CN116200418A

CN116200418A - Method for screening unknown gene mutant of pseudomonas aeruginosa LasR gene regulation network

Info

Publication number: CN116200418A
Application number: CN202111459700.3A
Authority: CN
Inventors: 戴伟君; 蔡文杰; 廖慧敏; 卢铭琪; 周湘婷
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2021-12-01
Filing date: 2021-12-01
Publication date: 2023-06-02

Abstract

The invention provides a method for screening unknown gene mutants in a Pseudomonas aeruginosa LasR gene regulation network. According to the invention, the easy-mutation gene is overexpressed in the Pseudomonas aeruginosa LasR knockout mutant, the defect that the Pseudomonas aeruginosa LasR knockout mutant cannot hydrolyze casein is utilized, the Pseudomonas aeruginosa LasR knockout mutant is cultured in a stress environment to induce mutation, and then the Pseudomonas aeruginosa recovering proteolytic capacity is screened to find out corresponding mutation sites. The method is more direct, simple and quick, can lead the genes in a specific regulation network to generate directional unknown mutation, and can better discover the regulation relation between genes and the regulation network and greatly save time compared with the existing method.

Description

Method for screening unknown gene mutant of pseudomonas aeruginosa LasR gene regulation network

Technical Field

The invention belongs to the technical field of molecular biology. More specifically, it relates to a method for screening unknown gene mutants of Pseudomonas aeruginosa LasR gene regulatory network.

Background

Bacterial whole genome sequencing lays a foundation for deep understanding of the vital activity rules of bacteria, but after sequencing is completed, people have to face the problem of unclear functions of a plurality of genes, and how to clarify the functions of unknown genes and the relationship between the genes becomes the most urgent task. It is estimated that 30 to 50% of the gene functions are still unknown in the most studied microorganisms Escherichia coli (Escherichia coli). The most important way to understand the function of bacterial genes is to obtain a mutant strain of the gene and then determine the function of the gene product based on the phenotypic changes of the mutant strain. Currently, the mainstream research method is to establish a bacterial monogenic mutant strain library or construct a mutant strain library by utilizing transposons. For example, chinese patent CN112553251a discloses a screening method for influenza virus-related host gene mutants, wherein the first step of screening is to create a random gene mutation library. However, the library construction strategy of bacterial single-gene mutant strain libraries is to mutate gene by using a single-exchange method, and as most bacteria contain thousands of genes, the strategy is time-consuming and labor-consuming, and generally needs large-scale cooperation, and is difficult to accomplish independently. The technological route of constructing mutant strain library with transposon is to randomly insert transposon Tn5 to produce mutant strain, and the mutation of the selected gene is time consuming owing to the randomness of the insertion. The method is only suitable for researching the influence of mutation of a single gene on a bacterial pathway, and cannot well research mutation of genes related to a certain system pathway, and if research on a regulation network among genes is required, the research is more difficult.

Pseudomonas aeruginosa (P.aeromonas) is known as Pseudomonas aeruginosa, one of the most common bacteria present in the soil. Studies have shown that the Pseudomonas aeruginosa Quorum Sensing (QS) system is closely related to the initiation and level of expression of its virulence factors. The Pseudomonas aeruginosa QS system comprises a las system and a rhl system, wherein the las system consists of lasI and lasR, and the rhl system consists of rh1I and rh 1R. Wherein, lasI and rhlI control the synthesis of signal molecules, while lasR and rh1R control the synthesis of the ligand of the respective signal molecules, respectively, and the combination of the signal molecules and the ligand proteins has high specificity. The compound formed by the signal molecule and the ligand regulates the expression of the downstream virulence genes and the production of various virulence factors. The signal molecule ligand complex of the las system can regulate and control the expression of various virulence factors, and can also regulate and control the signal molecule ligand complex to form a positive feedback loop, so that the efficacy of the signal molecule ligand complex is continuously amplified. When the QS system of Pseudomonas aeruginosa is activated, the biological properties of the Pseudomonas aeruginosa are changed, and some new biological characteristics are shown. If the biological envelope is induced to differentiate and mature, the drug resistance is enhanced; up-regulation and enhancement of virulence factor expression, and enhancement of its pathogenic ability; induce and promote partial bacterial death, maintain proper density of flora; helping bacteria to withstand adverse environments, such as hypoxia injury, antibiotic killing and the like. Therefore, research on the functions and genetic pathways of the pseudomonas aeruginosa QS gene is of great significance for preventing and controlling the pseudomonas aeruginosa, and the method for screening unknown gene mutants of the pseudomonas aeruginosa QS gene regulatory network is particularly important.

Disclosure of Invention

The invention aims to overcome the defects and the shortcomings of the prior art and provide a method for screening unknown gene mutants of a Pseudomonas aeruginosa LasR gene regulation network.

The above object of the present invention is achieved by the following technical scheme:

the invention provides a method for screening unknown gene mutants of a pseudomonas aeruginosa LasR gene regulation network, which comprises the following steps:

s1, selecting a known gene which is functionally related to a LasR gene and is easy to mutate in a Pseudomonas aeruginosa LasR gene regulation network as a target gene, and constructing a recombinant plasmid of the target gene;

s2, transferring the recombinant plasmid constructed in the step S1 into a Pseudomonas aeruginosa LasR knockout mutant, and screening the mutant under a stress environment;

s3, carrying out PCR sequencing on the mutant screened in the step S2, judging whether the target gene is mutated, if not, extracting genome DNA of the mutant, and carrying out resequencing to identify mutation sites;

s4, knocking out the mutation site identified in the step S3 in pseudomonas aeruginosa, and verifying whether the same phenotype can be obtained, wherein if the same phenotype can be obtained, the gene of the mutation site has an important role in LasR gene regulation network.

Specifically, the gene of interest in step S1 is the mexT gene.

Specifically, the plasmid used for constructing the recombinant plasmid in step S1 is pUC18T-miniTn7.

Specifically, when the constructed recombinant plasmid is transferred into a Pseudomonas aeruginosa LasR knockout mutant, the pTNS2 plasmid is used for assistance.

Specifically, the recombinant plasmid and pTNS2 plasmid are transferred into Pseudomonas aeruginosa LasR mutant by electric shock transformation.

Specifically, the constructed recombinant plasmid is transferred into escherichia coli DH5 alpha for transformation, transformants growing on LB plates (containing gentamicin) are detected by PCR, positive transformants with correct sequence are cultured in a large quantity, the plasmid is extracted, and then the recombinant plasmid carrying the target gene and the pTNS2 plasmid are mixed and then are shocked into the Pseudomonas aeruginosa LasR knockout mutant.

Specifically, the transferred pseudomonas aeruginosa knockout mutant can be a multiple gene knockout mutant, but at least the LasR gene is knocked out in the multiple gene knockout mutant.

LasR knockout mutants cannot hydrolyze casein, so that the mutants can be screened using culture medium with casein as the sole carbon source as stress environment.

Specifically, step S2 is to screen mutants under the stress environment provided by PM-casein medium.

Specifically, the method for screening mutants comprises the following steps: inoculating pseudomonas aeruginosa strain carrying target gene recombinant plasmid into a Falcon round bottom test tube containing PM-casein culture medium for culture, supplementing sterile water once every 2d, sampling once every 5d, coating bacterial liquid obtained by sampling on LB solid culture medium, culturing until single colony point is grown, culturing and observing the single colony point on a milk-LB plate, and using original pseudomonas aeruginosa strain as a control, wherein single colony with a hydrolysis ring is a mutant strain. Meanwhile, 100 mu L of bacterial liquid is inoculated into a new 3mL PM-casein culture medium for continuous shaking culture.

Specifically, the Pseudomonas aeruginosa LasR deletion strain carrying the recombinant plasmid needs to shake the seed solution before being inoculated into the PM-casein culture medium.

Specifically, the culture conditions in PM-casein medium were 37℃and 220rpm.

Specifically, the original pseudomonas aeruginosa strain is pseudomonas aeruginosa PAO1.

Pseudomonas aeruginosa has many mutant strains on LasR and mexT genes, and the virulence and various properties of the mutant strains are changed. The LasR gene of the pseudomonas aeruginosa is knocked out, the proteolytic activity of the pseudomonas aeruginosa is influenced, and the mutation of the mexT gene can restore the proteolytic activity of the pseudomonas aeruginosa on the basis of knocking out the LasR gene. Therefore, unknown gene mutants of the Pseudomonas aeruginosa LasR gene regulation network are screened by utilizing LasR knockout mutants and mexT genes.

The invention utilizes a PUC18T-miniTn7 plasmid and a known gene (mexT) which is easy to mutate in a pseudomonas aeruginosa quorum sensing system to construct a recombinant plasmid, the screening method is described and verified, the constructed recombinant plasmid and pTNS2 plasmid are introduced into a pseudomonas aeruginosa LasR knockout mutant by electric shock transformation, the gene which is easy to mutate is overexpressed, and pseudomonas aeruginosa containing the recombinant plasmid is cultivated in a stress environment, so that the mutant gene is screened. Among them, pTNS2 plasmid is a helper plasmid capable of helping the PUC18T-miniTn7 plasmid to insert the gene of interest into the glms gene position of Pseudomonas aeruginosa, but does not affect its properties. The reason for over-expressing the mutation-prone gene is that even if the mutation-prone gene is mutated in the future, the function of the gene is restored by the plasmid carrying the gene.

The invention utilizes the defect that the LasR knockout mutant of the pseudomonas aeruginosa cannot hydrolyze casein to continuously culture the pseudomonas aeruginosa carrying the recombinant plasmid in a PM-casein liquid culture medium. Casein (Casein) is the only carbon source in PM-Casein liquid medium, pseudomonas aeruginosa must be able to break down in large amounts to reproduce in large amounts, whereas LasR knockout strains lack proteolytic activity. The invention utilizes the extreme environment and the evolution of the pseudomonas aeruginosa to cause the pseudomonas aeruginosa to mutate towards the direction favorable for survival of the pseudomonas aeruginosa. The mutated gene is directed, and is a loop in the pseudomonas aeruginosa gene and gene regulation network, and the mutated gene can restore the previous character. Before the pseudomonas aeruginosa is cultured by the stress environment, the recombinant plasmid is used for over-expressing the genes which are easy to mutate in the pseudomonas aeruginosa, so that the pseudomonas aeruginosa can mutate other genes in the regulated network to survive. By screening pseudomonas aeruginosa with the casein hydrolyzing capability restored, the corresponding mutation sites can be found out to better study the regulation relationship and regulation network between genes.

The invention has the following beneficial effects:

according to the invention, the easy-mutation gene is overexpressed in the pseudomonas aeruginosa LasR knockout mutant, the defect that the pseudomonas aeruginosa LasR knockout mutant cannot hydrolyze casein is utilized to stress, the pseudomonas aeruginosa LasR knockout mutant is cultured in a stress environment to induce mutation, and then the pseudomonas aeruginosa recovering proteolytic capacity is screened to find out corresponding mutation sites. The method is more direct, simple and quick, can lead the genes in a specific regulation network to generate directional unknown mutation, and can better discover the regulation relation between genes and the regulation network and greatly save time compared with the existing method.

Drawings

FIG. 1 is a schematic diagram of the structure of a recombinant plasmid PUC18T-miniTn 7-mexT.

FIG. 2 shows the mutant strains screened on the milk-LB plate.

FIG. 3 is a schematic diagram of the structure of pGEX2-rpoA2 vector.

FIG. 4 is a graph showing the results of the verification of rpoA mutation.

FIG. 5 shows mutant strains screened on milk-LB plates using PAO1- ΔLasRΔpsdR double knockout strains.

FIG. 6 is a schematic diagram of the structure of pGEX2-gshA point mutation vector.

FIG. 7 is a graph of the results of the verification of gshA mutations.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

Example 1

In this example, the screening method of the present invention was described in more detail using the mexT gene of P.aeruginosa PAO1 as the target gene, and the names and sequences of the primers used in this example are shown in Table 1.

TABLE 1 primer sequence listing

Primer name	Nucleotide sequence (5 '-3')
		miniTn7-mexT-F	CATGCATGAGCTCACTAGTGGATCCTGTTCCATGCTTGACTCCGCC
miniTn7-mexT-R	TTCGCGAGGTACCGGGCCCAAGCTTTGACGCCAGAGCACATCCTT
		miniTn7-F	CGTTCGGTCAAGGTTCTGGA
miniTn7-R	AGCGCCCAAACATAACAGGA
		glmsup-F	CTGTGCGACTGCTGGAGCTGA
glmsdown-R	GCACATCGGCGACGTGCTCTC
		mexT-JC-F	GAAAACGGATCACTCGGGAC
mexT-JC-R	GCGCCAGGAGAAGTGGGATG
		pGEX2-rpoA2-F	CTTCTGCAGGTCGACTCTAGAAGCGTCGCGTGTAATAGGAGA
pGEX2-rpoA2-R	GGAAATTAATTAAGGTACCGAATTCGTGCTATGAAGCGAAGCGGC
		pGEX2-F	CGAGCCGGAAGCATAAATGT
pGEX2-R	TCCGCGTTTCCAGACTTTAC
		rpoA-JC-F	GTCGAGCTCTACTCCAAGTA
rpoA-JC-R	CCACTTTTACGATGGCGCAT

S1, constructing recombinant plasmid carrying target gene mexT

(1) PCR amplification of the target Gene mexT

The genome DNA of pseudomonas aeruginosa PAO1 is used as a template, forward primer miniTn7-mexT-F and reverse primer miniTn7-mexT-R are used for PCR amplification, 200 bp is amplified respectively at the upstream and downstream of mexT, and finally a fragment with the length of 1577bp is obtained by amplification, and the fragment is named as miniTn7-mexT fragment. The forward primer miniTn7-mexT-F and the reverse primer miniTn7-mexT-R are prepared by the following steps of: 880417 is designed for the purpose. After the PCR amplification is completed, the PCR product is detected by electrophoresis and recovered by gel cutting.

(2) Homologous recombination of mexT fragment and PUC18T-miniTn7 restriction enzyme plasmid

The PUC18T-miniTn7 plasmid is subjected to enzyme digestion by BamHI and HindIII incision enzyme, and then glue is recovered, so that a plasmid enzyme digestion product is obtained, and the plasmid enzyme digestion product is named miniTn7-BamHI-HindIII; the mexT fragment recovered by PCR amplification was subjected to homologous recombination with miniTn7-BamHI-HindIII fragment by one-step directional cloning kit (Novoprotein, NR 001B), and reacted at 50℃for 20min.

(3) Conversion by heat shock

The competent cells of the escherichia coli DH5 alpha are prepared according to a conventional method, 100 mu L of competent cells of the escherichia coli DH5 alpha are taken and gently mixed with 5 mu L of miniTn7-mexT homologous recombination reaction liquid, and the mixture is immediately transferred into ice for 5min after being subjected to heat shock at 42 ℃ for 90s after being subjected to ice bath for 20min. After a small amount of the bacterial liquid was cultured at 37℃for 1 hour, the culture was spread on LB solid medium (containing 50. Mu.g/mL Gm (Gentamicin, gentamicin sulfate)) and cultured overnight at 37 ℃. After positive transformants were obtained by detection with the forward primer miniTn7-F and the reverse primer miniTn7-R, the corresponding strain was designated DH 5. Alpha. -miniTn7-mexT.

(4) After DH 5. Alpha. -MiniTn7-mexT was cultured in LB medium, miniTn7-mexT plasmid was extracted with OMEGA plasmid extraction kit.

The structural schematic diagram of the PUC18T-miniTn7-mexT recombinant plasmid constructed by the invention is shown in figure 1.

S2, electric shock transformation of pseudomonas aeruginosa mutant strain and mutant screening under stress environment

(1) Insertion of the PUC18T-miniTn7-mexT plasmid into the Pseudomonas aeruginosa mutant Strain

The PAO1-LasR knockout mutant of pseudomonas aeruginosa cultured overnight is prepared into competent cells by 10% sucrose solution, then the PUC18T-miniTn7-mexT plasmid and pTNS2 helper plasmid are mixed and added into the competent cells, the competent cells are placed in a 0.2cm precooled electric shock cup, a Bio-Rad electroconverter is used for electric shock at 2.5kV, 1mL of LB liquid medium is rapidly added after the electric shock is carried out by the electric shock cup, a small amount of bacterial liquid is taken for culturing at 37 ℃ for 1h and then coated on LB solid medium (containing 100 mu g/mL Gm (Gentamicin, gentamicin sulfate)) and the culture is carried out at 37 ℃ overnight.

After positive transformants were obtained by detection with the forward primer glmsup-F and the reverse primer glmsdown-R, the corresponding strain was designated as PAO 1-. DELTA.LasR-MiniTn 7-mexT.

(2) Screening mutants under stress environment

The strain PAO 1-DeltaLasR-MiniTn 7-mexT is shaken seed liquid, 100 mu L of seed liquid is taken after shaking culture for 5 hours at 37 ℃ and 220rpm and inoculated into 3mL of PM-casein culture medium, a 14mL Falcon round bottom test tube is used, and sterile water is supplemented every 2 days after shaking culture at 37 ℃ and 220rpm. Meanwhile, 100 mu L of shaking culture solution is taken every 5 days, diluted by sterile water or LB liquid culture medium, coated on LB solid culture medium, cultured for 20 hours in a 37 ℃ incubator to grow single colony, the single colony is cultured on a milk-LB (skim milk powder with the final concentration of 4% is added in a conventional LB culture medium) plate by using a sterile toothpick point, the culture is carried out for 20 hours in the 37 ℃ incubator, a wild strain and DeltaLasR DeltamexT are used as positive control (as mexT over-expression can influence the expression of a downstream gene, the proteolytic capacity is weakened, the proteolytic capacity is enhanced after mexT is knocked out, the control can be used), deltaLasR is used as negative control, whether a hydrolysis ring appears on the milk plate, and the mutant which is wanted to find is shown.

After 25-30 days of screening, mutants with hydrolysis circles are screened, and the result is shown in figure 2. Wherein, the first row of holes on the left side 2 is a wild strain, two holes on the middle are DeltaLasR mutants, two holes on the right side are DeltaLasR DeltamexT mutants, and the rest are single colonies tested. As can be seen from FIG. 2, as with the wild type PAO1 and the ΔLasR ΔmexT phenotypes, a part of the single colonies showed distinct hydrolysis circles after milk-LB plate culture, and blue-black circles were proteolytic circles, and a larger black circle indicates a stronger hydrolysis ability.

S3, detection of mutants

(1) Mutation detection of target Gene

mexT was amplified and sequenced to detect if the mutation was caused by a mutation in mexT. The invention uses forward primer mexT-JC-F and reverse primer mexT-JC-R to carry out PCR amplification on the screened mutant, sends the sequencing result to a company, and compares the sequencing result with the original sequence to find that the gene mexT on the genome is not mutated. Therefore, the genome DNA of the mutant is extracted to detect and identify the mutant gene.

(2) Sequencing identification of mutant genes

3 mutant strains were selected and cultured in LB medium. After shaking culture at 37℃and 220rpm for 6 hours, 1mL of the bacterial liquid was taken, and genomic DNA was extracted using a DNA extraction kit (full gold, EE 161), specifically by referring to the kit instructions. The DNA obtained by extraction was sent to Nostoc source company for resequencing, and the 3 mutants were found to have the same base mutation on the same gene (rpoA) by comparison, and the encoded amino acid was also changed.

S4, re-knockout mutant gene verification

PCR amplification is carried out by using the forward primer pGEX2-rpoA2-F and the reverse primer pGEX2-rpoA2-R, and the mutant with the identified mutation site is used as a template, and glue recovery is carried out, so that a PCR product is obtained, which is named rpoA2-G fragment and has the length of 2412bp. The pGEX2 suicide plasmid was digested with XbaI and EcoRI, and the gel was recovered to obtain a plasmid digested product, which was named pGEX2-XbaI-EcoRI. The rpoA2-G fragment recovered by PCR amplification and pGEX2-XbaI-EcoRI fragment were subjected to homologous recombination by one-step directional cloning kit (Novoprotein, NR 001B) and reacted at 50℃for 20 minutes.

