CN1807634A (en) * 1999-06-25 2006-07-26 Basf公司 Corynebacterium glutamicum genes encoding proteins involved in carbon metabolism and energy production
US8637295B1 (en) * 2009-02-20 2014-01-28 Evonik Degussa Gmbh Process for the production of L-lysine

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Boosting Anaplerotic Reactions by Pyruvate Kinase Gene Deletion and Phosphoenolpyruvate Carboxylase Desensitization for Glutamic Acid and Lysine Production in Corynebacterium glutamicum;Atsushi Yokota等;《Advances in biochemical engineering/biotechnology》;全文 *
L-赖氨酸的代谢途径到工业生产;魏爱英等;《发酵科技通讯》;全文 *

Also Published As

Publication number Publication date
CN112266891A (en) 2021-01-26

Similar Documents

Publication Publication Date Title
CN111979164B (en) Recombinant strain for producing L-lysine and construction method and application thereof
CN111979165B (en) Recombinant strain for producing L-lysine and construction method and application thereof
CN110607313A (en) Recombinant strain for high yield of L-lysine and construction method and application thereof
CN112646767B (en) Strain with enhanced L-glutamic acid productivity and construction method and application thereof
CN112646766B (en) Recombinant strain for producing L-glutamic acid by modifying gene BBD29_04920 as well as construction method and application thereof
CN111961635B (en) Recombinant strain for producing L-lysine and construction method and application thereof
CN112662605B (en) YH 66-10715 gene modified strain for producing L-isoleucine and construction method and application thereof
CN112625992B (en) Recombinant strain for producing L-glutamic acid by modifying gene BBD 29-11265 as well as construction method and application thereof
CN112175894B (en) Recombinant strain for producing L-amino acid and construction method and application thereof
CN111471693A (en) Corynebacterium glutamicum for producing lysine and construction method and application thereof
CN112522175B (en) Recombinant strain for producing L-glutamic acid by modifying gene BBD29_09525 as well as construction method and application thereof
CN112266891B (en) Recombinant strain for producing L-amino acid and construction method and application thereof
CN112725253B (en) Recombinant strain for modifying gene BBD29_14900 and construction method and application thereof
US11242545B2 (en) Corynebacterium for producing L-lysine by fermentation
CN112538491B (en) YH66_08550 gene-based recombinant strain for producing L-isoleucine as well as construction method and application thereof
CN114369559B (en) Recombinant strain for producing L-amino acid and construction method and application thereof
WO2021248890A1 (en) Recombinant strain producing l-lysine and construction methods therefor and use thereof
WO2021248902A1 (en) Recombinant strain for producing l-amino acid, construction method therefor, and application thereof
US20230323412A1 (en) Recombinant strain for producing l-amino acid and construction method and use thereof
CN112501097B (en) Recombinant strain for modifying YH66_06385 gene, construction method thereof and application of recombinant strain for producing L-isoleucine
CN118147035A (en) Recombinant microorganism and application thereof in preparation of L-lysine
CN112626098A (en) Recombinant strain for modifying kgd gene, construction method thereof and application of recombinant strain for producing L-isoleucine
CN116262915A (en) 3-isopropyl malate dehydratase mutant and application thereof
CN115873814A (en) Application of bifunctional methylenetetrahydrofolate dehydrogenase encoding gene folD in L-amino acid synthesis
CN116555213A (en) Acetolactate synthase III regulatory subunit coding gene ilvH, mutant thereof and application thereof in production of L-amino acid

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant