CN110878293A

CN110878293A - Application of bacillus licheniformis with deletion of yceD gene in production of heterologous protein

Info

Publication number: CN110878293A
Application number: CN201911295365.0A
Authority: CN
Inventors: 马昕; 陈守文; 蔡冬波; 莫非; 熊敏; 吴晗嘉; 廖永庆; 饶忆
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2019-12-16
Filing date: 2019-12-16
Publication date: 2020-03-13
Anticipated expiration: 2039-12-16
Also published as: CN110878293B

Abstract

The invention relates to the field of Bacillus licheniformis gene engineering modification and protein high-efficiency expression, and discloses application of Bacillus licheniformis lacking yceD gene in heterologous protein productionyceDSuccessfully obtained the deletion geneyceDBacillus licheniformis WX-02 deltayceDOn the basis, alkaline protease AprE free expression plasmid pHY-AprE, keratinase free expression vector pHY-Ker and neutral protease free expression vector pHY-NprE are transferred. Relative to control strainsThe engineering strain constructed by the invention has obvious effect on improving the enzyme activity of the protease, and the enzyme activity is improved by more than 25%.

Description

Application of bacillus licheniformis with deletion of yceD gene in production of heterologous protein

Technical Field

The invention relates to the field of Bacillus licheniformis gene engineering modification and high-efficiency protein expression, in particular to application of Bacillus licheniformis lacking yceD gene in production of heterologous protein, wherein the heterologous protein is mainly alkaline protease, keratinase and neutral protease.

Background

Bacillus is a good host for high-efficiency expression of heterologous proteins, and Bacillus licheniformis is a common host strain for high-efficiency industrial production of heterologous proteins, especially protease at present. The protease is an enzyme preparation product which is most widely applied at present, and is widely applied to the fields of food, medicine, chemical industry, waste treatment and the like. Heterologous protein expression is an effective strategy to increase the expression level of a protein of interest. In recent years, more and more strategies have been developed to increase the level of synthesis of proteins of interest. However, there are many genes related to the synthesis and secretion of exogenous proteins in bacillus licheniformis, and the relationship between protein yield and genes is still unknown, and further research on the way of modifying related genes to obtain high-yield protein engineering bacteria is needed.

YceD is a stress protein in Bacillus licheniformis, and whether the expression level is connected with the expression of a heterologous protein is not resolved and unpredictable. According to the invention, the yceD is knocked out from the bacillus licheniformis, so that the technical effect of improving the yield of heterologous proteins is achieved, and the knocking-out of the yceD is an effective strategy for improving the production level of the heterologous proteins.

Disclosure of Invention

One of the purposes of the invention is to provide the application of Bacillus licheniformis of deletion of yceD gene in the production of heterologous protein, wherein the sequence of the yceD gene is shown in SEQ ID NO. 1.

In order to achieve the purpose, the invention adopts the following technical measures:

the application of the Bacillus licheniformis with deletion of yceD gene in the production of heterologous protein comprises knocking out the yceD gene in the Bacillus licheniformis by using the conventional method of the invention, and then transferring the gene into a heterologous protein expression vector for protein expression, wherein the yceD gene is shown in SEQ ID NO. 1.

In the above-mentioned use, preferably, the heterologous protein is an alkaline protease, a keratinase or a neutral protease;

in the above application, preferably, the bacillus licheniformis is bacillus licheniformis WX-02;

in the above application, preferably, the yceD gene knockout method in Bacillus licheniformis comprises the following steps:

(1) PCR amplifying an upstream homologous arm of the yceD gene and a downstream homologous arm of the yceD gene by taking genome DNA of bacillus licheniformis as a template;

(2) connecting an upstream homologous arm of the yceD gene and a downstream homologous arm of the yceD gene together by overlap extension PCR to form a target gene segment;

(3) carrying out double enzyme digestion on the target gene fragment by using XbaI and BamHI restriction endonucleases to obtain an enzyme digestion gene fragment;

(4) preparing plasmid T2(2) -ori, and carrying out double digestion on the plasmid T2(2) -ori by using XbaI and BamHI restriction enzymes to obtain a linear plasmid fragment;

(5) connecting the enzyme-digested gene fragment obtained in the step (3) with the linear plasmid fragment obtained in the step (4) by using DNA ligase to obtain a knockout plasmid T2(2) -delta yceD;

(6) transferring the knockout plasmid T2(2) -delta yceD into bacillus licheniformis, and screening by taking kanamycin as a screening marker to obtain a positive transformant;

(7) after the positive transformant is subjected to transfer culture for a plurality of times, colony PCR detection is carried out to obtain a positive single-exchange conjugant strain which generates single exchange between the upstream homologous arm of the yceD gene or the downstream homologous arm of the yceD gene and the genome DNA of the Bacillus licheniformis WX-02;

(8) and selecting an upstream homologous arm of the yceD gene and a positive single-exchange binding strain which generates single exchange with the genome DNA of the Bacillus licheniformis WX-02, mixing a downstream homologous arm of the yceD gene and a positive single-exchange binding strain which generates single exchange with the genome DNA of the Bacillus licheniformis WX-02, inoculating the mixture into a culture medium which does not contain kanamycin, and performing transfer culture for several times, and screening by a PCR (polymerase chain reaction) method to obtain the Bacillus licheniformis with the yceD gene knocked out.

In the above applications, preferably, when Bacillus licheniformis lacking the yceD gene is used for the production of an alkaline protease, or a heterologous protein of keratinase or neutral protease, the fermentation medium used has a formulation comprising: 10-20g/L glucose, 5-13g/L soybean peptone, 8-12g/L corn steep liquor, 7-11g/L yeast powder, 8-12g/L sodium chloride and 2-5g/LK₂HPO₄And 4-8g/L (NH)₄)₂SO₄(ii) a Or 5-10g/L bone peptone, 5-13g/L soybean peptone, 8-12g/L corn steep liquor, 7-11g/L yeast powder, 8-12g/L sodium chloride, 2-5g/L K₂HPO₄And 4-8g/L (NH)₄)₂SO₄。

Compared with the prior art, the invention has the following advantages:

the inventor tries to construct the bacillus licheniformis for knocking out the yceD gene for the first time, successfully obtains a bacillus licheniformis heterologous protein expression host strain lacking the yceD gene, and transfers alkaline protease, keratinase and neutral protease free expression vectors, and fermentation results show that the yceD deletion obviously improves the protein expression level, and compared with corresponding control strains, the yield of the heterologous protein of the bacillus licheniformis constructed by the invention is improved by more than 25%. The invention provides a new strategy for the high-efficiency expression of the bacillus licheniformis protein.

Detailed Description

The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, if not specifically mentioned, are commercially available.

The invention takes three proteins (alkaline protease, keratinase and neutral protease) as examples to illustrate the superiority of the technical scheme of the invention; however, in practice, the method is not limited to these three proteins.

Example 1:

obtaining a yceD gene deletion strain Bacillus licheniformis WX-02 delta yceD:

1. designing upstream homology arm primers (yceD-F1 and yceD-R1) and downstream homology arm primers (yceD-F2 and yceD-R2) of the yceD gene according to the gene sequence of the yceD gene in the genome DNA sequence of the Bacillus licheniformis WX-02; and taking genome DNA of Bacillus licheniformis WX-02 as a template, and respectively carrying out PCR amplification by using an upstream homologous arm primer and a downstream homologous arm primer of the yceD gene to obtain an upstream homologous arm fragment of the yceD gene and a downstream homologous arm fragment of the yceD gene (the upstream homologous arm fragment of the yceD gene is 520bp, and the downstream homologous arm fragment of the yceD gene is 542 bp);

wherein, the sequences of yceD-F1, yceD-R1, yceD-F2 and yceD-R2 are as follows:

yceD-F1：GATCTTTTCTACGAGCTCGAACAAGAACGTCATTTA、

yceD-R1：ATTTCCATTCTTCTCCGTCGTCGTGGGCCTTGGCTG、

yceD-F2：CAGCCAAGGCCCACGACGACGGAGAAGAATGGAAAT、

yceD-R2：GTGGCGGCCGCTCTAGAAAAAGTTTTGGCTGCGGCT；

2. taking an upstream homologous arm of the yceD gene and a downstream homologous arm fragment of the yceD gene as templates, taking an upstream homologous arm primer yceD-F1 and a downstream homologous arm primer yceD-R2 as primers, and connecting the upstream homologous arm of the yceD gene and the downstream homologous arm of the yceD gene together through overlap extension PCR to obtain a target gene fragment;

3. carrying out double enzyme digestion on the target gene fragment in the step 2 by using XbaI and BamHI restriction endonucleases to obtain an enzyme digestion gene fragment;

4. and XbaI and BamHI restriction enzyme are adopted to carry out double enzyme digestion on plasmid T2(2) -ori to obtain a linear plasmid fragment;

5. transferring the ligation product into escherichia coli DH5 α by a calcium chloride conversion method, screening by a culture medium containing kanamycin resistance at 37 ℃, screening to obtain a transformant, and carrying out colony PCR verification on a transformant selection plasmid (the used primers are T2-F and T2-R). if the PCR verification result of the transformant is that an electrophoresis band appears at 1314bp, the construction of a knockout vector is successful, wherein the transformant is a positive transformant (named as knockout vector T2(2) -delta yceD);

6. the knockout vector T2(2) -delta yceD is transferred into Bacillus licheniformis WX-02, screened by a kanamycin-resistant culture medium at 37 ℃, screened to obtain a transformant, and subjected to colony PCR verification on a transformant selection plasmid (the used primers are T2-F and T2-R). If the PCR verification result of the transformant is as follows: an electrophoretic band appeared at 1314bp, demonstrating that: the knockout vector T2(2) - Δ yceD was successfully transferred into Bacillus licheniformis WX-02, at which time the transformant was a positive transformant (i.e., Bacillus licheniformis WX-02 into which the knockout vector T2(2) - Δ yceD was transferred);

wherein the sequences of T2-F and T2-R are:

T2-F：ATGTGATAACTCGGCGTA、

T2-R：GCAAGCAGCAGATTACGC；

7. the positive transformant obtained in the step 6 is subjected to grafting culture for 3 times on a kanamycin-resistant culture medium at the temperature of 45 ℃, each time of culture is 12 hours, colony PCR detection is carried out on a single-crossover strain by taking T2-F and delta yceD-KYR as primers (or taking T2-R and delta yceD-KYF as primers), and a band with the length of 1829bp or 2906bp is amplified, namely the single-crossover strain is proved;

wherein the sequences of the delta yceD-KYF and the delta yceD-KYR are as follows:

ΔyceD-KYF：AGATTTTGGTCGGTCTCG、

ΔyceD-KYR：AATCCGCTGCCGATCGCA；

8. and (3) carrying out mixed inoculation culture on the single-crossover strain with the 1829bp band in the PCR detection obtained in the step (7) and the single-crossover strain with the 2906bp band in the PCR detection obtained in the step (7), carrying out transfer culture for a plurality of times in a culture medium without kanamycin at 37 ℃, and picking up transformants for colony PCR verification (the primers are delta yceD-KYF and delta yceD-KYR). If the PCR verification result of the transformant is as follows: when an electrophoresis strip appears at 2013bp, the gene reversion is indicated, and the transformant is bacillus licheniformis WX-02; when an electrophoresis band appears at 1560bp, the successful knockout of the yceD gene on the genome of WX-02 is shown, and the transformant is a positive transformant. Then, DNA sequencing is carried out on the positive transformant for further verification, and a yceD knockout strain (namely Bacillus licheniformis WX-02 delta yceD) with successful double crossover is obtained.

Example 2:

construction of three foreign protein expression vectors:

preparation of alkaline protease free expression plasmid pHY-AprE:

1. using Bacillus licheniformis WX-02 genome DNA as a template, designing a gene expression frame (shown in SEQ ID NO.2 and comprising a promoter, an aprE gene and a terminator) of a primer aprE-F/aprE-R amplification alkaline protease gene aprE, and obtaining an aprE gene sequence 1740 bp;

2. carrying out enzyme digestion on the obtained aprE gene by adopting EcoRI and XbaI to obtain a double enzyme digestion fragment;

3. carrying out double enzyme digestion on the bacillus expression vector pHY300PLK by adopting EcoRI and XbaI to obtain a double enzyme digestion vector fragment;

4. transferring the ligation product into Escherichia coli DH5 α by a calcium chloride conversion method, screening by a tetracycline resistance-containing culture medium at 37 ℃, screening to obtain a transformant, and carrying out colony PCR verification on a transformant plasmid (primers are pHY-F and pHY-R), if the PCR verification result of the transformant is that an electrophoresis band appears at 1992bp, the construction of the expression vector is successful, wherein the transformant is a positive transformant (named as an expression vector pHY-AprE);

AprE-F CGGAATTCTGATCTCATAAAATAAATGAATAGT

AprE-R GCTCTAGAGGGGTCATCTCTTTCGCGTCGT

pHY-F GTTTATTATCCATACCCTTAC

pHY-R CAGATTTCGTGATGCTTGTC。

preparation of keratinase free expression vector pHY-Ker:

1. using Bacillus licheniformis WX-02 genome DNA as a template, designing a primer Ker-F/Ker-R to amplify a gene cluster sequence (shown in SEQ ID NO.3 and comprising a promoter, a gene and a terminator) of an alkaline protease gene aprE, and obtaining an Ker gene fragment 1713 bp;

2. carrying out enzyme digestion on the obtained aprE gene by adopting EcoRI and XbaI to obtain a double enzyme digestion fragment after enzyme digestion;

4. transferring the ligation product into escherichia coli DH5 α by a calcium chloride conversion method, screening by a tetracycline resistance-containing culture medium at 37 ℃, screening to obtain a transformant, and performing colony PCR verification on a transformant selection plasmid (primers are pHY-F and pHY-R), wherein if the PCR verification result of the transformant is that an electrophoresis band appears at 1965bp, the construction of the expression vector is successful, and the transformant is a positive transformant (named as an expression vector pHY-Ker);

Ker-F CGGAATTCTTTACAAACGCAGTTTCGAGGCA

Ker-R GCTCTAGATGATCTCATAAAATAAATGAATAG.

preparation of neutral protease free expression vector pHY-NprE:

1. using Bacillus licheniformis WX-02 genome DNA as a template, designing a gene cluster sequence (shown in SEQ ID NO.4 and comprising a promoter, a gene and a terminator) of an alkaline protease gene aprE amplified by a primer NprE-F/NprE-R, and obtaining an aprE gene fragment 2238 bp;

4. transferring the ligation product into escherichia coli DH5 α by a calcium chloride conversion method, screening by a tetracycline resistant culture medium at 37 ℃, screening to obtain a transformant, and carrying out colony PCR verification on a transformant selection plasmid (primers are pHY-F and pHY-R), if the PCR verification result of the transformant is that an electrophoresis band appears at 2490bp, the construction of the expression vector is successful, wherein the transformant is a positive transformant (named as an expression vector pHY-NprE);

NprE-F CGGAATTCATGAAATATCTGTCGAAATGCTG

NprE-R GCTCTAGACCCTTCAAACGGAAAACCGTGG。

example 3:

construction and application of three genetic engineering bacteria for expressing foreign protein:

respectively electrically transferring the alkaline protease free expression plasmid pHY-AprE, the keratinase free expression vector pHY-Ker and the neutral protease free expression vector pHY-NprE into the Bacillus licheniformis WX-02 delta yceD, taking tetracycline resistance as a screening marker, performing colony PCR screening, taking pHY-F and pHY-R as verification primers, and performing PCR verification to obtain a positive transformant, thereby obtaining alkaline protease expression strain Bacillus licheniformis WX-02 delta yceD/pHY-AprE, keratinase expression strain Bacillus licheniformis WX-02 delta yceD/pHY-Ker and neutral protease expression strain Bacillus licheniformis WX-02 delta yceD/pHY-NprE;

in this example, the alkaline protease free expression plasmid pHY-AprE, the keratinase free expression vector pHY-Ker and the neutral protease free expression vector pHY-NprE were electroporated into Bacillus licheniformis WX-02 at the same time, and the genetically engineered alkaline protease expression strain Bacillus licheniformis WX-02/pHY-AprE, the keratinase expression strain Bacillus licheniformis WX-02/pHY-Ker and the neutral protease expression strain Bacillus licheniformis WX-02/pHY-NprE were selected as controls by the same method as described above.

In this example, the above six exogenous protein gene engineering bacteria were inoculated into 15 different fermentation media, respectively, to examine the effect of the different media on the target product, and to verify that bacillus licheniformis lacking the yceD gene could indeed improve the expression level of the exogenous protein. The formulation of the fermentation medium used in 15 is shown in Table 1.

The seed fermentation comprises the following specific steps: activating bacillus licheniformis, namely inoculating 1 percent of the bacillus licheniformis in a glycerol pipe in volume percentage into an LB culture medium containing 5mL, culturing for 12 hours at the temperature of 37 ℃ at 230r/min, and then inoculating the bacterial liquid after the bacterial activation in volume percentage according to the inoculation amount of 1 percent into a seed fermentation culture medium to culture for 10 hours at the temperature of 37 ℃ at 230r/min to obtain the bacterial liquid of seed culture;

the production and fermentation method comprises the following specific steps:

50mL of fermentation medium is filled into a 500mL triangular flask, and then the bacterial liquid (OD 6004.0-5.0) cultured by the seeds is fermented and cultured for 48 hours at the rotating speed of 230r/min and the temperature of 37 ℃ according to the inoculation amount of 2 percent (volume percentage) to obtain the bacterial liquid for producing fermentation.

The formulations of the seed fermentation medium and the fermentation medium described above are the same, as shown in table 1.

TABLE 1

The other components in the 15 culture media are: 10g/L corn steep liquor, 10g/L yeast powder, 10g/L sodium chloride and 3g/LK₂HPO₄，6g/L(NH₄)₂SO₄，pH7.0～7.2。

The three protease enzyme activities are determined according to the welfare method described in national standards of the people's republic of China.

One unit of enzyme activity (U) is defined as: under the conditions of certain temperature and certain pH value, the protease liquid hydrolyzes casein within 1min to generate 1 mu g of tyrosine.

Wherein the determination of the standard curve: the standard tyrosine solution was prepared in an isocratic solution (10, 20 … … 80, 90, 100. mu.g/mL) and the reactions described in the above documents were carried out.

The protease activity of the sample is calculated by the formula Ax4 xN/10

A, the microgrammes of tyrosine obtained by calculating the value of a sample at 660nm of a spectrophotometer through a standard curve;

n is the dilution multiple of the protease stock solution;

10-reaction time (min) of protease solution and Casein.

The difference in activity of heterologous proteases in the fermentation broth was calculated according to this method (see table 2).

According to the method, the alkaline protease activity difference in WX-02/pHY-AprE and WX-02 delta yceD/pHY-AprE zymocyte liquid is calculated (see table 2); differences in the activity of keratinase in WX-02/pHY-Ker and WX-02. delta. yceD/pHY-Ker fermenters (see Table 3); the neutral protease activity of WX-02/pHY-NprE and WX-02 Δ yceD/pHY-NprE zymocyte solutions is different (see Table 4).

TABLE 2 Alkallikrein activity statistics

TABLE 3 statistics of keratinase activity data

TABLE 4 Neutroprotease enzyme Activity data statistics

As can be seen from tables 2-4, under the same fermentation conditions, the protease activity in the fermentation liquor of the Bacillus licheniformis WX-02 delta yceD/pHY-AprE, WX-02 delta yceD/pHY-Ker and WX-02 delta yceD/pHY-NprE is greatly improved by more than 25 percent compared with that of the control bacteria. The gene engineering modification method has important application value in the aspect of improving the production of the heterologous protein of the bacillus licheniformis.

Sequence listing

<110> university of Hubei

<120> application of Bacillus licheniformis with deletion of yceD gene in production of heterologous protein

<160>20

<170>SIPOSequenceListing 1.0

<210>1

<211>582

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atggcaattt cattagcgaa aggacaaaag atcgatttaa caaaaacaaa tcccggattg 60

tcgaaagtcg tcgtgggcct tggctgggac gtcaatcaat atgacggcgg cgctgatttt 120

gacctggatg cgagcgtgtt tctgctcaat gcagaaggca aatgcgcttc tgaaaaggac 180

tttattttct ataatcagac cgaaggcgca ggcggagctg tcatacatac aggcgataat 240

cgaacaggtg aaggcgaagg agacgatgag caggtaaaaa tcaatttgaa tgcagtgcct 300

gccgacattc aaaagatttc ttttgtgatt acgattcatg aagcggaagc gcgccgccaa 360

aactttggac aggtgtcaaa tgcttatgtt cgcgtgatca atgaagactc gaatgaagag 420

ttaatccgct atgatctggg tgaagatttc tcgattgaaa cagcgctgat cacgggagag 480

ctgtaccgtc acggagaaga atggaaattc tcagcgatcg gctcaggcta tcaaggcgga 540

ctggcgagga tcgccaccga tttcggcctg caggtcggct ga 582

<210>2

<211>1740

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tgatctcata aaataaatga atagtatttt cataaaatga atcagatgga gcaatctcct 60

gtcattcgcg gccctcggga cctctttccc tgccaggctg aagcggtcta ttcatacttt 120

cgaactgaac atttttctaa aacagttatt aataaccaaa aaattttaaa ttggtcctcc 180

aaaaaaatag gcctaccata taattcattt tttttctata ataaattaac agaataattg 240

gaatagatta tattatcctt ctatttaaat tattctgaat aaagaggagg agagtgagta 300

atgatgagga aaaagagttt ttggcttggg atgctgacgg ccttcatgct cgtgttcacg 360

atggcattca gcgattccgc ttctgctgct caaccggcga aaaatgttga aaaggattat 420

attgtcggat ttaagtcagg agtgaaaacc gcatctgtca aaaaggacat catcaaagag 480

agcggcggaa aagtggacaa gcagtttaga atcatcaacg cggcaaaagc gaagctagac 540

aaagaagcgc ttaaggaagt caaaaatgat ccggatgtcg cttatgtgga agaggatcat 600

gtggcccatg ccttggcgca aaccgttcct tacggcattc ctctcattaa agcggacaaa 660

gtgcaggctc aaggctttaa gggagcgaat gtaaaagtag ccgtcctgga tacaggaatc 720

caagcttctc atccggactt gaacgtagtc ggcggagcaa gctttgtggc tggcgaagct 780

tataacaccg acggcaacgg acacggcaca catgttgccg gtacagtagc tgcgcttgac 840

aatacaacgg gtgtattagg cgttgcgcca agcgtatcct tgtacgcggt taaagtactg 900

aattcaagcg gaagcggatc atacagcggc attgtaagcg gaatcgagtg ggcgacaaca 960

aacggcatgg atgttatcaa tatgagcctt gggggagcat caggctcgac agcgatgaaa 1020

caggcagtcg acaatgcata tgcaaaaggg gttgtcgttg tagctgcagc agggaacagc 1080

ggatcttcag gaaacacgaa tacaattggc tatcctgcga aatacgattc tgtcatcgct 1140

gttggtgcgg tagactctaa cagcaacaga gcttcatttt ccagtgtggg agcagagctt 1200

gaagtcatgg ctcctggcgc aggcgtatac agcacttacc caacgaacac ttatgcaaca 1260

ttgaacggaa cgtcaatggc ttctcctcat gtagcgggag cagcagcttt gatcttgtca 1320

aaacatccga acctttcagc ttcacaagtc cgcaaccgtc tctccagcac ggcgacttat 1380

ttgggaagct ccttctacta tgggaaaggt ctgatcaatg tcgaagctgc cgctcaataa 1440

catattctaa caaatagcat atagaaaaag ctagtgtttt tagcactagc tttttcttca 1500

ttctgatgag ggttgttcaa tattttgaat ccgttccatg atcgtcggat ggccgtattt 1560

aaaaatcttg acgagaaacg gcgggtttgc ctcgctcagc ccggcttttg agagctcttg 1620

aaacgtcgaa accgctgcat cgctgttttg cgtcagttca atcgcatact ggtcagcagc 1680

tttttcctga tgcctcgaaa ctgcgttcgt aaatggagac gacgcgaaag agatgacccc 1740

<210>3

<211>1713

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tttacaaacg cagtttcgag gcatcaggaa aaagccgctg accagtatgc gattgaactg 60

acgcaaaaca gcgatgcagc ggtttcgacg tttcaagagc tctcaaaagc cgggctgagc 120

gaggcaaacc cgccgtttct cgtcaagatt tttaaatacg gccatccgac gatcatggaa 180

cggattcaaa atattgaaca gtcttcatca gaatgaagaa aaagctagtg ctaaaaacac 240

tagctttttc tatatgctat ttgttagaat atgttattga gcggcagctt cgacattgat 300

cagacctttc ccatagtaga aggagcttcc caaataagtc gccgtgctgg agagacggtt 360

gcggacttgt gaagctgaaa ggttcggatg ttttgacaag atcaaagctg ctgctcccgc 420

tacatgagga gaagccattg acgttccgtt caatgttgca taagtgttcg ttgggtaagt 480

gctgtatacg cctgcgccag gagccatgac ttcaagctct gctcccacac tggaaaatga 540

agctctgttg ctgttagagt ctaccgcgcc aacagcgatg acagaatcgt atttcgcagg 600

atagccaatt gtattcgtgt ttcctgaaga tccgctgttc cctgctgcag ctacaacgac 660

aacccctctt gcatatgcat tgtcgactgc ctgtttcatc gctgtcgagc ctgatgctcc 720

cccaaggctc atattgataa catccatgcc gtttgttgtc gcccactcga ttccgcttac 780

aatgccgctg tatgatccgc ttccgcttga attcagtact ttaaccgcgt acaaggatac 840

gcttggcgca acgcctaata cacccgttgt attgtcaagc gcagctactg taccggcaac 900

atgtgtgccg tgtccgttgc cgtcggtgtt ataagcttcg ccagccacaa agcttgctcc 960

gccgactacg ttcaagtccg gatgagaagc ttggattcct gtatccagga cggctacttt 1020

tacattcgct cccttaaagc cttgagcctg cactttgtcc gctttaatga gaggaatgcc 1080

gtaaggaacg gtttgcgcca aggcatgggc cacatgatcc tcttccacat aagcgacatc 1140

cggatcattt ttgacttcct taagcgcttc tttgtctagc ttcgcttttg ccgcgttgat 1200

gattctaaac tgcttgtcca cttttccgcc gctctctttg atgatgtcct ttttgacaga 1260

tgcggttttc actcctgact taaatccgac aatataatcc ttttcaacat ttttcgccgg 1320

ttgagcagca gaagcggaat cgctgaatgc catcgtgaac acgagcatga aggccgtcag 1380

catcccaagc caaaaactct ttttcctcat cattactcac tctcctcctc tttattcaga 1440

ataatttaaa tagaaggata atataatcta ttccaattat tctgttaatt tattatagaa 1500

aaaaaatgaa ttatatggta ggcctatttt tttggaggac caatttaaaa ttttttggtt 1560

attaataact gttttagaaa aatgttcagt tcgaaagtat gaatagaccg cttcagcctg 1620

gcagggaaag aggtcccgag ggccgcgaat gacaggagat tgctccatct gattcatttt 1680

atgaaaatac tattcattta ttttatgaga tca 1713

<210>4

<211>2238

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgaaatatc tgtcgaaatg ctgaataaaa tgactgaaaa tctctgacat ctgtaacaat 60

cctttacgtt tattaaggcc tcacccgttt agacaaccgg cattcaaaaa agttttaaag 120

atcttaacat ttttccccta tcatttttcc cgtcttcatt tgtcattttt tccagaaaaa 180

atcgcgtcat tcgactcatg tctaatccaa cacgtgtctc tcggcttatc ccctgacacc 240

gcccgccgac agcccgcatg ggacgattct atcaattcag ccgcggagtc tagttttata 300

ttgcagaatg cgagattgct ggtttattat aacaatataa gttttcatta ttttcaaaaa 360

gggggattta ttgtgggttt aggtaagaaa ttgtctgttg ctgtcgccgc ttcctttatg 420

agtttaacca tcagtctgcc gggtgttcag gccgctgaga atcctcagct taaagaaaac 480

ctgacgaatt ttgtaccgaa gcattctttg gtgcaatcag aattgccttc tgtcagtgac 540

aaagctatca agcaatactt gaaacaaaac ggcaaagtct ttaaaggcaa tccttctgaa 600

agattgaagc tgattgacca aacgaccgat gatctcggct acaagcactt ccgttatgtg 660

cctgtcgtaa acggtgtgcc tgtgaaagac tctcaagtca ttattcacgt cgataaatcc720

aacaacgtct atgcgattaa cggtgaatta aacaacgatg tttccgccaa aacggcaaac 780

agcaaaaaaa tatctgcaaa tcaggcgctg gatcatgctt ataaagcgat cggcaaatca 840

cctgaagccg tttctaacgg aaccgttgca aacaaaaaca aagccgagct gaaagcagca 900

gccacaaaag acggcaaata ccgcctcgcc tatgatgtaa ccatccgcta catcgaaccg 960

gaacctgcaa actgggaagt aaccgttgat gcggaaacag gaaaaatcct gaaaaagcaa 1020

aacaaagtgg agcatgccgc cacaaccgga acaggtacga ctcttaaagg aaaaacggtc 1080

tcattaaata tttcttctga aagcggcaaa tatgtgctgc gcgatctttc taaacctacc 1140

ggaacacaaa ttattacgta cgatctgcaa aaccgcgagt ataacctgcc gggcacactc 1200

gtatccagca ccacaaacca gtttacaact tcttctcagc gcgctgccgt tgatgcgcat 1260

tacaacctcg gcaaagtgta tgattatttc tatcagaagt ttaatcgcaa cagctacgac 1320

aataaaggcg gcaagatcgt atcctccgtt cattacggca gcagatacaa taacgcagcc 1380

tggatcggcg accaaatgat ttacggtgac ggcgacggtt cattcttctc acctctttcc 1440

ggttcaatgg acgtaaccgc tcatgaaatg acacatggcg ttacacagga aacagccaac 1500

ctgaactacg aaaatcagcc gggcgcttta aacgaatcct tctctgatgt attcgggtac 1560

ttcaacgata ctgaggactg ggatatcggt gaagatatta cggtcagcca gccggctctc 1620

cgcagcttat ccaatccgac aaaatacgga cagcctgata atttcaaaaa ttacaaaaac 1680

cttccgaaca ctgatgccgg cgactacggc ggcgtgcata caaacagcgg aatcccgaac 1740

aaagccgctt acaatacgat tacaaaaatc ggcgtgaaca aagcggagca gatttactat 1800

cgtgctctga cggtatacct cactccgtca tcaactttta aagatgcaaa agccgctttg 1860

attcaatctg cgcgggacct ttacggctct caagatgctg caagcgtaga agctgcctgg 1920

aatgcagtcg gattgtaaac aagaaaagag accggaaatc cggtctcttt tttatatcta 1980

aaaacatttc acagtggctt caccatgatc atatatgtct tttcccgatc gtctttttca 2040

agcttcagct gttcaaagcc gcactggctt aaaaacaaca cccattcctg cctggcaagg 2100

ggaacggctg taaacatcgc tttatgctcc gctctcagcc ggccggcaat ctcttcaatg 2160

accgcgcgcc cgattccttt ctcttttgcc tccggagcga cggccacagt tccgagccac 2220

ggttttccgt ttgaaggg 2238

<210>5

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gatcttttct acgagctcga acaagaacgt cattta 36

<210>6

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

atttccattc ttctccgtcg tcgtgggcct tggctg 36

<210>7

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

cagccaaggc ccacgacgac ggagaagaat ggaaat 36

<210>8

<211>36

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gtggcggccg ctctagaaaa agttttggct gcggct 36

<210>9

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

atgtgataac tcggcgta 18

<210>10

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gcaagcagca gattacgc 18

<210>11

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

agattttggt cggtctcg 18

<210>12

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

aatccgctgc cgatcgca 18

<210>13

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

cggaattctg atctcataaa ataaatgaat agt 33

<210>14

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gctctagagg ggtcatctct ttcgcgtcgt 30

<210>15

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gtttattatc cataccctta c 21

<210>16

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

cagatttcgt gatgcttgtc 20

<210>17

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

cggaattctt tacaaacgca gtttcgaggc a 31

<210>18

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gctctagatg atctcataaa ataaatgaat ag 32

<210>19

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

cggaattcat gaaatatctg tcgaaatgct g 31

<210>20

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gctctagacc cttcaaacgg aaaaccgtgg 30

Claims

1. The application of Bacillus licheniformis of deletion yceD gene in the production of heterologous protein, wherein the yceD gene is shown in SEQ ID No. 1.

2. The use according to claim 1, wherein the heterologous protein is an alkaline protease, a keratinase or a neutral protease.

3. The use of claim 1, wherein the bacillus licheniformis is bacillus licheniformis WX-02.

4. The use according to claim 1, in a method of knockout of the yceD gene in bacillus licheniformis, comprising the steps of:

5. Use according to claim 2, when using Bacillus licheniformis lacking the yceD gene for the production of heterologous proteins of alkaline protease, or keratinase or neutral protease, the fermentation medium used has a formulation comprising: 10-20g/L glucose, 5-13g/L soybean peptone, 8-12g/L corn steep liquor, 7-11g/L yeast powder, 8-12g/L sodium chloride, 2-5g/L K₂HPO₄And 4-8g/L (NH)₄)₂SO₄(ii) a Or 5-10g/L bone peptone, 5-13g/L soybean peptone, 8-12g/L corn steep liquor, 7-11g/L yeast powder, 8-12g/L sodium chloride, 2-5g/L K₂HPO₄And 4-8g/L (NH)₄)₂SO₄。