The competent cells of the escherichia coli DH5 alpha are prepared by a conventional method. 100. Mu.L of E.coli DH 5. Alpha. Competent cells and 5. Mu.L of pGEX2-rpoA2-G homologous recombination reaction solution were gently mixed, placed on ice for 20min, heat-shocked at 42℃for 90s, and immediately transferred on ice for 5min.

After a small amount of the bacterial liquid was cultured at 37℃for 1 hour, the culture was spread on LB solid medium (containing 50. Mu.g/mL Gm (Gentamicin, gentamicin sulfate)) and cultured overnight at 37 ℃.

After positive transformants were obtained by screening with the forward primer pGEX2-F and the reverse primer pGEX2-R, the corresponding strain was designated DH 5. Alpha. -pGEX2-rpoA2-G.

The structure of pGEX2-rpoA2 vector constructed by the invention is schematically shown in FIG. 3.

The Pseudomonas aeruginosa PAO1-LasR knockout mutant, DH5 alpha-pGEX 2-rpoA2-G and DH5 alpha-PRK 2013 (helping plasmid, helping pGEX2 suicide plasmid to bind into host bacteria) were mixed three-sidedly, dropped on LB plate for 8 hours, then diluted and spread on PIA culture substrate (Gm (Gentamicin, gentamicin sulfate) containing 100 mug/mL) and cultured at 37 ℃ for 24 hours. The grown transformant was re-screened with 10% sucrose-LB salt-free plate, and the plasmid suicide after the exchange of the transformant passing through the sucrose plate was resistant. PCR amplification was performed with the forward primer rpoA-JC-F and the reverse primer rpoA-JC-R, and sequencing was carried out by company, which showed that the base of the mutation site of part of rpoA had been replaced.

Example 2

The PAO 1-DeltaLasR-rpoA point mutant bacteria were subjected to phenotype detection on a milk-LB plate, and the mutants obtained by screening the PAO 1-DeltaLasR mutant of Pseudomonas aeruginosa and the PAO 1-DeltaLasR-rpoA-miniTn 7-mexT mutant of Pseudomonas aeruginosa were used as controls, and the results are shown in FIG. 4. As can be seen from FIG. 4, the PAO 1-DeltaLasR-rpoA point mutant bacteria have hydrolysis circles on the milk-LB plate, and the strain after the rpoA point mutation knockout has the same phenotype as the screened mutant, which shows that the rpoA point mutation knockout is successful. The proteolytic ability is stronger than that of the mexT over-expressed mutant because the mexT over-expression affects the expression of the downstream gene and weakens the proteolytic ability. The results show that the gene participates in a regulatory network for regulating LasR.

Example 3

In this example, the screening method of the present invention was described in more detail using LasR and psdR double deletion mutants of P.aeruginosa PAO1 with mexT gene as the target gene on the vector. The names and sequences of the primers used in this example are shown in Table 2.

TABLE 2 primer sequence listing

Primer name	Nucleotide sequence (5 '-3')
		glmsup-F	CTGTGCGACTGCTGGAGCTGA
glmsdown-R	GCACATCGGCGACGTGCTCTC
		mexT-JC-F	GAAAACGGATCACTCGGGAC
mexT-JC-R	GCGCCAGGAGAAGTGGGATG
		rpoA-JC-F	GTCGAGCTCTACTCCAAGTA
rpoA-JC-R	CCACTTTTACGATGGCGCAT
		pGEX2-F	CGAGCCGGAAGCATAAATGT
pGEX2-R	TCCGCGTTTCCAGACTTTAC
		pGEX2-GshA-F	GCATAAATGTAAAGCAAGCTTGGAGCGCCTCGACGAACAC
pGEX2-GshA-R	ATTCGAGCTCGAGCCCGGGGATCGTTCGAGCAGTTGCGCGA
		gshA-JC-F	GCAAGACCATGCAGTGCATC
gshA-JC-R	CGGCGACGAAGGTATCGAAG

S1, constructing recombinant plasmid carrying target gene mexT

The mexT recombinant plasmid constructed in this example is the same as that in example 1, and will not be described here again, and the schematic structure of the recombinant plasmid is shown in FIG. 1.

The overnight-cultured pseudomonas aeruginosa PAO1-LasR-psdR double knockout mutant is made into competent cells by using 10% sucrose solution, then the PUC18T-miniTn7-mexT plasmid and pTNS2 helper plasmid are mixed and added into the competent cells, placed in a 0.2cm precooled electric shock cup, subjected to electric shock at 2.5kV by using a Bio-Rad electrotransducer, quickly added with 1mL of LB liquid medium after the electric shock by using the electric shock cup, and a small amount of bacterial liquid is taken to be cultured at 37 ℃ for 1 hour and then coated on LB solid medium (containing 100 mug/mL Gm (Gentamicin, gentamicin sulfate)) and cultured at 37 ℃ overnight.

After positive transformants were obtained by detection with the forward primer glmsup-F and the reverse primer glmsdown-R, the corresponding strain was designated as PAO 1-. DELTA.LasR-. DELTA.psdR-MiniTn 7-mexT.

(2) Screening mutants under stress environment

The strain PAO 1-DeltaLasR-DeltapsdR-MiniTn 7-mexT was shaken at 37℃and 220rpm, 100. Mu.L of the seed solution was inoculated into 3mL of PM-casein medium after shaking culture for 5 hours, and the used test tube was a 14mL Falcon round bottom test tube, and the culture was carried out at 37℃and 220rpm, and sterile water was supplemented every 2 days. Meanwhile, 100 mu L of shaking culture liquid is taken every 5 days, diluted by sterile water or LB liquid culture medium, coated on LB solid culture medium, cultured for 20 hours in a 37 ℃ incubator to grow single colony, the single colony is inoculated on a milk-LB (skim milk powder with the final concentration of 4% is added in a conventional LB culture medium) plate by sterile toothpick, cultured for 20 hours in the 37 ℃ incubator, a wild strain is used as a positive control, deltaLasR is used as a negative control, and whether hydrolysis rings appear on the milk plate is judged, and the hydrolysis rings appear as the intended mutants. At the same time, 100. Mu.L of the bacterial liquid was inoculated into a new 3mL PM-casein medium, and shaking culture was continued.

After 25-30 days of screening, mutants with hydrolysis circles are screened, and the result is shown in figure 5. Wherein, the 1 st hole on the right side of the first row is a wild strain, the 2 nd hole is a DeltaLasR mutant, and the rest are single colonies tested. As can be seen from FIG. 5, the same phenotype as the wild-type PAO1, a part of the single colonies showed a distinct hydrolysis circle after being cultured on a milk-LB plate, and the blue-black circle was a proteolytic circle, and the darker the larger the hydrolysis ability.

S3, detection of mutants

(1) Mutation detection of target Gene

mexT was amplified and sequenced to detect if the mutation was caused by a mutation in mexT. The invention uses forward primer mexT-JC-F and reverse primer mexT-JC-R to carry out PCR amplification on the selected mutant, uses forward primer rpoA-JC-F and reverse primer rpoA-JC-R to carry out sequencing by a company, and compares the sequencing result with the original sequence to find that the genes mexT and rpoA on the genome are not mutated. Therefore, the genome DNA of the mutant is extracted to detect and identify the mutant gene.

(2) Sequencing identification of mutant genes

2 mutant strains were selected and cultured in LB medium. After shaking culture at 37℃and 220rpm for 6 hours, 1mL of the bacterial liquid was taken, and genomic DNA was extracted using a DNA extraction kit (full gold, EE 161), specifically by referring to the kit instructions. The extracted DNA is sent to Nostoc source company for resequencing, and the base mutation on the gshA gene is found through comparison, and the coded amino acid is changed.

S4, re-knockout mutant gene verification

And (3) carrying out PCR amplification by using the forward primer pGEX2-gshA-F and the reverse primer pGEX2-gshA-R and taking the mutant with the identified mutation site as a template, and carrying out glue recovery to obtain a PCR product, namely gshA fragment with the length of 1459bp. The pGEX2 suicide plasmid is digested with HindIII and XmaI endoenzymes, and the gel is recovered to obtain plasmid digested product which is named pGEX 2-HindIII-XmaI. The gshA fragment recovered by PCR amplification was subjected to homologous recombination with pGEX 2-HindIII-XmaI fragment by one-step directional cloning kit (Novoprotein, NR 001B), and reacted at 50℃for 45min.

The competent cells of the escherichia coli DH5 alpha are prepared by a conventional method. Taking 100 mu L of escherichia coli DH5 alpha competent cells, gently mixing the competent cells with 5 mu L of pGEX2-gshA homologous recombination reaction solution, placing the mixture on ice for 20min, performing heat shock at 42 ℃ for 90s, and immediately transferring the mixture on ice for 5min.

After positive transformants were obtained by screening with the forward primer pGEX2-F and the reverse primer pGEX2-R, the corresponding strain was designated DH 5. Alpha. -pGEX2-gshA.

The structural schematic diagram of pGEX2-gshA vector constructed by the invention is shown in figure 6.

The Pseudomonas aeruginosa PAO 1-DeltaLasRDeltapsdR knockout mutant, DH5 alpha-pGEX 2-gshA and DH5 alpha-pRK 2013 were mixed three-sidedly, dropped on LB plates for 8 hours, then diluted and spread on PIA culture substrates (containing 100. Mu.g/mL Gm (Gentamicin, gentamicin sulfate)) and cultured overnight at 37℃for 24 hours. The grown transformant is passed through 10% sucrose-LB salt-free plate, and the transformant after passing through the sucrose plate is subjected to plasmid suicide after exchange, and has no resistance. PCR amplification detection was performed using the forward primer gshA-JC-F and the reverse primer gshA-JC-R, and sequencing was carried out by company, which showed that the base of the mutation site of the portion gshA had been replaced. The results of the phenotypic assays performed on milk-LB plates using P.aeruginosa PAO1, deltaLasR knockout, deltaLasR DeltapsdR double knockout mutant, deltaLasR DeltaMexT triple knockout mutant as controls are shown in FIG. 7. As can be seen from fig. 7, the presence of the hydrolysis circle indicates that the knockout of the gshA point mutation is successful, and the strain after the gshA point mutation is knocked out has the same phenotype as the screened mutant, which indicates that the gene participates in regulating the regulation network.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims

1. A method for screening unknown gene mutants of pseudomonas aeruginosa LasR gene regulatory network, which is characterized by comprising the following steps:

2. The method according to claim 1, wherein the plasmid used in step S1 for constructing the recombinant plasmid is pUC18T-miniTn7.

3. The method according to claim 2, wherein step S2 is performed using pTNS2 plasmid for the transfer of the constructed recombinant plasmid into a pseudomonas aeruginosa knockout mutant.

4. The method of claim 3, wherein the recombinant plasmid and pTNS2 plasmid are transformed into a Pseudomonas aeruginosa knockout mutant by electric shock transformation.

5. The method of claim 1, wherein the pseudomonas aeruginosa knockout mutant transferred in step S2 is a multiple gene knockout mutant, but at least the LasR gene is knocked out in the multiple gene knockout mutant.

6. The method of claim 1, wherein step S2 is to screen mutants under stress provided by a medium with casein as sole carbon source.

7. The method of claim 6, wherein the medium is PM-casein medium.

8. The method of claim 7, wherein the method of screening for mutants is: inoculating pseudomonas aeruginosa strain carrying target gene recombinant plasmid into a Falcon round bottom test tube containing PM-casein culture medium for culture, supplementing sterile water once every 2d, sampling once every 5d, coating bacterial liquid obtained by sampling on LB solid culture medium, culturing until single colony point is grown, culturing and observing the single colony point on a milk-LB plate, and using original pseudomonas aeruginosa strain as a control, wherein single colony with a hydrolysis ring is a mutant strain.

9. The method according to claim 8, wherein the Pseudomonas aeruginosa strain carrying the recombinant plasmid of the target gene is inoculated into PM-casein medium with seed solution.

10. The method of claim 8, wherein the culturing conditions in PM-casein medium are 37 ℃,220rpm.